Molecular marker combination of wheat pre-harvest sprouting resistance related genes and application of molecular marker combination

Abstract

The invention relates to the technical field of plant breeding, in particular to a molecular marker combination of wheat pre-harvest sprouting resistance related genes and application of the molecular marker combination. The molecular marker combination comprises a nucleotide sequence as shown in SEQ ID NO.1-3; the 102nd site of the nucleotide sequence as shown in SEQ ID NO.1 has polymorphism, and the polymorphism is A / T; the 107th site of the nucleotide sequence as shown in SEQ ID NO.2 has polymorphism, and the polymorphism is C / G; the 24th site of the nucleotide sequence as shown in SEQ ID NO.3 has polymorphism, and the polymorphism is G / C. The invention provides a molecular marker combination related to wheat pre-harvest sprouting resistance genes OCO1, LCYE and WRKY2, and the molecular marker combination has high accuracy when being applied to detection of wheat pre-harvest sprouting resistance characters and has important significance in the field of wheat breeding.

Description

Technical Field

[0001] The present invention relates to the technical field of plant breeding, and in particular to a molecular marker combination of wheat ear sprouting resistance-related genes and an application thereof. Background Art

[0002] Wheat ear sprouting can cause a series of physiological and biochemical changes, including the activity of plant hormones and hydrolases, the decomposition of grain protein and storage materials, and drastic changes in grain quality characteristics, which can lead to a decrease in yield and unsuitability for processing, thus affecting economic benefits. At present, once wheat ear sprouting occurs in wheat producing areas, it will cause direct and indirect economic losses to local farmers.

[0003] The wheat OCO1 gene is located in a 2.4 Mb presence / absence (PAV) variation interval on chromosome 3D. This interval is missing in most white-grain wheat varieties, and wheat is susceptible to ear sprouting, while most wheat materials containing this interval have the ability to resist ear sprouting, indicating that the OCO1 gene is closely linked to the wheat ear sprouting resistance phenotype. It is currently known that a variety of plant hormones can affect ear sprouting resistance, among which abscisic acid (ABA) is the main regulatory hormone. The initial synthesis of ABA occurs in the cytoplasm, and LCYE is responsible for the conversion of lycopene to lutein and β-carotene, and participates in the biosynthesis of carotenoids. Carotenoids are catalyzed by ZEP-encoded zeaxanthin epoxidase to form violaxanthin, which is then oxidized to form flavonoid aldehyde by 9-cis-epoxycarotenoid dioxygenase. Flavonoid aldehyde is then transported to the cytosol, catalyzed by short-chain alcohol dehydrogenase and aldehyde oxidase, and activated by ABA3-encoded molybdenum cofactor sulfurylase, to finally form biologically active ABA. ABA is also involved in plant stress responses, in which WRKY transcription factors play an important role. Transgenic Arabidopsis overexpressing TaWRKY2 has improved tolerance to salt, drought and / or freezing stress compared to wild-type plants. Regulating TaWRKY2 in wheat or other crops could improve their tolerance to various abiotic stress conditions, including tolerance to spike sprouting.

[0004] Molecular marker-assisted breeding uses molecular markers that are closely linked and co-segregated with the target gene to accurately analyze the genotype and phenotype of different individuals in the hybrid offspring, thereby assisting in selection. Compared with traditional breeding, molecular marker-assisted breeding has the advantages of shortening the breeding period, improving breeding efficiency, saving manpower and material resources, being free from time and environmental restrictions, and being able to select samples at different stages or under multiple environmental conditions. However, the screening efficiency of existing markers is low and cannot meet the needs of large-scale breeding screening. Summary of the invention

[0005] In order to solve the problems existing in the prior art, the present invention provides a molecular marker combination of wheat ear sprouting resistance related genes and application thereof.

[0006] In a first aspect, the present invention provides a molecular marker combination, the molecular marker combination comprising the nucleotide sequence shown in SEQ ID NO.1-3; As shown in SEQ ID NO.1, the nucleotide sequence at position 102 has a polymorphism, and the polymorphism is A / T; As shown in SEQ ID NO.2, the nucleotide sequence at position 107 has a polymorphism, and the polymorphism is C / G; As shown in SEQ ID NO.3, the nucleotide sequence at position 24 has a polymorphism, and the polymorphism is G / C.

[0007] The nucleotide sequence shown in SEQ ID NO.1: TGATAGCCTTAGACGAGACGCATTATCAAGACGGTTACAAAGATGGTTATGATGATGGCATGGTATCTGGAAAAGAAGAAGGAAGGCAGGTCGGTTTAAAGTTGGGTTTCCAGGTAGGTGA.

[0008] The nucleotide sequence shown in SEQ ID NO.2: CGTCAGCGCTCATTCTTCCTCTTTGGATTGGCCTTGATAATTCAACTGGATAACGAAGGCATTCAAACATTCTTCGAGAGCTTTTTCCGGTTACCCAAATGGATGTGGCGAGGATTCCTTGGTTCGA.

[0009] The nucleotide sequence shown in SEQ ID NO.3: CAAGTGGTAGAAGTGAGCAACAAGAGCAGCAGCGGCGACAACAACAAGCAGGTTGAGGACGGATACAATTGGAGGAAGTACGGGCAGAAGCAAGTTAAGGGCAGCGAGAACCCGCGAGCTACTACAAGTGCACCTA.

[0010] In a second aspect, the present invention provides a primer combination, comprising an OCO1 primer pair, a LCYE primer pair and a WRKY2 primer pair; The OCO1 primer pair includes: TaOCO1_D_COM:TGATAGCCTTAGACGAGACGC,

[0011] TaOCO1_D_FAM:TCACCTACCTGGAAACCCAA,

[0012] TaOCO1_D_HEX:TCACCTACCTGGAAACCCAT; The LCYE primer pair includes: LCYE_B_1451_COM:CGTCAGCGCTCATTCTTCCTC,

[0013] LCYE_B_1451_FAM: TCGAACCAAGGAATCCTCGCC,

[0014] LCYE_B_1451_HEX: TCGAACCAAGGAATCCTCGCG; The WRKY2 primer pair includes: WRKY2_B_524_COM:TAGGTGCACTTGTAGTAGCTCC,

[0015] WRKY2_B_524_FAM:CAAGTGGTAGAAGTGAGCAACAAG,

[0016] WRKY2_B_524_HEX:CAAGTGGTAGAAGTGAGCAACAAC.

[0017] Further, fluorescent molecules can be connected to the primers including the polymorphic sites, for example, FAM can be connected to the primers labeled with FAM as above, and HEX can be connected to the primers labeled with HEX. In fact, other fluorescent molecules can be connected in addition to FAM and HEX, such as Cy3, Cy5, TET or ROX.

[0018] The nucleotide sequence of FAM includes: gaaggtgaccaagttcatgct, and the nucleotide sequence of HEX includes: gaaggtcggagtcaacggatt.

[0019] In a third aspect, the present invention provides a kit comprising the molecular marker combination or the primer combination.

[0020] In a fourth aspect, the present invention provides the use of the molecular marker combination, the primer combination or the kit in detecting wheat ear sprouting resistance.

[0021] The present invention further provides the use of the molecular marker combination, the primer combination or the kit in any of the following: i) Detection of wheat ear sprout resistance-related genes OCO1, LCYE and WRKY2; ii) Cultivating wheat with low ear germination rate; iii) Molecular marker-assisted breeding of wheat; iv) identification of wheat germplasm resources; v) Improved wheat germplasm resources.

[0022] In a fifth aspect, the present invention provides a method for identifying wheat ear germination resistance, comprising: The polymorphism of the molecular marker combination of the wheat to be tested is detected, and the ear sprouting resistance of the wheat to be tested is determined according to the detection result.

[0023] Further, including: The genomic DNA of the wheat to be tested is extracted, and PCR amplification is performed using the above-mentioned KASP primer combination, and the ear sprouting resistance of the wheat to be tested is determined according to the amplification result.

[0024] Furthermore, based on a total system of 10 μL, the PCR amplification reaction system includes: 2× KASP Master Mix 5~10 μL, KASP Assay Mix 1~3 μL, wheat template DNA with a concentration of 50~150 ng / μL 1~3 μL, MgCl2 0.05~0.3 μL, and the balance is ddH2O; The reaction procedure includes: 93~97℃ 8~15min; 93~97℃ 15~30s, 61~55℃ 30~60s, decrease 0.5~1℃ each cycle, for 10~15 cycles in total; 93~97℃ 15~30s, 52~60℃ 30~60s, for 30~40 cycles in total.

[0025] Further, judging the spike sprouting resistance of the wheat to be tested according to the test results includes: As shown in SEQ ID NO.1, wheat with a molecular marker detection result of T has a higher ear sprout resistance than wheat with C; As shown in SEQ ID NO.2, the wheat with the molecular marker detection result of C has higher ear sprout resistance than that of G; As shown in SEQ ID NO.3, the molecular marker detection result of wheat G has higher ear sprouting resistance than that of wheat C.

[0026] Furthermore, a primer combination labeled with a fluorescent molecule may be used for detection, and the detection result of the molecular marker may be determined based on the fluorescence detection result.

[0027] For example, TaOCO1_D_FAM, LCYE_B_1451_FAM and WRKY2_B_524_FAM primers are labeled with FAM; TaOCO1_D_HEX, LCYE_B_1451_HEX and WRKY2_B_524_HEX primers are labeled with HEX.

[0028] At this time, if the fluorescence detection results are marked as blue and orange, it means that the genotype of the sample wheat is two different homozygous types. If the fluorescence detection results are marked as green, it means that the genotype of the sample wheat is heterozygous. If the fluorescence detection results are marked as black, it means that the genotype of the sample wheat is blank.

[0029] When OCO1 fluorescence is detected as orange, LCYE is C at the 1451st base of the coding sequence and the fluorescence is orange, and WRKY2-B is G at the 524th base of the coding sequence and the fluorescence is orange, the wheat's anti-ear sprouting ability is the highest.

[0030] The present invention has the following beneficial effects: The present invention screens and obtains new SNP sites for wheat spike sprout resistance-related genes OCO1, LCYE and WRKY2, and designs corresponding KASP primer combinations. Based on the polymorphism detection results of these SNP sites, the detection of wheat spike sprout resistance traits can be achieved. The SNP sites and KASP primer combinations provided by the present invention can be used for wheat germplasm resource improvement, and have important application value in the field of wheat breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0032] Figure 1 It is a schematic diagram of primer development provided in Example 1 of the present invention.

[0033] Figure 2 This is the evaluation and detection result of the KASP primer combination designed and obtained in Example 1 provided in Example 2 of the present invention.

[0034] Figure 3 This is the evaluation and detection result of the KASP primer combination in the parent population of Citi wheat×Chuanmai 23 provided in Example 3 of the present invention.

[0035] Figure 4This is the evaluation and detection result of KASP primer combination in the parent population of Citi wheat×Yanfeng 168 provided in Example 4 of the present invention. DETAILED DESCRIPTION

[0036] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be clearly and completely described below in conjunction with the drawings of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0037] The experimental methods involved in the following examples, unless otherwise mentioned, are all conventional methods in the art, for example, reference may be made to experimental manuals in the art, or the conditions recommended in the manufacturer's instructions.

[0038] Unless otherwise specified, the experimental materials and reagents involved in the following examples can be obtained from commercial sources.

[0039] Example 1

[0040] In this example, sequence analysis and molecular marker development were performed on wheat ear sprout resistance-related genes OCO1, LCYE, and WRKY2-B, and the process was as follows: The present invention searches for literature and databases related to genes related to seed dormancy germination and ABA signals, and finds genes OCO1, LCYE, and WRKY2-B that may be related to spike germination. Among them: The OCO1 gene ID is TraesCS3D02G468600, the copy number is 3, chromosome 3A / 3B / 3D, and the gene coding sequence length is 411; The LCYE gene ID is TraesCS3B03G0624200, copy number 3, chromosome 3 A / 3B / 3D, and the gene coding sequence length is 1611; The WRKY2-B gene ID is TraesCS1B03G0235500, the copy number is 3, chromosome 1A / 1B / 1D, and the gene coding sequence length is 1377.

[0041] The present invention further obtains SNP sites linked to genes OCO1, LCYE, and WRKY2-B by comparison and screening based on the gene sequence of wheat (search literature). The polymorphism of these SNP sites will cause changes in the amino acid sequence. The present invention further designs KASP primers for these SNP sites (primer development schematic diagram as shown in Figure 1Finally, the artificially designed primers were evaluated using the Ensembleplants website (http: / / plants.ensembl.org / ), and the SNP sites obtained were as follows: The SNP site of the OCO1 gene is located at the 121st position of its coding sequence, and the polymorphism is A / T.

[0042] The SNP site of LCYE gene is located at the 1451st position of its coding sequence, and the polymorphism is C / G.

[0043] The SNP site of the WRKY2-B gene is located at the 524th position of its coding sequence, and the polymorphism is C / G.

[0044] The KASP primer combination designed by the present invention includes the following primers: Table 1 Primer names and sequences

[0045] The KASP labeling system includes two specific primers and one universal primer. The front end of one specific primer is added with a specific sequence GAAGGTGACCAAGTTCATGCT that can bind to FAM fluorescence; the front end of the other specific primer is added with a specific sequence GAAGGTCGGAGTCAACGGATT that can bind to HEX fluorescence. The primer sequences were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0046] Example 2

[0047] This example provides the application of the KSAP primer combination provided in Example 1 in the identification of natural wheat populations.

[0048] 1. Experimental Materials

[0049] The specific wheat names involved in the examples are shown in Tables 2-5, including local wheat varieties, conventionally bred varieties and foreign wheat varieties. All materials in the following examples are stored and provided by the Crop Genetics and Breeding Team of the Wheat Research Institute of Sichuan Agricultural University.

[0050] Table 2 Biological material information - Part I

[0051] Table 3 Biological material information - Part II

[0052] Table 4 Biological material information - Part III

[0053] Table 5 Biological material information - Part 4

[0054] The seeds of all the test materials in Tables 2 to 5 were germinated at room temperature for about 7 days, young leaves were cut, and genomic DNA was extracted using the conventional CTAB method (this extraction method is a conventional method, and the extraction method used in this example can be found in the literature (Porebski S, Bailey LG, Baum BR. Modification of a CTAB DNA extraction protocol for plants containing high polysaccharide and polyphenol components [J]. Plant molecular biology reporter, 1997, 15: 8-15).

[0055] PCR amplification was performed using the KASP primers designed in Table 1.

[0056] PCR reaction system: 2× KASP Master Mix 5 μL (Beijing Jiacheng), KASP Assay Mix 1.4 μL, wheat template DNA 1 μL with a concentration of 100 ng / μL, MgCl2 0.08 μL, supplemented to 10 μL with ddH2O; wherein, each 100 μL of the KASP Assay Mix includes: the primer FAM 12 μL with a concentration of 100 μM, the primer HEX 12 μL with a concentration of 100 μM, the universal primer 30 μL with a concentration of 100 μM, supplemented to 100 μL with ddH2O; The PCR reaction program was as follows: 95°C for 10 min; 95°C for 20 s, 61-55°C for 40 s, 0.6°C lowered in each cycle, for 10 cycles; 95°C for 20 s, 55°C for 40 s, for 35 cycles. The PCR results were analyzed by scanning with a KASP fluorescence analyzer (Bio-Rad model CFX96 Touch Real-Time PCR Detection System).

[0057] The wheat grains in Table 3 were collected in the field and dried in the shade at room temperature for 7 days. After threshing, 50 grains were taken for grain germination experiment, which was repeated three times. The rupture of the epidermis of the grain embryo was used as the germination standard, and the average grain germination rate was calculated on the 7th day.

[0058] Table 6 Results of molecular marker t test

[0059] Table 7 OCO1-LCYE-WRKY2 marker combination detection results

[0060] The fluorescence detection results of molecular markers are as follows Figure 2 As shown: All markers were successfully typed, FAM was orange, HEX was blue, heterozygous was green, and blank was black. The marker detection results and grain germination rate are listed in Table 6. The relationship between different SNPs and grain germination rate was analyzed according to genotype and grain germination rate. The results are shown in Table 6, indicating that these intragenic markers are associated with germination rate; the excellent SNPs in the three genes OCO1, LCYE and WRKY2-B are T, C and G respectively. The present invention then statistically analyzed the excellent allele combination effects of the three genes OCO1, LCYE and WRKY2-B in the wheat population, and the results are shown in Table 7. When the SNP type of the three genes is TCG, the grain germination rate is significantly lower than that of other combinations ( P ≤0.01), indicating that the aggregation of the excellent SNP types (TCG) of these three genes can effectively reduce the germination rate and improve the resistance to wheat ear germination. Therefore, the detection of the aggregation of this marker combination in wheat materials can provide a reference for the breeding of wheat ear germination resistance materials.

[0061] Example 3

[0062] This example applies the KASP primer combination provided in Example 1 to the selection of wheat materials resistant to ear sprouting in the progeny of the biparental population of Citi wheat×Chuanmai 23, including the following process: 1. Experimental Materials

[0063] Huati wheat is resistant to ear sprouting, and the marker detection result of OCO1-LCYE-WRKY2 is TCG; Chuanmai 23 is susceptible to ear sprouting, and the marker detection result of OCO1-LCYE-WRKY2 is AGG. The materials in the following table are the F3 hybrid population of Huati wheat × Chuanmai 23. All materials in the following examples are preserved and provided by the Crop Genetics and Breeding Team of the Wheat Research Institute of Sichuan Agricultural University.

[0064] 2. Experimental methods

[0065] Genotype segregation and ear sprout resistance / susceptibility phenotype segregation will occur in the population of Citi wheat × Chuanmai 23. In order to verify whether the KASP primer combination provided in Example 1 can screen out ear sprout resistance materials, the present invention first starts with the OCO1 genotype. DNA is extracted from field leaves, amplified using the KASP primers of the present invention, and the genotypes of LCYE and WRKY2 are then detected from the detected OCO1 excellent allele type (T). Finally, the materials with excellent SNP types (TCG) of the three genes aggregated together are screened. Grains at the wax maturity stage are collected and their grain germination rate is detected.

[0066] 3. Experimental results

[0067] The test results are statistically shown as Figure 3 It shows that the aggregation of excellent SNP types (TCG) of these three genes can effectively reduce the germination rate, thereby screening out wheat materials with resistance to ear sprouting.

[0068] Table 8 Marker detection results in the parental population of Citi wheat × Chuanmai 23 - Part I

[0069] Table 9 Marker detection results in the parental population of Citi wheat × Chuanmai 23 - Part II

[0070] Table 10 Marker detection results in the parent population of Citi wheat × Chuanmai 23 - Part III

[0071] Example 4

[0072] The present invention further applies the KASP primer combination provided in Example 1 to the detection of ear sprout resistance trait of progeny of Citi wheat×Yanfeng 168.

[0073] 1. Experimental materials: Citi wheat is resistant to ear sprouting, and the marker detection result of OCO1-LCYE-WRKY2 is TCG; Yanfeng 168 is susceptible to ear sprouting, and the marker detection result of OCO1-LCYE-WRKY2 is AGG. The materials in the following table are Citi wheat × Yanfeng 168 F3 hybrid populations. All materials in the following examples are preserved and provided by the Crop Genetics and Breeding Team of the Wheat Research Institute of Sichuan Agricultural University.

[0074] 2. Experimental methods: In the population of Citi wheat × Yanfeng 168, there will be genotype segregation and resistant / susceptible ear sprout phenotype segregation. In order to verify whether the marker primer combination of the present invention can screen out anti-ear sprout materials, this experiment used the developed KASP marker primer set to detect the genotypes of OCO1 and LCYE. WRKY2 did not have genotype segregation in the parents. DNA was extracted from field leaves and amplified using the KASP primers of the present invention; grains at the wax-mature stage were collected and their grain germination rate was detected.

[0075] 3. Experimental results: The test results are statistically shown as Figure 4 It shows that the aggregation of excellent SNP types (TCG) of these three genes can effectively reduce the germination rate, thereby screening out wheat materials with resistance to ear sprouting.

[0076] Table 11 Marker detection results in the parental population of Citi wheat × Yanfeng 168 - Part I

[0077] Table 12 Marker detection results in the parental population of Citi wheat × Yanfeng 168 - Part II

[0078] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A molecular marker combination, characterized in that: The molecular marker combination includes the nucleotide sequence shown in SEQ ID NO.1-3; As shown in SEQ ID NO.1, the nucleotide sequence at position 102 has a polymorphism, and the polymorphism is A / T; As shown in SEQ ID NO.2, the nucleotide sequence at position 107 has a polymorphism, and the polymorphism is C / G; As shown in SEQ ID NO.3, the nucleotide sequence at position 24 has a polymorphism, and the polymorphism is G / C.

2. A primer combination, characterized in that: Includes OCO1 primer pair, LCYE primer pair and WRKY2 primer pair; The OCO1 primer pair includes: TaOCO1_D_COM:TGATAGCCTTAGACGAGACGC, TaOCO1_D_FAM:TCACCTACCTGGAAACCCAA, TaOCO1_D_HEX:TCACCTACCTGGAAACCCAT; The LCYE primer pair includes: LCYE_B_1451_COM:CGTCAGCGCTCATTCTTCCTC, LCYE_B_1451_FAM: TCGAACCAAGGAATCCTCGCC, LCYE_B_1451_HEX: TCGAACCAAGGAATCCTCGCG; The WRKY2 primer pair includes: WRKY2_B_524_COM:TAGGTGCACTTGTAGTAGCTCC, WRKY2_B_524_FAM:CAAGTGGTAGAAGTGAGCAACAAG, WRKY2_B_524_HEX:CAAGTGGTAGAAGTGAGCAACAAC.

3. A kit, characterized in that: It includes the molecular marker combination according to claim 1 or the primer combination according to claim 2.

4. Use of the molecular marker combination according to claim 1, the primer combination according to claim 2, or the kit according to claim 3 in detecting wheat ear sprouting resistance.

5. Use of the molecular marker combination according to claim 1 or the primer combination according to claim 2, or the kit according to claim 3 in any of the following: i) Detection of wheat ear sprout resistance-related genes OCO1, LCYE and WRKY2; ii) Cultivating wheat with low ear germination rate; iii) Molecular marker-assisted breeding of wheat; iv) identification of wheat germplasm resources; v) Improved wheat germplasm resources.

6. A method for identifying wheat ear sprout resistance, characterized in that: include: Detect the polymorphism of the molecular marker combination of the wheat to be tested as claimed in claim 1, and determine the ear sprouting resistance of the wheat to be tested according to the detection result.

7. The method according to claim 6, characterized in that include: The genomic DNA of the wheat to be tested is extracted, and PCR amplification is performed using the KASP primer combination described in claim 2, and the ear sprout resistance of the wheat to be tested is determined according to the amplification result.

8. The method according to claim 7, characterized in that Based on a total system of 10 μL, the PCR amplification reaction system includes: 2× KASP Master Mix 5~10 μL, KASP Assay Mix 1~3 μL, wheat template DNA with a concentration of 50~150 ng / μL 1~3 μL, MgCl2 0.05~0.3 μL, and the balance is ddH2O; The reaction procedure includes: 93~97℃ 8~15min; 93~97℃ 15~30s, 61~55℃ 30~60s, decrease 0.5~1℃ each cycle, for 10~15 cycles in total; 93~97℃ 15~30s, 52~60℃ 30~60s, for 30~40 cycles in total.

9. The method according to any one of claims 6 to 8, characterized in that: The step of judging the spike sprouting resistance of the wheat to be tested according to the test results comprises: As shown in SEQ ID NO.1, wheat with a molecular marker detection result of T has a higher ear sprout resistance than wheat with C; As shown in SEQ ID NO.2, the wheat with the molecular marker detection result of C has higher ear sprout resistance than that of G; As shown in SEQ ID NO.3, the molecular marker detection result of wheat G has higher ear sprouting resistance than that of wheat C.

Images