Potato high-temperature inducible promoter pStHSFA2 and application thereof

Abstract

The invention provides a potato high-temperature inducible promoter pStHSFA2 and application thereof.The nucleotide sequence of the potato high-temperature inducible promoter pStHSFA2 is shown as SEQ ID No.1. The potato high-temperature inducible promoter pStHSFA2 is remarkably induced by high temperature, has high-temperature specific expressivity and can serve as a specific promoter to drive specific expression of a target gene under the high-temperature condition, and the specific expression of the target gene under the high-temperature condition is achieved. The method can avoid adverse effects caused by continuous expression of target genes, and has wide application value in the fields of plant genetic engineering and germplasm resource improvement.

Description

Technical Field

[0001] The invention belongs to the field of plant gene engineering technology and molecular biology, and specifically relates to the separation, identification and application of a potato high temperature inducible promoter pStHSFA2. Background Art

[0002] Plants are subject to stress from many environmental factors during their growth and development, among which temperature has a particularly serious impact on plant growth and development. As global temperatures continue to rise, high temperature stress has become one of the important factors affecting plant growth and development. High temperature stress has a wide range of effects on plant growth and development. On a macro level, it can cause problems such as water shortage in plants, inhibition of seed germination, abnormal growth, male sterility, and reduced yields of cereal crops; on a physiological level, high temperature stress can cause plant stomata to close, photosynthesis to decrease, and important signals and metabolic processes such as water relations, dry matter production, respiration, mineral metabolism, hormone balance, and antioxidant systems in the body to change; and on a molecular level, high temperature stress can cause hazards such as protein misfolding and changes in RNA / DNA structure.

[0003] High temperature is considered to be one of the most important environmental factors affecting potato plant growth and tuber yield. Under high temperature stress, potato seedlings grow slowly, leaves wilt or even turn yellow and damaged, leaves become shorter, and leaves and petioles curl significantly. High temperature stress during the tuber stage will cause delayed potato tuber development, an increase in deformed potatoes, a decrease in the number of runners per plant, a significant decrease in the commercial potato rate and the number of tubers, an increase in the rate of viral diseases, and a decrease in yield. High temperature stress will not only reduce potato yield, but also cause a decrease in tuber quality. High temperature during the tuber stage reduces the activity of key enzymes for starch synthesis in potato tubers and reduces the starch synthesis rate, resulting in less starch accumulation in the tubers, and a significant decrease in the content of nutrients such as reducing sugars and dry matter. At the same time, high temperature stress will also cause an increase in the content of sterol glycoalkaloids in the tubers, which seriously affects the taste of the tubers. Therefore, it is very important to analyze the molecular mechanism of potato's high temperature resistance and cultivate potato varieties that are resistant to high temperatures.

[0004] In the current field of potato stress-resistant variety breeding, constitutive promoters are often used to overexpress stress response-related genes to improve plant stress resistance. Although constitutive promoters have the advantage of high overexpression effects, the constitutive expression of exogenous genes usually causes unnecessary waste of resources. At the same time, the accumulation of a large amount of heterologous proteins will also break the original metabolic balance of the plant and hinder the normal growth of the plant. Therefore, inducible promoters that can drive the expression of exogenous genes in a specific environment have gradually become the focus of research. In the study of the molecular mechanism of potato high temperature resistance, high temperature inducible promoters are needed to upregulate the expression of target genes, and then analyze the function of target genes in potato response to high temperature stress, and minimize the adverse effects of target genes on other tissues and organs. At present, there have been relevant reports on high temperature inducible promoters. The alfalfa MsMBF1c promoter can be significantly activated by high temperature induction and can be used as a high temperature inducible promoter for scientific research and production practice; the konjac AaHSFB1 promoter contains the heat stress response element HSE and a variety of cis-acting elements related to plant development and stress response. After heat stress treatment, the activity of the AaHSFB1 promoter is significantly enhanced; after high temperature treatment, the promoter activity of soybean GmGolSP is enhanced, which increases the expression of the downstream reporter gene GUS, indicating that pGmGolSP is a high temperature inducible promoter. But in general, there are still few high temperature inducible promoters used in potatoes. Therefore, isolating and identifying more high temperature inducible promoters and studying their expression response to high temperature stress will not only help to analyze the molecular mechanism of plant resistance to high temperature stress, but also provide applicable promoter reference sequences for the study of plant resistance to high temperature stress, and provide a theoretical basis for the creation of new high temperature resistant materials.

[0005] As one of the key components of plant heat stress response, HSF (HEAT SHOCK FACTOR) transcription factors play an important role in plant response to high temperature stress. Plant HSFs can be divided into three categories: A, B, and C according to the length of the amino acid residues between the DNA binding domain and the oligomerization domain and the number of amino acid residues inserted between the hydrophobic repeat sequences A and B. Among them, HSFA1, HSFA2, and HSFA3 play a key role as members of class A. Studies in Arabidopsis have shown that HSFA1 can activate a series of target genes including many heat shock proteins under heat stress; in addition, HSFA2 can be induced by HSFA1 protein and specifically plays a role in heat stress memory. The inventors also found through research that the potato StHSFA2 gene is significantly induced by high temperature and plays an important role in potato response to high temperature stress. In the process of gene expression, the promoter is one of the key factors that determine whether the gene is transcribed and how efficient the transcription is. Therefore, cloning and functional analysis of the StHSFA2 promoter have important theoretical significance and application value for analyzing the molecular mechanism of plant resistance to high temperature stress and breeding improvement. Summary of the invention

[0006] In view of this, the purpose of the present invention is to provide a potato high-temperature inducible promoter pStHSFA2 and its application. The potato high-temperature inducible promoter pStHSFA2 is significantly induced by high temperature, has high-temperature specific expression, can be used as a specific promoter to drive the specific expression of the target gene under high temperature conditions, can avoid the adverse effects caused by the continuous expression of the target gene, and has wide application value in the fields of plant genetic engineering and germplasm resource improvement.

[0007] In order to achieve the above object, the present invention provides the following technical solutions:

[0008] The present invention provides a potato high temperature inducible promoter pStHSFA2, whose nucleotide sequence is one of the following:

[0009] a) having the nucleotide sequence as described in SEQ ID No.1;

[0010] b) having a sequence complementary to the nucleotide sequence defined in a);

[0011] c) a nucleotide sequence having more than 90% homology with the nucleotide sequence defined in a) and having the same high temperature inducible function.

[0012] The present invention also provides the use of the potato high temperature inducible promoter pStHSFA2 to induce the expression of a target gene at high temperature. In one embodiment of the present invention, the pStHSFA2::pRC18 vector was transformed into the Agrobacterium strain GV3101, and the transformed Agrobacterium strain was transformed into the model plant Arabidopsis thaliana, proving that the promoter pStHSFA2 can drive the expression of the target gene at a high temperature of 38°C.

[0013] The present invention also provides a method for cloning or isolating the potato high temperature inducible promoter pStHSFA2, wherein the nucleotide sequence of the promoter pStHSFA2 is obtained by PCR amplification from potato DM total genomic DNA using the primer pair SEQ ID No. 2 and SEQ ID No. 3.

[0014] The present invention also provides primers for extending the potato high temperature inducible promoter pStHSFA2, including a forward primer sequence with a nucleotide sequence as shown in SEQ ID No.2 and a reverse primer sequence with a nucleotide sequence as shown in SEQ ID No.3.

[0015] The present invention also provides a gene expression cassette, a recombinant expression vector, a recombinant bacterium and a transgenic plant cell line containing the potato high temperature inducible promoter pStHSFA2, specifically:

[0016] 1) The gene expression cassette is composed of a potato high temperature inducible promoter pStHSFA2, an exogenous target gene and a transcription termination sequence connected in a specific direction. In one embodiment of the present invention, the exogenous target gene is specifically a β-glucuronidase gene (GUS).

[0017] 2) The recombinant expression vector is a plant recombinant expression vector comprising the gene expression cassette described in 1). In one embodiment of the present invention, the expression vector is specifically pRC18.

[0018] 3) The recombinant bacteria are recombinant bacteria comprising the gene expression cassette described in 1).

[0019] 4) The transgenic plant cell line is a transgenic plant cell line comprising the gene expression cassette described in 1).

[0020] The present invention also provides the use of the above-mentioned potato high temperature inducible promoter pStHSFA2, a gene expression cassette containing the potato high temperature inducible promoter pStHSFA2, a recombinant expression vector, a recombinant bacterium, and a transgenic plant cell line in preparing transgenic plants. The transgenic plants of the present invention can be obtained by any known transgenic technology capable of introducing exogenous genes into plant cells or plant tissues; in one embodiment of the present invention, the transgenic technology is Agrobacterium-mediated transformation.

[0021] The present invention also provides the use of the potato high temperature inducible promoter pStHSFA2, gene expression cassette, recombinant expression vector, recombinant bacteria and transgenic plant cell line in cultivating high temperature resistant plant varieties.

[0022] Preferably, the plant is a dicotyledonous plant or a monocotyledonous plant, more preferably a potato.

[0023] Beneficial effects of the present invention: (1) The present invention provides a potato high temperature inducible promoter pStHSFA2, whose nucleotide sequence is shown in SEQ ID No. 1. The potato high temperature inducible promoter pStHSFA2 is significantly induced by high temperature and has high temperature specific expression. It can be used as a specific promoter to drive the specific expression of the target gene under high temperature conditions, which can avoid the adverse effects caused by the continuous expression of the target gene and has a wide range of application value in the fields of plant genetic engineering and germplasm resource improvement. (2) The potato high temperature inducible promoter pStHSFA2 provided by the present invention can also be used for functional analysis and identification of plant heat resistance related genes, which helps to enrich the molecular mechanism of regulating potato resistance to high temperature stress and provide an effective gene reserve for the subsequent use of plant genetic engineering methods to improve plant stress resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1Schematic diagram of the construction of the recombinant expression vector pStHSFA2-GUS of the high temperature inducible promoter pStHSFA2.

[0025] Figure 2 This is the electrophoresis diagram of the cloned promoter pStHSFA2.

[0026] Figure 3 These are the results of GUS staining of pStHSFA2-GUS transgenic Arabidopsis seedlings under normal growth conditions and high temperature stress.

[0027] Figure 4 This is the result graph of GUS gene expression level in pStHSFA2-GUS transgenic Arabidopsis seedlings under normal growth conditions and high temperature stress.

[0028] Figure 5 This is a quantitative detection diagram of GUS activity in pStHSFA2-GUS transgenic Arabidopsis seedlings under normal growth conditions and high temperature stress. DETAILED DESCRIPTION

[0029] The present invention is further described below in conjunction with the accompanying drawings and examples. The following examples are only used to illustrate the present invention and should not be construed as limiting the present invention; the experimental methods in the following examples, unless otherwise specified, are all conventional methods; the materials, reagents and instruments used in the following examples, unless otherwise specified, are all commercially available products; in the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence table is the 5' terminal nucleotide of the corresponding DNA, and the last position is the 3' terminal nucleotide of the corresponding DNA. Without departing from the spirit and essence of the present invention, modifications or substitutions made by those skilled in the art to the methods, steps or conditions of the present invention are all within the scope of the present invention.

[0030] The main strain used in the present invention is Escherichia coli Trelief TM 5α, Agrobacterium strain GV3101, the expression vector used was pRC18 (kanamycin resistance), the vector came from the Chongqing Key Laboratory of Tuber Biology and Genetic Breeding. Primer synthesis and sequencing were completed by Sangon Biotech Co., Ltd.

[0031] Example 1: Obtaining potato high temperature inducible promoter pStHSFA2

[0032] 1) Extraction of total genomic DNA from potato DM

[0033] Take about 0.1g of young potato leaves and place them in a 2mL sterile centrifuge tube with two steel balls; freeze them in liquid nitrogen for about 5 minutes and grind them in a 40Hz grinder. The sample was quickly ground into powder for 20 seconds; 600 μL of 2×CTAB extract preheated at 65°C (the extract and the reducing agent were mixed in a volume ratio of 500:1) was added; the centrifuge tube was placed in a 65°C water bath for 0.5 h, and the centrifuge tube was gently shaken every 10 minutes or so; the sample was taken out and cooled at room temperature for use, 500 μL of chloroform-isoamyl alcohol mixture (24:1) was added, the mixture was vigorously shaken and mixed, centrifuged at 12000 rpm for 10 minutes, and the supernatant was transferred to a new centrifuge tube; an equal volume of isopropanol was added to the supernatant, the mixture was mixed by inversion, and the mixture was placed at -20°C for precipitation for more than 30 minutes, centrifuged at 12000 rpm for 10 minutes, and the supernatant was discarded; the precipitate was washed once with 75% ethanol, centrifuged at 12000 rpm for 5 minutes, and the supernatant was discarded; the precipitate was naturally dried and dissolved in 50 μL of deionized water; it was stored at -20°C.

[0034] 2) Cloning of potato high temperature inducible promoter pStHSFA2 and construction of expression vector

[0035] The promoter reference sequence 2Kb upstream of the transcription start site of StHSFA2 was obtained from http: / / spuddb.uga.edu / index.shtml, and the primers required for cloning pStHSFA2 were further designed using snap gene software (the forward primer and reverse primer sequences were GCCAGTGCCAAGCTTATGAGCAAAAGTATTTAATTATG, SEQ ID No. 2 and TCCGGTACCTCTAGATGCTTGTTCAGTTTGCTAATTAG, SEQ ID No. 3, respectively, wherein in the forward primer, the sequence GCCAGTGCC is the upstream sequence of the fusion site of the vector pRC18, and the sequence AAGCTT is the HindIII restriction site; in the reverse primer, the sequence TCCGGTACC is the downstream sequence of the fusion site of the vector pRC18, and the sequence TCTAGA is the XbaI restriction site). The potato DM genomic DNA obtained above was used as a template and PCR amplification was performed using the high-fidelity polymerase 2×KeyPo MasterMix (Dye Plus) produced by Nanjing Novozymes Biotech Co., Ltd.

[0036] a) PCR reaction system (50 μL):

[0037]

[0038] b) PCR reaction procedure:

[0039]

[0040] After amplification, 1% agarose gel electrophoresis was used to detect the target band ( Figure 2 ). The target fragment with a sequence length of about 2000 bp was purified and recovered using the TIANGEN Universal DNA Purification and Recovery Kit.

[0041] The pRC18 vector was double-digested with HindIII and XbaI, and the linear vector was obtained by gel recovery.

[0042] c) Enzyme digestion reaction system:

[0043]

[0044]

[0045] The purified PCR target fragment and the restriction-cut linear vector were recombined using the ClonExpress MultiS One Step Cloning Kit of Nanjing Novozymes Biotechnology Co., Ltd.

[0046] d) Homologous recombination reaction system:

[0047]

[0048] Next, use Trelief TM 5α E. coli competent cells were used for E. coli transformation experiments, single clones were picked for colony PCR positive clone detection, the positive clones were screened for sequencing verification, and the vector with correct sequencing was named pStHSFA2-GUS( Figure 1 ), and further used the Plasmid Miniprep Kit (ZP101) from Beijing Zhuangmeng International Biogene Technology Co., Ltd. to extract the plasmid.

[0049] Example 2: Transformation of Arabidopsis thaliana with the recombinant expression vector pStHSFA2-GUS

[0050] 1) Transform the recombinant expression vector pStHSFA2-GUS into Agrobacterium

[0051] Agrobacterium competent cells GV3101 were used for Agrobacterium transformation experiments. The specific steps are as follows: GV3101 competent cells were quickly inserted into ice, and after melting, 1 μg of plasmid was added; ice bath for 5 minutes, liquid nitrogen cold shock for 5 minutes, 37°C metal bath heat shock for 5 minutes, and ice bath for 5 minutes; 200 μL of YEB medium without antibiotics was added to the centrifuge tube in the clean bench, and after pipetting and mixing, it was revived at 28°C and 200 rpm for 2-3 hours; 200 μL of bacterial solution was aspirated and applied to YEB solid medium containing rifampicin (25 μg / mL) and kanamycin (50 μg / mL), and after inverted culture in a constant temperature incubator at 28°C for 2 days, positive clones were screened.

[0052] 2) Agrobacterium-mediated genetic transformation of Arabidopsis

[0053] Wild-type Arabidopsis thaliana was transformed by the inflorescence infiltration method, specifically: Agrobacterium containing the pStHSFA2-GUS plasmid was activated in YEB liquid medium, cultured overnight at 28°C, 200-220 rpm; the above bacterial solution was added to 50 mL of YEB liquid medium containing the corresponding antibiotics until the OD 600 =0.1, 28°C, 200-220rpm, culture until OD 600 = about 0.7; 5000rpm, 6min centrifugation to collect bacteria, discard the supernatant and resuspend Agrobacterium in the infection solution (containing 5g / 100mL sucrose and 50μL / 100mL SilwetL-77) according to the proportion; the pruned wild-type Arabidopsis inflorescence is completely immersed in the above Agrobacterium suspension for 10-20s, and after the infection is completed, it is cultured in the dark for 2d, and then transferred to normal light for continued cultivation until harvest.

[0054] Example 3: Screening and identification of pStHSFA2-GUS transgenic Arabidopsis

[0055] Take the transgenic seeds obtained in Example 2 and stored by low temperature drying. Under a sterile environment, place an appropriate amount of seeds in a sterile 1.5mL centrifuge tube, add an appropriate volume of 75% alcohol for disinfection for 8min, pour out the alcohol, and wash with sterile water for 3 times. The sterilized seeds are evenly sown on a 1 / 2MS medium containing hygromycin (25μg / mL), and placed in 4℃ dark vernalization for 2d, and then cultured for 10-15d under the conditions of temperature 22℃, humidity 60%, light and dark alternation (lighting time 16h, dark time 8h). At this time, dark green, hypocotyl elongation, and normal true leaf growth of resistant seedlings can be seen, while yellow or white seedlings are non-resistant wild-type seedlings. The selected resistant seedlings are transplanted into a nutrient matrix (vermiculite: nutrient soil = 1:2, V / V) for continued cultivation. Young tissues of the screened T1 generation positive transgenic plants were taken, and genomic DNA was extracted for PCR detection. The forward primer sequence and reverse primer used for detection were TGTAACTTGAAAGTCATCGC, SEQ ID No.4 and CGCGATCCAGACTGAATG, SEQ ID No.5, respectively. The results showed that all positive transgenic plants contained the target bands. After repeated screening, T2 generation plants and seeds were obtained, and the T2 generation seeds were further screened, and finally T3 generation homozygous plants were obtained for subsequent experiments.

[0056] Example 4: Identification of high temperature inducible activity of pStHSFA2

[0057] 1) High temperature stress treatment

[0058] In order to verify the response of pStHSFA2 to high temperature stress, two strains pStHSFA2-GUS#1 and pStHSFA2-GUS#5 were selected from the obtained positive plants for high temperature stress induction activity analysis. The sterilized T3 generation homozygous transgenic Arabidopsis and wild-type Arabidopsis seeds were sown on 1 / 2MS culture medium using the Arabidopsis disinfection method in Example 3, and after vernalization at 4°C in the dark for 2 days, they were cultured normally for 10 days. Then the treatment group was treated at 38°C for 3 hours, and the control group was kept in a 22°C incubator for growth.

[0059] 2) GUS histochemical staining analysis

[0060] The Arabidopsis seedlings of the treatment group and the control group were immersed in the substrate X-Gluc staining reaction solution, vacuumed for 5 minutes, and incubated in the dark at 37°C for 12 hours. The staining solution was removed, and then decolorized with 75% ethanol 2-3 times, and observed and photographed under a stereoscope. The results are shown in the figure. Under normal and high temperature induction conditions, the wild-type Arabidopsis could not be stained (no GUS gene expression). Under normal conditions, only the stem tip of the pStHSFA2-GUS transgenic Arabidopsis was slightly colored, and the rest of the tissues were not stained. After being treated at 38°C for 3 hours, the pStHSFA2-GUS transgenic Arabidopsis showed dark blue, indicating that the promoter pStHSFA2 was significantly induced by high temperature ( Figure 3 ).

[0061] 3) Analysis of GUS gene expression level

[0062] The RNA of Arabidopsis seedlings in the above-mentioned treatment group and control group was extracted using the FastPureUniversal Plant Total RNA Isolation Kit RC411-01 from Nanjing Novazon Biotech Co., Ltd., and then the reverse transcription kit from Yisheng Biotech (Shanghai) Co., Ltd. was used. Ⅲ1St Strand cDNA Synthesis SuperMix for qPCR (gDNA digester plus) was used for reverse transcription. The cDNA synthesized by reverse transcription was used as a template for specific PCR amplification of the GUS gene. The forward primer sequence and the reverse primer sequence were CGGTCAGTGGCAGTGAAGGG, SEQ ID No.6 and CGAGGTACGGTACGGTAGGAGTTGG, SEQ ID No.7, respectively. Three replicates were set for each sample, and the Ct values ​​of the samples were calculated using 2 -ΔΔCT The formula was used to calculate the data and analyze the relative expression of the target gene. The results showed that under high temperature stress, the expression level of the GUS gene regulated by the promoter pStHSFA2 was significantly upregulated, indicating that the promoter pStHSFA2 was significantly induced by high temperature ( Figure 4 ).

[0063] 4) Quantitative analysis of GUS enzyme activity

[0064] The sample to be tested was ground into powder in a pre-cooled mortar with liquid nitrogen, and its weight was accurately weighed; 1 mL of extract was added to every 100 mg of powder, and vortexed to mix thoroughly; centrifuged at 12,000 × g, 4°C for 10 min, the supernatant was aspirated into a new centrifuge tube, and placed on ice for later use; the protein concentration of each supernatant was determined according to the Bradford protein assay; 150 μL of supernatant was taken, 150 μL of preheated 4-MUG substrate solution was added, and mixed, and the reaction was incubated at 37°C; 100 μL of reaction solution was taken at 10 min and 20 min, respectively, and 900 μL of reaction stop solution was added; the fluorescence intensity was measured using a fluorescence microplate reader under the conditions of an excitation wavelength of 365 nm and an emission wavelength of 456 nm, and the concentration of 4-MU produced by each sample reaction was obtained through the 4-MU standard curve, and the GUS enzyme activity was calculated; each sample was repeated 3 times. The results showed that after 38°C high temperature treatment for 3 h, the GUS activity was significantly increased, indicating that the activity of pStHSFA2 was significantly induced by high temperature stress treatment ( Figure 5 ).

[0065] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. All modifications, equivalent substitutions, improvements, etc. within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A potato high temperature inducible promoter pStHSFA2, whose nucleotide sequence is one of the following: a) having the nucleotide sequence as described in SEQ ID No.1; b) having a sequence complementary to the nucleotide sequence defined in a); c) a nucleotide sequence having more than 90% homology with the nucleotide sequence defined in a) and having the same high temperature inducible function.

2. Use of the potato high temperature inducible promoter pStHSFA2 according to claim 1 to induce the expression of a target gene under high temperature.

3. A method for cloning or isolating the potato high temperature inducible promoter pStHSFA2 according to claim 1, characterized in that: The method comprises the following steps: using the primer pair of SEQ ID No. 2 and SEQ ID No. 3 to obtain the nucleotide sequence of the promoter pStHSFA2 from the total genomic DNA of potato DM by PCR amplification.

4. Primers for extending the potato high temperature inducible promoter pStHSFA2 according to claim 1, characterized in that: It includes a forward primer sequence with a nucleotide sequence as shown in SEQ ID No.2 and a reverse primer sequence with a nucleotide sequence as shown in SEQ ID No.

3.

5. A gene expression cassette, a recombinant expression vector, a recombinant bacterium and a transgenic plant cell line containing the potato high temperature inducible promoter pStHSFA2 according to claim 1, specifically: 1) The gene expression cassette is composed of a potato high temperature inducible promoter pStHSFA2, an exogenous target gene and a transcription termination sequence connected in a specific direction; 2) the recombinant expression vector is a plant recombinant expression vector comprising the gene expression cassette described in 1); 3) The recombinant bacteria is a recombinant bacteria comprising the gene expression cassette described in 1); 4) The transgenic plant cell line is a transgenic plant cell line comprising the gene expression cassette described in 1).

6. The recombinant expression vector according to claim 5, characterized in that The expression vector of the recombinant expression vector is pRC18.

7. Use of the potato high temperature inducible promoter pStHSFA2 according to claim 1, the gene expression cassette, the recombinant expression vector, the recombinant bacteria, the transgenic plant cell line according to claim 5, and the recombinant expression vector according to claim 6 in preparing transgenic plants.

8. Use of the potato high temperature inducible promoter pStHSFA2 according to claim 1, the gene expression cassette according to claim 5, the recombinant expression vector according to claim 5, the recombinant bacteria according to claim 5, the transgenic plant cell line according to claim 5, and the recombinant expression vector according to claim 6 in cultivating high temperature resistant plant varieties.

9. The use according to claim 8, characterized in that: The plant is a dicotyledonous plant or a monocotyledonous plant.

10. The use according to claim 9, characterized in that: The plant is potato.

Images