Application of bdellovibrio bacteriovorus Bd3 as bacterial disease control agent

Abstract

The invention discloses application of bdellovibrio bacteriovorus Bd3 as a bacterial disease control agent, and relates to the technical field of bacterial disease control, the bdellovibrio bacteriovorus Bd3 fermentation broth is used as the bacterial disease control agent in aquaculture, and a preparation method of the bdellovibrio bacteriovorus Bd3 fermentation broth comprises the following steps: preparing a culture medium of the bdellovibrio bacteriovorus Bd3; a bdellovibrio bacteriovorus Bd3 culture medium is placed in a fermentation tank, a bdellovibrio bacteriovorus Bd3 propagation seed solution is poured into the fermentation tank, and the bdellovibrio bacteriovorus Bd3 fermentation liquor is obtained after constant-temperature standing. The invention has splitting activity on common pathogenic bacteria in aquaculture, can be used for preventing and controlling bacterial diseases in the aquaculture process, and overcomes the problem of drug-resistant bacteria generation caused by excessive application of antibiotics.

Description

Technical Field

[0001] The invention relates to application of Bdellovibrio phage Bd3 as a bacterial disease prevention and control agent, belonging to the technical field of bacterial disease prevention and control. Background Art

[0002] Bacterial diseases have always been an important factor restricting the development of aquaculture. Bacterial diseases not only cause a large number of deaths of aquatic animals, but also induce the outbreak of viral diseases, leading to large-scale aquatic animal diseases, posing a huge threat to aquaculture. Therefore, controlling the number of pathogens in the aquaculture environment is of great significance for the prevention and control of aquatic animal diseases.

[0003] At present, the control methods for aquatic pathogens mainly use chemical disinfectants and antibiotics. Although chemical disinfectants have high control efficiency, their effective ingredients are easily degraded and the control time is short, which will cause the rebound of pathogens. Excessive use has acute toxic effects on aquaculture objects, and the abuse of antibiotics will cause a variety of pathogens to develop drug resistance. At the same time, the toxic side effects of drug residues in aquatic animals and water bodies pose a huge threat to food safety, aquaculture environment and natural ecological environment. Therefore, the development and research of new aquaculture control means and technical methods play a very important role in the prevention and control of aquatic animal diseases.

[0004] Bdellovibrio-and-like organisms (BALOs) are a type of Gram-negative bacteria that specifically parasitize other bacteria and cause them to lyse. BALOs are currently the only type of periplasmic obligate predatory bacteria in the prokaryotic world. They can recognize, invade and settle in the periplasmic space of host bacteria, use the nutrients of host bacterial cells to grow in filaments, and lyse and kill the host bacteria. BALOs have similar functions to bacteriophages, but they are not viruses, and their antibacterial spectrum is stronger than that of bacteriophages. BALOs are widely present in natural and artificial environments, do not infect eukaryotic cells, are non-pathogenic to humans and animals, and can be used as "antibiotic substitutes" in the biological control of pathogens. They have important potential. Summary of the invention

[0005] The purpose of the present invention is to overcome the deficiencies in the prior art and provide a bacteriophage Bdellovibrio Bd3 for use as a bacterial disease control agent, which has lytic activity against common pathogenic bacteria in aquaculture and can be used for the prevention and control of bacterial diseases in aquaculture, thereby overcoming the problem of drug-resistant bacteria caused by excessive use of antibiotics.

[0006] To achieve the above object, the present invention is implemented by adopting the following technical solutions: The invention provides an application of Bdellovibrio phage Bd3 as a bacterial disease control agent, comprising using the Bdellovibrio phage Bd3 fermentation liquid as a bacterial disease control agent in aquaculture.

[0007] Furthermore, the bacteria include Aeromonas hydrophila, Vibrio parahaemolyticus, Edwardsiella anguillarum and Vibrio anguillarum.

[0008] Furthermore, the preparation method of the Bdellovibrio phage Bd3 fermentation broth comprises: preparing a culture medium for Bdellovibrio phage Bd3; The culture medium of Bdellovibrio phage Bd3 is placed in a fermentation tank, and then the Bdellovibrio phage Bd3 expansion seed liquid is poured into the fermentation tank, and the fermentation liquid of Bdellovibrio phage Bd3 is obtained after standing at a constant temperature.

[0009] Furthermore, the culture medium for preparing Bdellovibrio phage Bd3 comprises: Aeromonas hydrophila was used as the host bacteria to be inoculated into LB liquid culture medium, and the culture medium was shaken at a constant temperature to obtain the seed liquid for culture medium expansion; The culture medium seed solution was centrifuged, the supernatant was discarded, and the collected bacteria were resuspended with sterile PBS to adjust the concentration of the resuspended Aeromonas hydrophila to the set concentration; The resuspended Aeromonas hydrophila was sterilized by high pressure to obtain a culture medium of Bdellovibrio bacteriophage Bd3.

[0010] Furthermore, the constant temperature oscillation condition parameters include oscillating at 120-170 r / min at 25-30°C.

[0011] Furthermore, the constant temperature oscillation condition parameters include oscillating at 120-170 r / min at 25-30°C.

[0012] Furthermore, the condition parameters of the high-pressure sterilization include inactivation at 115-125° C. and 0.10-0.14 MPa for 10-20 min.

[0013] Furthermore, the set concentration is 2×10 3 ~3×10 7 cfu / mL.

[0014] Furthermore, the method also includes detecting the amount of Bdellovibrio phage Bd3 in the fermentation liquid of Bdellovibrio phage Bd3 by PCR.

[0015] Furthermore, the effective content of Bdellovibrio phage Bd3 in the Bdellovibrio phage Bd3 fermentation broth is 1.0×10 6 pfu / mL or above.

[0016] Compared with the prior art, the present invention has the following beneficial effects: The present invention provides an application of Bdellovibrio phage Bd3, which has lytic activity against common pathogenic bacteria in aquaculture, can be used for the prevention and control of bacterial diseases in aquaculture, and overcomes the problem of drug-resistant bacteria caused by excessive use of antibiotics; Bdellovibrio Bd3 can decompose a variety of aquatic pathogens such as Vibrio, Aeromonas, Pseudomonas, Edwardsiella, etc. in a short time, and can effectively control the content of harmful substances such as ammonia nitrogen, nitrite and sulfide in water. It can control the number of pathogens for a long time in the early stage of bacterial disease outbreak and prevent the outbreak of diseases in a short time. Bdellovibrio phage Bd3 is safe and harmless, and can significantly affect the distribution of intestinal microbial flora of Macrobrachium rosenbergii, improve the richness and diversity of intestinal microorganisms, and increase the survival rate of bacteria that infect Macrobrachium rosenbergii. It can be used as an alternative to antibiotics, making it an important potential in the biological control of pathogens. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Schematic diagram of the detection and scanning electron microscope of Bdellovibrio phage Bd3 in one embodiment of the present invention, wherein A is OD 600nm A schematic diagram of the absorbance change of the Bdellovibrio phage Bd3 culture, B is a schematic diagram of agarose gel electrophoresis for PCR detection of Bdellovibrio phage Bd3, and C is a schematic diagram of SEM of the cultured Bdellovibrio phage Bd3; Figure 2 A schematic diagram of a phylogenetic tree analysis of Bdellovibrio phage Bd3 in an embodiment of the present invention; Figure 3 FIG. 1 is a schematic diagram of the detection of plaques of Bdellovibrio phage Bd3 against different pathogenic bacteria in one embodiment of the present invention, wherein A is the detection of Bdellovibrio phage Bd3 against Aeromonas hydrophila ( Aeromonas hydrophilia ) of the phage plaque test, B is the bacteriovorus Bd3 against Vibrio parahaemolyticus ( Vibrio Parahemolyticus ) of the plaque test, C is the bacteriovorus Bd3 against Edwardsiella anguillarum ( Edwardsiella anguillarum ) of the phage plaque detection, D is the bacteriovorus Bd3 against Vibrio anguillarum ( Vibrio anguillarum ) schematic diagram of plaque assay; Figure 4 This is a schematic diagram of the effect of Bdellovibrio phage Bd3 on the distribution of intestinal microbial flora of Macrobrachium rosenbergii in one embodiment of the present invention; Figure 5 This is a schematic diagram of the effect of Bdellovibrio phage Bd3 on the survival rate of pathogenic bacteria infected with Macrobrachium rosenbergii in an embodiment of the present invention. DETAILED DESCRIPTION

[0018] The present invention will be further described below in conjunction with the accompanying drawings. The following embodiments are only used to more clearly illustrate the technical solution of the present invention, and cannot be used to limit the protection scope of the present invention.

[0019] 1. Preparation of Bdellovibrio bacteriophage Bd3 fermentation broth The laboratory preserved strain Aeromonas hydrophila was taken as the host bacteria and inoculated into a 200 mL conical flask containing 50 mL LB liquid culture medium on the clean bench. It was placed in a constant temperature shaking incubator at 150 r / min and cultured overnight at 28°C as the culture medium expansion seed solution.

[0020] The cultured host bacteria were placed in a centrifuge tube and centrifuged at 4000 g / min for 20 min at room temperature. The supernatant was discarded and the bacteria were resuspended in sterile PBS (pH 7.0). The concentration of the resuspended Aeromonas hydrophila was adjusted to 3´10 7 cfu / mL concentration of bacteria, put them in an autoclave, inactivate them at 121℃, 0.12 MPa for 15 min. After cooling, store them in a refrigerator at 4℃ for later use as a culture medium for culturing Bdellovibrio Bd3.

[0021] 50 mL of Bdellovibrio Bd3 culture seed solution was added to a 5 L fermenter containing 1 L of Bdellovibrio Bd3 culture medium and cultured at 28°C for 96 h. After fermentation, the fermentation broth of Bdellovibrio Bd3 should be clear. The number of Bdellovibrio in the Bd3 fermentation broth was determined by PCR for subsequent use.

[0022] The bacteriophage Bd3 used in this example is as described in [1] Yang Hui, Cao Qingsheng, Zhu Zhu, Cao Yangyang, Ji Tongwei, Wei Wenzhi, Zhao Haiyong, Zhang Yingying. Bdellovibrio lyse multiple pathogenic bacteria andprotect crucian carp Carassius auratus gibelio from Aeromonas veronii As shown in the strains disclosed in infections [J]. Aquaculture, 2023, 562: 738741.

[0023] 2. Detection and identification of Bdellovibrio phage Bd3 During the culture process, 200 μL of the sample was taken every 12 h and transferred into a 96-well cell plate and the OD value was measured by NanoDrop spectrophotometer. 600nm Measure the absorbance value to observe the changes in the culture medium. Figure 1 As shown in A, as the culture time increases, the absorbance value at OD600 nm decreases continuously, indicating that Bdellovibrio Bd3 fully lyses the host bacteria. The electrophoresis results of PCR detection using the designed specific primers are shown in Figure 1 As shown in Figure B, the specific primers can detect Bdellovibrio within 96 h, indicating that the number of Bdellovibrio in the culture medium increases with time. The morphology of the cultured Bdellovibrio was observed by SEM. Figure 1 As shown in C, Bdellovibrio individuals are small, with a length of about 3.2 μm and a diameter of less than 1 μm, and a long flagellum at one end of the body. Bdellovibrio-specific PCR primers (F: CAGGCCTAACACATGCAAGTC and R: CGWCACTGAAGGGGTCAA) were used to PCR amplify and sequence the cultured Bdellovibrio, and the sequence of strain Bd3 was compared for homology. From the comparison results, strain Bd3 was similar to the strain in the database. Bdellovibrio sp. W (ATCC 27047) and Bdellovibrio bacteriovorus W (CP002190.1) strains naturally clustered, e.g. Figure 2 shown.

[0024] 3. Detection of inhibitory activity of Bdellovibrio phage Bd3 fermentation broth against different aquatic pathogens Four common pathogens in aquaculture, Aeromonas hydrophila ( Aeromonas hydrophilia ), Vibrio parahaemolyticus ( Vibrio Parahemolyticus )、Edwardsiella anguillarum( Edwardsiella anguillarum )、Vibrio anguillarum( Vibrio anguillarum ) was used to detect the inhibitory activity of Bdellovibrio against pathogenic bacteria.

[0025] Use LB nutrient agar, autoclave at 121℃ for 15 min, and cool to 60℃. Pour the sterilized LB nutrient agar into a culture dish in a clean bench as the lower layer of the double plate. For the upper culture medium of the double plate, add 0.5 g agar powder to every 100 mL of clean water filtered with a 0.45 μm filter membrane, autoclave at 121℃ for 15 min, and cool to 40℃ for use.

[0026] In a clean bench, add 4 mL of host bacteria and 2 mL of Bdellovibrio liquid (host bacteria: Bdellovibrio ratio is 2:1) to a 15 mL sterile centrifuge tube and let it stand for 5 min. Add the upper culture medium to 15 mL, tighten the centrifuge tube cap, turn it upside down to mix well, and pour it on the lower culture medium. After the upper culture medium solidifies, invert it and place it in a constant temperature incubator at 28°C for continuous cultivation to observe the appearance of plaques.

[0027] The results are as follows Figure 3 As shown in the figure, it can be seen that after a period of cultivation, Bdellovibrio can lyse the six pathogens and produce plaques, but the size and number of plaques are different. This may be related to the different types of pathogens. The results show that the cultured Bdellovibrio can significantly lyse pathogenic bacteria and produce plaques.

[0028] 4. Effects of Bdellovibrio phage Bd3 fermentation broth on the distribution of intestinal microbial communities in Macrobrachium rosenbergii After 60 days of Bdellovibrio treatment, the intestines of Macrobrachium rosenbergii in the experimental group and the control group were taken, rinsed with sterile PBS, and then frozen in liquid nitrogen.

[0029] Microbial DNA was extracted from intestinal samples. The V4-V5 region of the bacterial 16S ribosomal RNA gene was amplified by PCR using primers 515F 5'-barcode-GTGCCMCGCCGCGG-3' and 907R 5'-CCGTCAATTCMTRAGTTT-3' (95°C for 2 min, 95°C for 30 s, 55°C for 30 s, 72°C for 30 s, and a final extension at 72°C for 5 min).

[0030] Amplified products were extracted from 2% agarose gel and purified using the AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, CA, USA) according to the manufacturer’s instructions. Pooled DNA products were used to construct Illumina paired-end libraries following the Illumina genomic DNA library preparation procedure.

[0031] The amplified libraries were then subjected to paired-end sequencing (2 × 250) on an Illumina MiSeq platform (Shanghai BIOZERON Co., Ltd.) according to standard protocols. The raw fastq files were first demultiplexed using an in-house perl script based on the barcode sequence information of each sample. The passed sequences were deduplicated and subjected to the DADA2 algorithm (QIME2 is recommended) to identify indel mutations and substitutions. The sequences were clustered into operational taxonomic units (OTUs) with 100% similarity (identical) using the Deblur denoising algorithm, which eliminates interference due to sequencing errors. Rarefaction analysis was performed based on Mothur v.1.21.1 to reveal diversity indices, including Chao, ACE, and Shannon diversity indices. One-way analysis of variance (ANOVA) tests were performed to assess statistically significant differences in diversity indices between samples. Venn diagrams were drawn using the online tool “Draw Venn Diagrams” to analyze overlapping and unique OTUs during treatment.

[0032] To identify biomarkers for high-dimensional colonic bacteria, LEfSe (Linear Discriminant Analysis Effect Size) analysis was performed. Kruskal-Wallis and rank tests were used to examine the changes and differences between different taxa, followed by LDA analysis to determine the size effect of each differently abundant taxa.

[0033] At the genus level, the microbial flora is mainly concentrated at the level of five genera, as shown in Table 1: Table 1: Top 5 genera of symbiotic bacteria in the intestine of Macrobrachium rosenbergii after treatment in the experimental and control groups (%)

[0034] As shown in Table 1, the proportion of Cetobacterium in the experimental group and the control group was basically the same. The proportions of Citrobacter and Isosphaeracea-unclassified in the experimental group were 13.20% and 8.34%, respectively, which were significantly higher than those in the control group. The detection rates of Herminiimonas and Aeromonas in the experimental group were 0.14% and 2.1%, respectively, which were significantly lower than those in the control group. The types and numbers of intestinal microorganisms of Macrobrachium rosenbergii in the experimental group were significantly higher than those in the control group, indicating that treatment of Macrobrachium rosenbergii with Bdellovibrio bacteriovorus Bd3 can significantly increase the types and numbers of microorganisms in the intestine, such as Figure 4 shown.

[0035] 5. Protective effect of long-term immersion in Bdellovibrio Bd3 fermentation broth on Macrobrachium rosenbergii infection with Aeromonas hydrophila The ability of Macrobrachium rosenbergii that was immersed in Bdellovibrio Bd3 fermentation broth for a long time to resist Aeromonas hydrophila was analyzed under the infection of Aeromonas hydrophila immersion broth. The experimental results are as follows Figure 5 As shown in Figure 2, some Macrobrachium rosenbergii in the experimental and control groups died after being immersed in Aeromonas hydrophila. However, the mortality rate of the control group was significantly higher than that of the experimental group ( P <0.05). The results showed that long-term immersion of Macrobrachium rosenbergii in Bdellovibrio Bd3 fermentation broth could effectively resist the infection of Aeromonas hydrophila and reduce the mortality rate.

[0036] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the technical principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Use of Bdellovibrio phage Bd3 as a bacterial disease control agent, characterized in that: The bacteriovorus Bd3 fermentation liquid is used as a bacterial disease control agent in aquaculture.

2. The use of Bdellovibrio phage Bd3 as a bacterial disease control agent according to claim 1, characterized in that: The bacteria include Aeromonas hydrophila, Vibrio parahaemolyticus, Edwardsiella anguillarum and Vibrio anguillarum.

3. The use of Bdellovibrio phage Bd3 as a bacterial disease control agent according to claim 1, characterized in that: The preparation method of the Bdellovibrio phage Bd3 fermentation liquid comprises: preparing a culture medium for Bdellovibrio phage Bd3; The culture medium of Bdellovibrio phage Bd3 is placed in a fermentation tank, and then the Bdellovibrio phage Bd3 expansion seed liquid is poured into the fermentation tank, and the fermentation liquid of Bdellovibrio phage Bd3 is obtained after standing at a constant temperature.

4. The use of Bdellovibrio phage Bd3 as a bacterial disease control agent according to claim 3, characterized in that: The culture medium for preparing bacteriophage Bdellovibrio Bd3 comprises: Aeromonas hydrophila was used as the host bacteria to be inoculated into LB liquid culture medium, and the culture medium was shaken at a constant temperature to obtain the seed liquid for culture medium expansion; The culture medium seed solution was centrifuged, the supernatant was discarded, and the collected bacteria were resuspended with sterile PBS to adjust the concentration of the resuspended Aeromonas hydrophila to the set concentration; The resuspended Aeromonas hydrophila was sterilized by high pressure to obtain a culture medium of Bdellovibrio bacteriophage Bd3.

5. The use of Bdellovibrio phage Bd3 as a bacterial disease control agent according to claim 4, characterized in that: The constant temperature oscillation condition parameters include oscillating at 25-30°C and 120-170 r / min.

6. The use of Bdellovibrio phage Bd3 as a bacterial disease control agent according to claim 4, characterized in that: The centrifugal condition parameters include centrifugation at 3000-5000 r / min for 15-25 min at room temperature.

7. The use of Bdellovibrio phage Bd3 as a bacterial disease control agent according to claim 4, characterized in that: The condition parameters of the high pressure sterilization include inactivation at 115-125° C. and 0.10-0.14 MPa for 10-20 min.

8. The use of Bdellovibrio phage Bd3 as a bacterial disease control agent according to claim 4, characterized in that: The set concentration is 2×10 3 ~3×10 7 cfu / mL.

9. The use of Bdellovibrio phage Bd3 as a bacterial disease control agent according to claim 3, characterized in that: The method also includes detecting the amount of Bdellovibrio phage Bd3 in the fermentation broth of Bdellovibrio phage Bd3 by PCR.

10. The use of Bdellovibrio phage Bd3 as a bacterial disease control agent according to claim 1, characterized in that: The effective content of Bdellovibrio phage Bd3 in the fermentation liquid of Bdellovibrio phage Bd3 is 1.0×10 6 pfu / mL or above.

Images