Application of combination of fludarabine and temozolomide in treatment of brain glioma

Abstract

The invention relates to an application of a combination of fludarabine and temozolomide in treatment of brain glioma. A drug combination composition comprises fludarabine and temozolomide. The temozolomide and the fludarabine are combined for use, so that a synergistic interaction effect is generated on treatment of the brain glioma, and the effect is obviously better than that of single use of the temozolomide and the fludarabine. Therefore, the pharmaceutical composition for treating the brain glioma, provided by the invention, can be used for remarkably inhibiting the growth of the brain glioma cells and prolonging the lifetime of a patient, and a brand new strategy and thought are provided for the treatment of the brain glioma.

Description

Technical Field

[0001] The invention belongs to the field of medicine and biotechnology, and specifically relates to the application of fludarabine and temozolomide in the treatment of brain glioma. Background Art

[0002] Glioblastoma (GBM) is a tumor originating from glial cells in the brain, accounting for 40% to 60% of all primary central nervous system tumors and is known as the most common primary intracranial tumor in adults. Temozolomide (TMZ) is currently the only chemotherapy drug with clear efficacy against glioma. The small size (194Da) and lipophilicity (logP 1.4) of TMZ enable it to penetrate the blood-brain barrier, making it a more effective drug for the treatment of GBM. However, TMZ treatment is poorly effective, which is due to its resistance pathway, either increasing the expression of O6-alkylguanine methylguanine-deoxymethyltransferase (MGMT) or increasing protein expression by demethylating the MGMT promoter site.

[0003] The standard treatment for GBM is to first perform maximal surgical resection, followed by simultaneous radiotherapy and temozolomide treatment, and then 6 cycles of TMZ adjuvant chemotherapy. These treatments can cause iatrogenic immunosuppression in GBM patients, known as treatment-related lymphopenia (TRL), which occurs in about 40% of GBM patients after treatment and is associated with poor survival. Moreover, this treatment is only effective for a few months, and almost all GBM tumors inevitably recur after treatment. In addition to TMZ, only bevacizumab is currently approved by the FDA for the clinical treatment of recurrent GBM. However, bevacizumab can only effectively relieve symptoms and improve quality of life in the short term, and bevacizumab has no combined effect with TMZ and radiotherapy; in addition, it reduces the absorption of TMZ, cannot improve overall survival, and has significant side effects such as hypertension, venous thrombosis, and infection.

[0004] Based on the above background, in order to improve the efficacy and prognosis of GBM patients, new treatment strategies need to be continuously provided. The present invention provides an application of two drugs in combination to prepare a drug for treating glioma, so as to solve the problem of poor efficacy in the treatment of glioma patients in the prior art and improve the efficacy of glioma. Summary of the invention

[0005] In order to provide an effective treatment strategy for brain glioma, the present invention provides the following technical solutions: A first aspect of the present invention provides a pharmaceutical composition for treating brain glioma, wherein the pharmaceutical composition comprises a first component and a second component.

[0006] The first component is a STAT1 inhibitor.

[0007] The second component is temozolomide or a pharmaceutically acceptable salt thereof.

[0008] In the present invention, the term "inhibitor" refers to a substance that targets, reduces or inhibits STAT1 protein activity or mRNA expression activity.

[0009] Furthermore, the STAT1 inhibitor includes those that are artificially synthesized or exist in nature.

[0010] Furthermore, the STAT1 inhibitor includes reagents used in RNA interference technology, antisense oligonucleotide technology, CRISPR technology, TALEN technology, ZFN technology, Cre loxP gene recombination technology or other gene editing technologies, and also includes compounds that can reduce the expression of STAT1.

[0011] Furthermore, the STAT1 inhibitor includes shSTAT1, fludarabine or a pharmaceutically acceptable salt thereof.

[0012] In the present invention, the pharmaceutically acceptable salt refers to a salt of an active compound (such as fludarabine) and is prepared by reacting the active compound with a suitable organic or inorganic acid or acid derivative. Pharmaceutically acceptable salts include, but are not limited to, hydrochlorides, sulfates, phosphates, citrates, hydrobromides, acetates, benzoates, benzenesulfonates, tartrates, carbonates, citrates, gluconates, lactates, malates, methanesulfonates, stearates, valerates, nitrates, sodium salts, calcium salts, potassium salts, zinc salts, and meglumine salts.

[0013] Furthermore, the sequence of the shSTAT1 is shSTAT1-84: GCCGAGAACATACCAGAGAAT; shSTAT1-86: CCGAAGAACTTCACTCTCTTA.

[0014] Treatment as mentioned in the context of the present invention refers to the prevention and reduction of the occurrence or development of a disease, the inhibition, containment, alleviation, improvement, slowing, stopping, delaying or reversal of the development or aggravation of the disease course, and the various indicators of the disease, disorder or pathological state described in the maintenance and / or medication include alleviation or reduction of symptoms or complications, or cure or elimination of the disease, disorder or condition. Treatment may refer to a reduction or improvement in the severity of the symptoms / effects of an established disease by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100%.

[0015] Furthermore, the pharmaceutical composition also includes pharmaceutically acceptable excipients.

[0016] The pharmaceutically acceptable excipient refers to a non-toxic solid, semi-solid or liquid filler, diluent, encapsulating material or any type of formulation auxiliary.

[0017] Furthermore, the pharmaceutically acceptable excipient is selected from one or more of a diluent, an excipient, a filler, a binder, a wetting agent, a disintegrant, an emulsifier, a solubilizing agent, a solubilizing agent, an osmotic pressure regulator, a lubricant, a surfactant, a coating material, a colorant, a pH regulator, an antioxidant or an antibacterial agent.

[0018] Wherein, the diluent includes one or more of lactose, sodium chloride, glucose, urea, starch and water.

[0019] The adhesive comprises one or more of starch, pregelatinized starch, dextrin, maltodextrin, sucrose, gum arabic, gelatin, methyl cellulose, methyl cellulose, ethyl cellulose, polyvinyl alcohol, polyethylene glycol, polyvinyl pyrrolidone, alginic acid and alginate, xanthan gum, hydroxypropyl cellulose and hydroxypropyl methyl cellulose.

[0020] Wherein, the surfactant includes one or more of polyoxyethylene sorbitan fatty acid, sodium lauryl sulfate, stearic acid monoglyceride, and cetyl alcohol.

[0021] Wherein, the wetting agent includes glycerol, starch and the like.

[0022] Wherein, the lubricant includes one or more of zinc stearate, glyceryl monostearate, polyethylene glycol, talc, calcium and magnesium stearate, polyethylene glycol, boric acid powder, hydrogenated vegetable oil, sodium stearyl fumarate, polyoxyethylene monostearate, monolauric sucrose acid, sodium lauryl sulfate, magnesium lauryl sulfate, and magnesium dodecyl sulfate.

[0023] The filler comprises one or more of mannitol (granular or powdered), xylitol, sorbitol, maltose, erythrose, microcrystalline cellulose, polymeric sugar, coupling sugar, glucose, lactose, sucrose, dextrin, starch, sodium alginate, laminarin powder, agar powder, calcium carbonate and sodium bicarbonate.

[0024] The disintegrant comprises one or more of cross-linked vinyl pyrrolidone, sodium methyl starch, low-substituted hydroxypropyl methyl, cross-linked sodium methyl cellulose, and soybean polysaccharide.

[0025] Furthermore, the pharmaceutical composition is a single compound preparation or a combination of two separate single preparations.

[0026] Furthermore, the dosage forms of the first component and the second component in the combination of the two single-ingredient preparations are the same or different.

[0027] Furthermore, the dosage form of the single compound preparation or the combination of two separate single preparations includes solutions, drops, tablets, capsules, granules, films, gels, powders, emulsions, suspensions, pills, suppositories, aerosols, sprays, powder mists, patches, ointments or creams.

[0028] Furthermore, the dosage ratio of the first component to the second component in the pharmaceutical composition is 1:100~3000.

[0029] Furthermore, the concentration ratio of the first component to the second component is (50-300 μM): (0.1-0.5 μM).

[0030] Furthermore, the first component and the second component in the pharmaceutical composition can be administered sequentially, simultaneously or cross-administered.

[0031] Specifically, the interval between the sequential administrations may be 0, 1, 2, 3, 4, 5, 6, 7 or more days.

[0032] Furthermore, the sequential administration is to administer the first component and then the second component. The sequential administration is preferably to administer the first component 3 days and then the second component 7 days.

[0033] The pharmaceutical composition described in the present invention can also be used in combination with other drugs for treating brain gliomas, and other therapeutic compounds can be administered simultaneously with the main active ingredient, or even administered simultaneously in the same composition. Other therapeutic compounds can also be administered separately in a separate composition or in a dosage form different from the main active ingredient. Partial doses of the main ingredient can be administered simultaneously with other therapeutic compounds, while other doses can be administered separately. During the treatment process, the dosage of the pharmaceutical composition of the present invention can be adjusted according to the severity of the symptoms, the frequency of recurrence and the physiological response of the treatment plan.

[0034] The other drugs for treating brain glioma include but are not limited to Acivicin, Aclarubicin, Acodazole Hydrochloride, AcrQnine, Adozelesin, Aldesleukin, Asparaginase, Asperlin, Azacitidine, Azetepa, Azotomycin, Batimastat, Benzodepa, Bicalutamide, Bisantrene Hydrochloride, Bisnafide Dimesylate, Bizelesin, Bleomycin Sulfate, Brequinar Sodium Sodium), Bropirimine, Busulfan, Cactinomycin, Calusterone, Caracemide, Carbetimer, Carboplatin, Carmustine, Carubicin Hydrochloride, Carzelesin, Cedefingol, Chlorambucil, Cirolemycin, Cisplatin, Cladribine, etc.

[0035] Furthermore, the brain glioma includes grade I, grade II, grade III, and grade IV brain glioma.

[0036] The second aspect of the present invention provides an application of the pharmaceutical composition described in the first aspect of the present invention, and the application includes any one of the following: 1) application in the preparation of a product for treating glioma; 2) application in the preparation of an agent for inhibiting the growth of glioma cells in vitro and promoting the apoptosis of glioma cells.

[0037] Furthermore, the brain glioma includes grade I, grade II, grade III, and grade IV brain glioma.

[0038] Furthermore, the product includes a test kit, a chip, a test strip, or a device, an equipment, or a computer-readable storage medium.

[0039] The third aspect of the present invention provides a method for inhibiting the growth of glioma cells and promoting apoptosis of glioma cells in vitro for non-therapeutic purposes, the method comprising the following steps: treating glioma cells with the pharmaceutical composition described in the first aspect of the present invention.

[0040] Furthermore, the brain glioma cells include but are not limited to GL261 cells, T3-5 cells, U87MG cells, U251 cells, LN229 cells, T98G cells, U373 cells, C6 cells, 9L cells, and G422 cells.

[0041] Furthermore, the brain glioma cells are GL261 cells or T3-5 cells.

[0042] The fourth aspect of the present invention provides the use of a STAT1 inhibitor in the preparation of a drug for improving the effect of temozolomide in treating brain gliomas, wherein the STAT1 inhibitor comprises one or more of shSTAT1, fludarabine or a pharmaceutically acceptable salt thereof.

[0043] Furthermore, the sequence of the shSTAT1 is shSTAT1-84: GCCGAGAACATACCAGAGAAT; shSTAT1-86: CCGAAGAACTTCACTCTCTTA.

[0044] Advantages and beneficial effects of the present invention: The present invention provides the use of a STAT1 inhibitor and temozolomide in combination for preparing a drug for treating brain glioma. In vivo and in vitro experiments have demonstrated that the combination of fludarabine and temozolomide has a synergistic effect in the treatment of brain glioma, and that knocking down STAT1 in vivo can increase the therapeutic effect of temozolomide and prolong survival time, providing a new strategy for treating brain glioma. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 This is a graph showing the relative cell survival rate of GL261.

[0046] Figure 2 This is a graph showing the relative cell survival rate of T3-5.

[0047] Figure 3 Statistical graph of combined inhibition rate and q value of GL261 cells.

[0048] Figure 4 It is the statistical graph of combined inhibition rate and q value of T3-5 cells.

[0049] Figure 5 This is a statistical table of CI values ​​of fludarabine and temozolomide combined in GL261 cells.

[0050] Figure 6 This is a statistical table of CI values ​​of fludarabine and temozolomide combined in T3-5 cells.

[0051] Figure 7 This is a table for evaluating the in vivo therapeutic effect of the combination of fludarabine and temozolomide.

[0052] Figure 8 The figures are the results of in vivo treatment of tumors with the combination of fludarabine and temozolomide, where A is a schematic diagram of grouped drug administration, B is the imaging of small animals in different groups on the 5th and 15th days, C is the in situ tumor growth curve, and D is a statistical graph of tumor size detected by in vivo imaging of small animals on the 5th and 15th days.

[0053] Fig. 9 This is a diagram for detecting the effect of STAT1 knockdown.

[0054] Fig.10 This is a table for evaluating the in vivo therapeutic effect of STAT1 knockdown combined with temozolomide.

[0055] Fig.11 Statistical chart of tumor treatment with STAT1 knockdown combined with temozolomide in vivo.

[0056] Fig.12 This is the survival curve of STAT1 knockdown combined with temozolomide treatment in vivo. DETAILED DESCRIPTION

[0057] The present invention is further described below in conjunction with the embodiments. The following description is only a preferred embodiment of the present invention, and does not limit the present invention in other forms. Any technician familiar with the profession may use the above disclosed technical content to change it into an equivalent embodiment with equivalent changes. Any simple modification or equivalent change made to the following embodiments based on the technical essence of the present invention without departing from the content of the present invention falls within the protection scope of the present invention.

[0058] Example 1 In vitro cell verification of the synergistic effect of fludarabine and temozolomide 1. Experimental materials: GL261 mouse glioma cell line and T3-5 human primary glioma cell line were both from Jiang Tao's research group at Tiantan Hospital.

[0059] 2. Experimental methods: 1. DPBS: add 0.2g KCl, 8.0g NaCl, 0.2g KH2PO4, 1.15g Na2HPO4 to 1L, adjust pH to 7.35, then add 0.1g MgCl2·6H2O, mix thoroughly until the solution is clear, add 0.133g CaCl2·2H2O, mix thoroughly until the solution is clear. Sterilize twice with a 0.2μM filter, and store in aliquots at 4°C.

[0060] 2. Preparation of PMS solution: Use DPBS to prepare 0.92 mg / mL PMS solution, filter and sterilize with a 0.2 μM filter, divide into EP tubes wrapped with tin foil, and store at -20°C away from light.

[0061] 3. Preparation of MTS solution: Prepare according to the ratio of 1 mg MTS powder to 0.5 mL DPBS, gently mix, about 15 minutes, until MTS is completely dissolved. Measure the pH and keep it between 6.0-6.5. After sterilization by filtering twice with a 0.2 μM filter, dispense into EP tubes wrapped with tin foil and store at -20°C away from light.

[0062] 4. Preparation of MTS / PMS working solution: Melt the prepared MTS and PMS solutions separately, and then mix them into MTS / PMS working solution in a volume ratio of MTS:PMS of 20:1.

[0063] 5. Taking the combination of fludarabine and temozolomide in the GL261 cell line as an example, the following concentration gradients of fludarabine were set: 0μM, 0.1μM, 0.2μM, 0.3μM, 0.4μM, 0.5μM, and the following concentration gradients of temozolomide were set: 0μM, 50μM, 100μM, 200μM, 300μM. All cell lines were first treated with the above-mentioned different concentration gradients of fludarabine for 24 hours, and then replaced with different concentration gradients of temozolomide for 4 days. Each drug combination concentration has 3 replicates. The concentration gradient setting of the T3-5 cell line is consistent with that of GL261.

[0064] 6. Prepare the corresponding volume of MTS / PMS working solution as needed, and then add the corresponding MTS / PMS working solution at a ratio of working solution: culture medium = 1:5 to make the final system 120μL per well, then incubate at 37℃, 5% CO2 for 2 hours. According to the absorbance spectrum of the formazan product produced after MTS reduction, read the data A490 at the absorption peak of 490nm, and subtract the data A630 read at 630nm to subtract the noise value caused by cell debris, etc., and other non-specific absorbance values.

[0065] 7. Calculate the cell survival rate based on the absorbance value A490-A630, cell survival rate = (experimental group (A490-A630) / control group) × 100%. Take the average of the survival rates of the three replicate wells, and then draw a relative survival rate heat map using Graphpad software. Calculate the drug inhibition rate based on the cell survival rate, inhibition rate = 1-cell survival rate; use the Golden formula to calculate the combined index q value of the two drugs: q = E (A + B) / (EA + EB-EA * EB). E (A + B) is the inhibition rate of the two drugs in combination, EA and EB are the inhibition rates of each drug when used alone, q values ​​greater than or equal to 1 indicate that the two drugs in combination have a synergistic effect, and q values ​​less than 1 indicate that the two drugs in combination have an antagonistic effect.

[0066] 3. Experimental results: In GL261 mouse glioma cells and human primary T3-5 glioma cells, Figure 1 to Figure 2 The relative cell survival rate of glioma cells treated with fludarabine and temozolomide was shown ( Figure 1 GL261 mouse glioma cells, Figure 2 is a human primary T3-5 glioma cell line). Figure 3 to Figure 4 The relationship between the inhibition rate of fludarabine and temozolomide and the combination index q value is shown ( Figure 3 For GL261 cells, Figure 4 for T3-5 cells), Figure 5 to Figure 6 The specific values ​​of the inhibition rate and the combination index q value of fludarabine and temozolomide at gradient concentrations are shown ( Figure 5 For GL261 cells, Figure 6 For T3-5 cells), it can be seen that the q values ​​are significantly greater than 1, indicating that the combination of fludarabine and temozolomide has a significant synergistic inhibitory effect on glioma cells.

[0067] Example 2 In vivo animal experiment confirms the synergistic effect of fludarabine and temozolomide 1. Experimental Methods (1) Order 5-week-old C57 / BL6J mice in advance and raise them in the animal room for one week.

[0068] (2) Collect GL261-luc mouse glioma cells in the logarithmic growth phase. GL261-luc cells are GL261 cells carrying a luciferase marker. After the D-luciferin free acid substrate is injected in vivo, the luminescence signal intensity can be detected and tracked using a small animal in vivo imaging system.

[0069] (3) Wash once with saline and count live cells using trypan blue.

[0070] (4) Resuspend the cells in sterile saline to ensure a concentration of 1×10 5 / μL.

[0071] (5) The mice were weighed and anesthetized by intraperitoneal injection of 400 μL / 20 g.

[0072] (6) After the mouse is deeply anesthetized, use a shaver to remove the hair on its skull and fix it on the positioning device.

[0073] (7) Disinfect the mouse’s scalp with an alcohol cotton ball and cut the skin tissue above the skull.

[0074] (8) Use a sterile cotton ball to carefully wipe the mouse skull to remove the fascia.

[0075] (9) Position the microinjection needle at the center of the intersection of bregma and midline.

[0076] (10) Locate the hole 1 mm posi- tively oriented to the anterior bregma and 2 mm to the right of the midline and use a skull drill to make a hole.

[0077] (11) Use a 10 μL microsyringe to aspirate 6-7 μL of cell suspension and remove the bubbles.

[0078] (12) Insert the needle into the hole to a depth of 3.5 mm, and then withdraw the needle to 3 mm. Inject 5 μL into each mouse.

[0079] (13) After the injection is completed, let it stand for 5 minutes and slowly remove the injector.

[0080] (14) Use medical glue to seal the skin and place the mouse back into its cage.

[0081] (15) On the 5th day after orthotopic tumor injection in the mouse brain, small animal imaging was performed to detect the tumor size in the mouse.

[0082] (16) D-luciferin free acid substrate was injected into mice via intraperitoneal injection. The mice were anesthetized with mouse anesthetic 10 min after injection and placed in a small animal in vivo imaging system 18 min after injection to detect the luminescence signal intensity.

[0083] (17) All tumor model mice were divided into four groups according to the intensity of the luminescent signal to ensure that there was no difference in the mean signal values ​​of the four groups.

[0084] (18) The corresponding drugs were given to treat tumor mice: temozolomide was administered via the tail vein at a rate of 30 mg / kg / day for 10 days; fludarabine was administered via the tail vein at a rate of 20 mg / kg / day for 3 days; the combination group was first given fludarabine for 3 days and then temozolomide for 7 days.

[0085] (19) Perform another tumor size signal test on the 15th or 12th day after the dosing cutoff time.

[0086] (20) The differences in tumor size between groups of mice after drug treatment were analyzed by analyzing the intensity of the luminescent signal, and the drug-drug interaction index (CDI) was calculated.

[0087] 2. Experimental Results 2.1 In vivo experiment on inhibition of tumor growth by fludarabine combined with temozolomide.

[0088] The drug interaction index, or CDI, is used to evaluate the in vivo therapeutic effect: CDI calculation formula is: CDI = AB / (A*B) AB is the ratio of the tumor signal size of the two-drug combination group to the control group, and A or B is the ratio of the tumor signal size of each drug alone group to the control group. When CDI is less than 1, it means that the two drugs have a synergistic therapeutic effect. Figure 7 The in vivo therapeutic effect of the combination of fludarabine and temozolomide in the GL261 cell transplant tumor model was evaluated. The results showed that the CDI value of the combination of the two was 0.91149, indicating that fludarabine and temozolomide have a combined therapeutic effect in vivo.

[0089] Figure 8 The data show the grouping, small animal imaging results and tumor size statistics of C57BL / 6J mouse brains transplanted with GL261-luc cells in situ. According to the t-test, it is obvious that the combination of the two drugs significantly inhibits the growth of orthotopic transplanted tumors. On the 15th day, the tumor in the combination group was significantly smaller than that in the temozolomide alone group. It can be seen that the combination of fludarabine and temozolomide has a significant synergistic effect.

[0090] Example 3 In vivo animal experiments verify the synergistic effect of STAT1 knockdown and temozolomide 1. Experimental materials: GL261-luc cells, STAT1 knockdown lentivirus, puromycin (10 mg / mL), C57 / BL6J mice.

[0091] 2. Experimental methods: (1) Plate the prepared GL261-luc cell suspension in a six-well cell culture plate, with 200,000 cells per well.

[0092] (2) After the cells adhered, GL261 cells were infected with virus at an MOI of 20, where MOI = (virus titer x virus volume) / cell number.

[0093] (3) 48 hours after infection, cells were treated with 4ug / mL puromycin-containing medium for two days to obtain a cell line with stable STAT1 knockdown, and the STAT1 knockdown effect was detected by western blotting. (4) Then, cells with stable knockdown of STAT1 and control GL261-luc cells were cultured at 5×10 5 The number was injected into the mouse's skull.

[0094] (5) In vivo imaging of small animals was performed on day 5 after injection to detect the initial tumor size.

[0095] (6) The patients were then treated with 30 mg / kg / day of temozolomide for seven days.

[0096] (7) On day 12, in vivo imaging was performed again to analyze the tumor size of each group of mice.

[0097] (8) The in vivo effects of STAT1 knockdown and temozolomide treatment were evaluated by tumor size and using CDI values.

[0098] 3. Experimental Results 1. Fig. 9 The results of western blot showed that STAT1 was successfully knocked down. The in vivo experiments used shSTAT1-84 cells.

[0099] 2. Fig.10 The in vivo therapeutic effect of STAT1 knockdown and temozolomide in the GL261 cell transplant tumor model was evaluated. The CDI value of the combination of the two was 0.60392, indicating that knockdown of the target STAT1 and temozolomide treatment had a significant synergistic therapeutic effect in vivo. The results were consistent with the in vivo therapeutic effect of the STAT1 inhibitor fludarabine combined with temozolomide.

[0100] 3. Fig.11 The left picture shows the tumor size on the 5th day after transplantation of the orthotopic tumor, and the right picture shows the tumor size on the 12th day of administration. The t-test results show that compared with the STAT1 knockdown group and the temozolomide treatment group alone, STAT1 knockdown combined with temozolomide can significantly inhibit tumor growth in vivo. Fig.12 This is the survival curve of each group of mice after transplantation of orthotopic tumors. It can be seen that STAT1 knockdown combined with temozolomide significantly prolonged the survival of mice.

[0101] Based on the in vivo and in vitro experimental results in the examples, it is shown that STAT1 knockdown or the combined administration of the STAT1 inhibitor fludarabine and temozolomide has a good synergistic effect in brain glioma and has excellent potential application value.

[0102] The description of the above embodiments is only used to understand the method and core idea of ​​the present invention. It should be pointed out that, for those skilled in the art, several improvements and modifications can be made to the present invention without departing from the principle of the present invention, and these improvements and modifications will also fall within the scope of protection of the claims of the present invention.

Claims

1. A pharmaceutical composition for treating brain glioma, characterized in that: The pharmaceutical composition comprises a first component and a second component; The first component is a STAT1 inhibitor; The second component is temozolomide or a pharmaceutically acceptable salt thereof.

2. The pharmaceutical composition according to claim 1, characterized in that The STAT1 inhibitors include those synthesized artificially or those existing in nature; Preferably, the STAT1 inhibitor includes reagents used in RNA interference technology, antisense oligonucleotide technology, CRISPR technology, TALEN technology, ZFN technology, Cre loxP gene recombination technology or other gene editing technology, and also includes compounds that can reduce the expression of STAT1; Preferably, the STAT1 inhibitor comprises shSTAT1, fludarabine or a pharmaceutically acceptable salt thereof; Preferably, the sequence of the shSTAT1 is shSTAT1-84: GCCGAGAACATACCAGAGAAT; shSTAT1-86: CCGAAGAACTTCACTCTCTTA.

3. The pharmaceutical composition according to claim 1, characterized in that The pharmaceutical composition also includes pharmaceutically acceptable excipients; The pharmaceutically acceptable excipients are selected from one or more of diluents, excipients, fillers, binders, wetting agents, disintegrants, emulsifiers, cosolvents, solubilizers, osmotic pressure regulators, lubricants, surfactants, coating materials, colorants, pH regulators, antioxidants or antibacterial agents.

4. The pharmaceutical composition according to claim 1, characterized in that The pharmaceutical composition is a single compound preparation or a combination of two separate single preparations; Preferably, the dosage forms of the first component and the second component in the combination of the two single-ingredient preparations are the same or different; Preferably, the dosage form of the single compound preparation or the combination of two separate single preparations includes solutions, drops, tablets, capsules, granules, films, gels, powders, emulsions, suspensions, pills, suppositories, aerosols, sprays, powder mists, patches, ointments or creams.

5. The pharmaceutical composition according to claim 1, characterized in that The dosage ratio of the first component to the second component in the pharmaceutical composition is 1:100-3000; Preferably, the concentration ratio of the first component to the second component is (50-300 μM): (0.1-0.5 μM); The first component and the second component in the pharmaceutical composition may be administered sequentially, simultaneously or cross-administered.

6. The pharmaceutical composition according to claim 1, characterized in that The brain glioma includes grade I, grade II, grade III and grade IV brain glioma.

7. Use of the pharmaceutical composition according to any one of claims 1 to 6, characterized in that: The application includes any of the following: 1) Application in the preparation of products for the treatment of brain glioma; 2) Application in the preparation of reagents for inhibiting the growth of glioma cells in vitro and promoting the apoptosis of glioma cells.

8. The use according to claim 7, characterized in that: The brain glioma includes grade I, grade II, grade III, and grade IV brain glioma; Preferably, the product includes a kit, a chip, a test strip, or a device, an apparatus, or a computer-readable storage medium.

9. A method for inhibiting the growth of brain glioma cells and promoting apoptosis of brain glioma cells in vitro without therapeutic purpose, characterized in that: The method comprises the following steps: treating brain glioma cells with the pharmaceutical composition according to any one of claims 1 to 6.

10. Use of a STAT1 inhibitor in the preparation of a drug for improving the effect of temozolomide in treating brain glioma or in the preparation of a drug for prolonging survival, characterized in that: The STAT1 inhibitor includes one or more of shSTAT1, fludarabine or pharmaceutically acceptable salts thereof; Preferably, the sequence of the shSTAT1 is shSTAT1-84: GCCGAGAACATACCAGAGAAT; shSTAT1-86: CCGAAGAACTTCACTCTCTTA.

Images