STON1 gene molecular marker primer related to chicken double-yolk egg traits and application of STON1 gene molecular marker primer

Abstract

The invention relates to an STON1 gene molecular marker primer related to chicken double-yolk egg traits and application of the STON1 gene molecular marker primer, and belongs to the technical field of biology. The STON1 gene molecular marker is a 7867409th basic group of a chicken reference genome GRCg7b version chromosome 3, the basic group is mutated into A or G, and the genotypes are A / A, A / G and G / G. The double-yolk egg ratio of the G / G genotype chicken is higher than that of the A / G and A / A genotype individuals, and the double-yolk egg ratio of the A / G genotype chicken is higher than that of the A / A genotype individuals. A forward and reverse primer pair is used for amplifying a fragment containing the molecular marker site, Sanger sequencing is carried out on an amplification product, the genotype of an individual is rapidly and accurately identified to serve as a genetic marker for chicken breeding, and the chicken with the higher proportion of double-yolk eggs is bred; the double-yolk egg traits can be efficiently and accurately detected, the breeding accuracy and breeding efficiency of the chicken double-yolk egg proportion are improved, and the method has important value for chicken breeding and production.

Description

Technical Field

[0001] The invention relates to a STON1 gene molecular marker primer related to the trait of chicken double-yolk eggs and application thereof, belonging to the field of biotechnology. Background Art

[0002] The quality of eggs not only directly affects the hatching success rate, but is also crucial to the smooth progress of breeding work. Double-yolk eggs refer to eggs with two yolks in one eggshell. They are usually much larger than ordinary eggs, and contain more than ten times more lecithin, amino acids and free fatty acids than ordinary eggs. However, the output of double-yolk eggs is not high, and it is difficult to produce on a large scale. Therefore, it is difficult to form an industrial chain to meet the market demand for diversified double-yolk egg products. Double-yolk eggs are common in poultry production, with an incidence of 4%-12.5% ​​in breeder hens within 3 months of laying, and an incidence of 1.1%-3.5% in laying hens. Therefore, it is necessary to find suitable molecular markers to quickly and accurately identify the double-yolk egg traits of chickens, so as to select individuals with high double-yolk egg production rates and meet the market demand for diversified double-yolk egg products.

[0003] Marker-Assisted Selection (MAS) is a genetic improvement technology that enhances traditional selection methods through molecular markers. Single nucleotide polymorphism (SNP) refers to the variation of a single nucleotide in the genome, which can be stably inherited to offspring during the transmission of genetic material. SNP can be applied to MAS technology to help breeders accurately select individuals with desired traits before the trait is expressed, thereby achieving early selection, improving selection efficiency, reducing feeding costs, and improving selection accuracy. Studies have found that because high expression of the STON1 gene can lead to hyperandrogenism and obesity, the STON1 gene is expressed at a high level in women with polycystic ovary syndrome. Compared with mice of normal body size, high expression of the STON1 gene was found in the ovaries and fat cells of obese mice, and obesity is one of the reasons for the decline in reproductive performance. These studies have revealed that the STON1 gene is closely related to reproduction, but it has not been reported in chickens. Summary of the invention

[0004] The purpose of the present invention is to study the relationship between the STON1 gene and the double yolk egg trait in view of the defects of the prior art, and to propose a STON1 gene molecular marker primer related to the chicken double yolk egg trait and its application to quickly detect and screen chickens with a high proportion of double yolk eggs.

[0005] The present invention measures the double yolk egg ratio trait of chickens, uses second-generation sequencing technology to perform whole-genome SNP genotyping, and screens STON1 gene molecular markers significantly associated with the double yolk egg trait through whole-genome association analysis, providing new gene and molecular marker resources for the breeding of double yolk egg traits.

[0006] The present invention solves the technical problem through the following technical scheme: firstly, a STON1 gene molecular marker primer related to the proportion of double yolk eggs is provided, the nucleotide sequence of the molecular marker primer is shown in SEQ ID NO:1 and SEQ ID NO:2, the molecular marker is located at the 7867409th base on chromosome 3 of the chicken reference genome GRCg7b version, and the base is mutated to A or G. The sequence is shown in SEQ ID NO:3 or SEQ ID NO:4 at the 109th base.

[0007] The present invention further provides an application of the above molecular marker primers for detecting SNP genotypes related to the ratio of double yolk eggs. The detection method comprises the following steps: The first step is to provide a chicken DNA sample to be tested, and perform PCR amplification using a molecular marker primer pair to obtain an amplification product, wherein the amplification product is 538 bp in length and contains the 7867409th base of chicken chromosome 3; Step 2: Sanger sequencing of the PCR product; The third step is to determine the genotype of the SNP molecular marker at base 7867409 of chicken chromosome 3 based on the sequencing results of the second step.

[0008] Wherein, the deoxyribonucleotide sequence of the molecular marker primer pair described in the first step is: Upstream primer: 5'-CCACTGCACTTGCTCAACAT-3' (SEQ ID NO: 1) Downstream primer: 5'-CATCCAGCTGAATCAAAGCA-3' (SEQ ID NO: 2) The final concentration of the reaction system is 25 μl. Chicken DNA to be tested 50 ng, 2 x Accurate Taq Master Mix 12.5 μl, Upstream primer 1 μl, Downstream primer 1 μl, Add sterile water to 25 μl.

[0009] The reaction conditions of the PCR amplification are: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 60 seconds, for a total of 30 cycles; extension at 72°C for 2 minutes; storage at 4°C; the nucleotide sequence of the amplified product is shown in SEQ ID NO: 3 or SEQ ID NO: 4, the amplified product is 538 bp in length, and contains the 7867409th base of chicken chromosome 3.

[0010] In the third step, the judgment criterion is that the proportion of double yolk eggs of chickens with G / G genotype at the SNP site is higher than that of A / G and A / A genotype individuals, and the proportion of double yolk eggs of chickens with A / G genotype is higher than that of A / A genotype individuals.

[0011] The present invention detects the genotype of the double yolk egg trait through the STON1 gene molecular marker, and obtains that the proportion of double yolk eggs of G / G genotype individuals is higher than that of A / G genotype and A / A genotype individuals, and the proportion of double yolk eggs of A / G genotype individuals is higher than that of A / A genotype individuals. The genomic DNA of the chicken to be tested is used as a template, and PCR amplification is performed on it using specific primers, and then the PCR amplification product is subjected to Sanger sequencing and SNP molecular marker genotyping, and the genotype based on the SNP molecular marker can achieve the selection of the double yolk egg trait of the chicken. In breeding, according to the breeding goal, the A / G and A / A genotype individuals can be eliminated, and the G / G genotype individuals can be retained. The beneficial effect is that the molecular marker can be used as a genetic marker for chicken breeding, and chickens with a high proportion of double yolk eggs can be selected; the double yolk egg trait of the chicken can be identified efficiently and quickly, providing a scientific basis for the early breeding of chickens, which is of great value for the breeding of chickens. In addition, the detection method disclosed in the present invention is simple and easy to operate, and can be carried out in the laboratory. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 This is the Manhattan plot of the genome-wide association analysis of the double-yolked egg trait after the first lay.

[0013] Figure 2 These are the Sanger sequencing results of the PCR amplification products of the three genotypes. DETAILED DESCRIPTION

[0014] The following embodiments are applicable to chicken breeding, and the breeds of chickens cited are not limited to the following embodiments.

[0015] Example 1 In this example, the double-yolk egg phenotypic traits of recessive White Rock chickens were measured, and whole-genome SNP genotyping was performed using second-generation sequencing technology. The STON1 gene molecular marker significantly associated with the proportion of double-yolk eggs was screened through whole-genome association analysis. The results are as follows: Figure 1 shown.

[0016] In this example, the following experiment was conducted to identify and apply the STON1 gene molecular marker related to the double yolk egg trait of chickens.

[0017] 1. Phenotypic and genotypic testing (1) Experimental materials and phenotypic determination of 36-week-old double-yolk eggs A total of 2301 recessive White Rock chickens were selected and raised under the same feeding conditions with free access to feed and water throughout the whole process. The number and type of eggs laid by each chicken were recorded after the start of laying. At 36 weeks of age, the proportion of double-yolk eggs of each chicken was calculated as the phenotypic data of double-yolk eggs.

[0018] (2) Extraction of genomic DNA Blood was collected from the subwing vein of the individual to be tested, lysed after anticoagulation, digested with proteinase K, extracted with saturated sodium chloride method, dissolved in TE and stored at -20℃.

[0019] (3) PCR amplification Using the genomic DNA extracted as above as a template, a fragment containing the site at base position 7867409 on chromosome 3 was amplified.

[0020] Upstream primer: 5'-CCACTGCACTTGCTCAACAT-3' (SEQ ID NO: 1) Downstream primer: 5'-CATCCAGCTGAATCAAAGCA-3' (SEQ ID NO: 2) The final concentration of the reaction system is 25 μl. DNA to be tested 50 ng, 2 x Accurate Taq Master Mix 12.5 μl, Upstream primer 1 μl, Downstream primer 1 μl, Add sterile water to 25 μl.

[0021] The reaction conditions of PCR amplification are: 94℃ pre-denaturation for 5min; 94℃ denaturation for 30sec, 55℃ annealing for 30sec, 72℃ extension for 60sec, 30 cycles in total; 72℃ extension for 2min; 4℃ storage; 10μl was taken for agarose detection, and a single target band with a length of 538bp was amplified, containing the SNP molecular marker at the 7867409th base site of chicken chromosome 3. The sequence of the amplified product is as follows: SEQ ID NO:3 CCACTGCACTTGCTCAACATTCCATGAATCTGGAAGGCAACAGGGATGGGGAGTGCAACTTCTCGGTCAGTGATGGGATGTTCTGAGCAAAAAGGCAAACAACGAAAAAAGGCACAAAAGGATTCAGGCGAAAAAGGGGCAAAAGGCACAAAAAGGCAGCAGTCCTTTGTTTGCAAAGTCCTTATAAATGGTCTGGTCTTTGTGTGGTTTCACAAGGTAACAACACGTTGTGCACATTCGACACTACTGCACAGTCTTATCTACCCCTGAGCATCCAGGGTCCCTCATCTTAGGGTCACCTCGGTCCATCTCAGCAGCAGAACATGAGCTGGCATCCTCCCCTTATCTTTGTTGCCCCCGGCAACCGTGTGTAGGCAGCAGGGAGTCCTTCAGAGTCTCCCTCAGGCCTCTCAAGCAACTTCTGAGACAAAAAACTTCTTTGTATACGCTCACAGGGGTGCAACAGCATCCTCGTGCAACAGCAGGCGTTGGTTTCTGTTAAACTCAGAGGTGACGGATGCTTTGATTCAGCTGGATG SEQ ID NO:4 CCACTGCACTTGCTCAACATTCCATGAATCTGGAAGGCAACAGGGATGGGGAGTGCAACTTCTCGGTCAGTGATGGGATGTTCTGAGCAAAAAGGCAAACAACGAAAAGAGGCACAAAAGGATTCAGGCGAAAA AGGGGCAAAAGGCACAAAAAGGCAGCAGTCCTTTGTTTGCAAAGTCCTTATAAATGGTCTGGTCTTTGTGTGGTTTCACAAGGTAACAACACGTTGTGCACATTCGACACTACTGCACAGTCTTATCTACCCCTG AGCATCCAGGGTCCCTCATCTTAGGGTCACCTCGGTCCATCTCAGCAGCAGAACATGAGCTGGCATCCTCCCCTTATCTTTGTTGCCCCCGGCAACCGTGTGTAGGCAGCAGGGAGTCCTTCAGAGTCTCCCTC AGGCCTCTCAAGCAACTTCTGAGACAAAAAACTTCTTTGTATACGCTCACAGGGGTGCAACAGCATCCTCGTGCAACAGCAGGCGTTGGTTTCTGTTAAACTCAGAGGTGACGGATGCTTTGATTCAGCTGGATG (4) Sanger sequencing and genotyping The PCR products of each sample were subjected to Sanger sequencing, and the sequencing peaks of different genotypes were obtained as shown in Figure 2 shown.

[0022] 2. Correlation Analysis 2301 recessive White Rock hens with clear double yolk egg phenotype records at 36 weeks of age were selected for correlation analysis. The ANOVA test function of R 4.2 statistical drawing software was used for statistical test, and the pairwise mean comparison mode was selected to perform statistical test on the genotype and double yolk egg traits of the experimental chicken flocks. P<0.05 indicated significant differences. The results are shown in Table 1. The proportion of double yolk eggs in the three genotype chickens was significantly different (P<0.05). The proportion of double yolk eggs in G / G genotype individuals was 1.80%, which was higher than 1.57% (P<0.05) in A / G genotype individuals and 1.27% (P<0.05) in A / A genotype individuals. The proportion of double yolk eggs in A / G genotype individuals was higher than that in A / A genotype individuals (P<0.05). The results showed that the chicken STON1 gene molecular marker was significantly correlated with the double-yolk egg trait of chickens. According to the actual breeding goals, G / G genotype individuals can be selected to breed chickens with a high proportion of double-yolk eggs, thereby increasing the output rate of double-yolk eggs and improving breeding efficiency.

[0023] Table 1 Statistical analysis of genotypes and phenotypes of STON1 gene molecular markers genotype Count / pcs Double yolk egg ratio Total number of eggs laid A / A 451 <![CDATA[1.27% a ]]> 66.1 A / G 1173 <![CDATA[1.57% b ]]> 65.9 G / G 677 <![CDATA[1.80% c ]]> 66.1 Note: Data in the same column with the same letters on their shoulders indicate no significant difference, while data with different letters on their shoulders indicate significant difference (P<0.05).

[0024] Example 2 Genotype frequencies of different varieties Step 1: Blood sample collection Blood samples from 15 breeds, including Beijing Oily Chicken, Big Bone Chicken, Daweishan Miniature Chicken, Wenchang Chicken, Wuding Chicken, Piao Chicken, Bearded Chicken, Tibetan Chicken, Camellia Chicken, Fujian Hetian Chicken, Liyang Chicken, Xinghua Chicken, Guangxi Sanhuang Chicken, White Leghorn Laying Hen and Recessive White Rock Chicken, were collected by subwing vein blood collection and stored at -20℃ for future use.

[0025] Step 2: Extract genomic DNA Take the tissue sample obtained in step 1 and use Omega's tissue genomic DNA extraction kit to extract genomic DNA. The specific method refers to the standard operating procedure provided by Omega.

[0026] Step 3: Genotype detection Using the genomic DNA obtained in step 2 as a template, a primer pair consisting of an F nucleotide sequence (SEQ ID NO: 1) and an R nucleotide sequence (SEQ ID NO: 2) was used for PCR amplification and Sanger sequencing to obtain the individual's G / G genotype, G / A genotype, and A / A genotype.

[0027] Step 4: Result Analysis Beijing Oil Chicken, Big Bone Chicken, Daweishan Miniature Chicken, Wenchang Chicken, Wuding Chicken, Piao Chicken, Bearded Chicken, Tibetan Chicken, Camellia Chicken, Fujian Hetian Chicken, Liyang Chicken, Xinghua Chicken and Guangxi Sanhuang Chicken are well-known Chinese local chicken breeds. Recessive White Rock Chicken is a popular commercial breed on the market. White Leghorn Laying Hen is a common commercial laying hen breed with high egg production rate and moderate and uniform egg shape. Among them, Chinese local chickens have not undergone long-term selection and breeding, with low egg production, low proportion of abnormal eggs, and higher frequency of A allele in the population than recessive White Rock Chicken. White Leghorn Laying Hen is the most common fine breed laying hen. It has been selected for egg quality traits for a long time, with high egg production, low proportion of abnormal eggs, and higher frequency of A allele in the population than recessive White Rock Chicken. These results can all confirm that the SNP locus can be used as a molecular marker for double yolk eggs in chickens. See Table 2.

[0028] Table 2. Distribution of allele frequencies of STON1 gene molecular markers in different varieties

[0029] In addition to the above implementations, the present invention may also have other implementations. Any technical solution formed by equivalent replacement or equivalent transformation falls within the protection scope required by the present invention.

Claims

1. A molecular marker primer for the STON1 gene associated with the double-yolk egg trait of chickens, characterized in that: The nucleotide sequences of the molecular marker primers are shown in SEQ ID NO: 1 and SEQ ID NO:

2. The molecular marker is located at the 7867409th base on chicken chromosome 3, and the base is mutated to A or G.

2. The use of the STON1 gene molecular marker primers related to the chicken double yolk egg trait according to claim 1, characterized in that: Used to detect SNP genotypes related to the proportion of double yolk eggs.

3. The use of the STON1 gene molecular marker primers related to the chicken double yolk egg trait according to claim 2, characterized in that: The detection method comprises the following steps, The first step is to provide a chicken DNA sample to be tested, and perform PCR amplification using a molecular marker primer pair to obtain an amplification product, wherein the amplification product is 538 bp in length and contains the 7867409th base of chicken chromosome 3; The second step is to perform Sanger sequencing on the PCR product; The third step is to determine the genotype of the SNP molecular marker at base 7867409 of chicken chromosome 3 based on the sequencing results of the second step.

4. The use of the STON1 gene molecular marker primers related to the chicken double yolk egg trait according to claim 3, characterized in that: The final concentration of the reaction system is 25 μl. Chicken DNA to be tested 50 ng, 2 x Accurate Taq Master Mix 12.5 μl, Upstream primer 1 μl, Downstream primer 1 μl, Add sterile water to 25 μl; The reaction conditions of the PCR amplification are: 94°C pre-denaturation for 5 minutes; 94°C denaturation for 30 seconds, 55°C annealing for 30 seconds, 72°C extension for 60 seconds, a total of 30 cycles; 72°C extension for 2 minutes; 4°C storage; the nucleotide sequence of the amplified product is shown in SEQ ID NO: 3 or SEQ ID NO:

4.

5. The use of the STON1 gene molecular marker primers related to the chicken double yolk egg trait according to claim 3, characterized in that: In the third step, the judgment criterion is that the proportion of double yolk eggs of chickens with G / G genotype at the SNP site is higher than that of A / G and A / A genotype individuals, and the proportion of double yolk eggs of chickens with A / G genotype is higher than that of A / A genotype individuals.

Images