Application of pig exosome ssc-miR-22-3p in preparation of inhibitor drug targeting MAPK14 gene

Abstract

The invention discloses an application of a pig exosome ssc-miR-22-3p in preparation of an inhibitor drug of a targeted MAPK14 gene, and belongs to the field of livestock disease drugs. In order to research the effect of the pig milk exosome ssc-miR-22-3p in intestinal inflammation, LPS and Poly (I: C) are used for stimulating IPEC-J2 cells to construct an inflammation injury model, and a molecular mechanism of the pig milk exosome ssc-miR-22-3p in resisting intestinal epithelial cell injury induced by the LPS and Poly (I: C) in IPEC-J2 is planned to be further researched. And an important scientific basis is provided for research on regulation and control of intestinal inflammation reaction by the pig milk exosome miRNA.

Description

Technical Field

[0001] The invention relates to application of porcine exosome ssc-miR-22-3p in preparing an inhibitor drug targeting a MAPK14 gene, and belongs to the field of livestock disease drugs. Background Art

[0002] In recent years, inflammatory diseases of the intestine in piglets have become widespread. This disease can easily cause intestinal dysfunction in piglets, directly affect the feed conversion rate and growth and development of piglets, and even cause death of piglets. Because of its intermittent outbreaks and easy recurrence, it seriously damages the economic benefits of pig farms. Therefore, it is of great significance to study the mechanism of molecular disease resistance regulating intestinal inflammatory response.

[0003] Breast milk is rich in nutrients, including carbohydrates, proteins, fats and bioactive substances. Its bioactive substances are natural anti-infective and anti-inflammatory agents in breast milk (Finn KL, Kineman BD, Czerkies LA, Carvalho RS. Human Milk Bioactives: Future Perspective [J]. Nestle Nutr Inst Workshop Ser. 2021; 96 (1664-2155 (Electronic)): 166-74.), and are an important part of the innate immune system (Underwood MA. Human milk for the premature infant [J]. Pediatr Clin North Am. 2013; 60 (1): 189-207.). Breast milk intake can reduce the morbidity and mortality of inflammatory diseases (Thai JD, Gregory KE. Bioactive Factors in Human Breast Milk Attenuate Intestinal Inflammation during Early Life.LID-10.3390 / nu12020581[doi]LID-581[J].Nutrients.2020;12(2):581.,Lyons KE,Ryan CA,Dempsey EM,Ross RP,Stanton C.Breast Milk,a Source of Beneficial Microbes and Associated Benefits for Infant Health[J].Nutrients.2020;12(4):1039.). Exosomes are one of the bioactive substances and can be isolated from breast milk, urine, saliva, plasma and other body fluids ( C,Alikhani Vs Fau- K, K Fau-Eldh M,Eldh M Fau-Paredes PT,Paredes Pt Fau-Bossios A,Bossios AFau- M,et al.Human saliva,plasma and breast milk exosomes contain RNA:uptake by macrophages[J].(1479-5876(Electronic))). Exosomes are nanovesicles that carry miRNA, mRNA, lncRNA, DNA, lipids, etc. (Xu R Fau-Greening DW, Greening Dw Fau-Zhu HJ, Zhu Hj Fau-Takahashi N, Takahashi N Fau-Simpson RJ, Simpson RJ. Extracellular vesicle isolation and characterization: toward clinical application[J]. J Clin Invest. 2016; 126(4): 1152-62., Krylova SV, Feng D. The Machinery of Exosomes: Biogenesis, Release, and Uptake. LID-10.3390 / ijms24021337[doi] LID-1337[J]. International journal of molecular sciences. 2023; 24(2): 1337.). Milk exosomes enter the intestine through milk and are absorbed by the intestine during lactation to regulate immune function (Kosaka N, Izumi H, Sekine K, Ochiya T. microRNA as a new immune-regulatory agent in breast milk [J]. Silence. 2010; 1 (1): 7). Studies have found that the immune-related structures carried by milk exosomes can promote the development and maturation of the immune system and play a key role in intestinal development and barrier function (Admyre C, Johansson Sm Fau-Qazi KR, Qazi Kr Fau-Filén JJ, Filén Jj Fau-Lahesmaa R, Lahesmaa R Fau-Norman M, Norman M Fau-Neve EPA, et al. Exosomes with immune modulatory features are present in human breast milk [J]. (0022-1767 (Print)).).Therefore, it may be helpful in the prevention and treatment of intestinal inflammatory diseases (.

[0004] Melnik BA-O, Stremmel W, Weiskirchen RA-O, John SM, Schmitz GA-O. Exosome-Derived MicroRNAs of Human Milk and Their Effects on Infant Health and Development. LID-10.3390 / biom11060851[doi]LID-851[J]. Biomolecules. 2021;11(6):851.). In addition, exosomes play a key role in immune regulation and signal transduction between cells of the immune system (Robbins PD, Morelli AE. Regulation of immune responses by extracellular vesicles [J]. Nat Rev Immunol. 14 (3): 195-208.), and can deliver proteins and nucleic acids to receptor cells through vesicle transport, regulate inflammation and immune responses, and play an important role in regulating inflammatory bowel disease (Wani S, ManLaw IK, Pothoulakis C. Role and mechanisms of exosomal miRNAs in IBD pathophysiology [J]. Am J Physiol Gastrointest Liver Physiol. 319 (6): G646-G54., Ocansey DKW, Zhang L, Wang Y, Yan Y, Qian H, Zhang X, et al. Exosome-mediated effects and applications in inflammatory bowel disease [J]. Biol Rev Camb Philos Soc. 2020;95(5):1287-307.).

[0005] Lipopolysaccharide (LPS) is an endotoxin of the cell wall of Gram-negative bacteria. It is cytotoxic and can damage intestinal morphology and barrier function. It is widely used to construct intestinal inflammatory response models (Izadparast F, Riahi-Zajani B, Yarmohammadi F, Hayes AW, Karimi G. Protective effect of berberine against LPS-induced injury in the intestine: a review[J]. Cell Cycle. 2022; 21(22): 2365-78., Yi D, Hou Y, Xiao H, Wang L, Zhang Y, Chen H, et al. N-Acetylcysteine ​​improves intestinal function in lipopolysaccharides-challenged piglets through multiple signaling pathways[J]. Amino acids. 2017; 49(12): 1915–29.). Polyinosinic-polycytidylic acid (Poly(I:C)) is a synthetic viral double-stranded RNA that is often used to simulate pathogen infection (Quach C, Helou DG, Li M, Hurrell BP, Howard E, Shafiei-Jahani P, et al. Enhancing autophagy in CD11c(+)antigen-presenting cells as a therapeutic strategy for acute respiratory distress syndrome[J]. Cell reports. 2023; 42(8): 112990. Bianchi FA-O, Pretto S, Tagliabue EA-O, Balsari AA-O, Sfondrini LA-O. Exploiting poly(I:C) to induce cancer cell apoptosis[J]. Cancer biology&therapy. 2017; 18(10): 747-56.).

[0006] MicroRNA (miRNA) plays an important role in physiological and pathological processes such as growth, development, differentiation, proliferation and immune response. MiRNA is a small non-coding RNA that regulates mRNA expression and translation. Usually, the miRNA sequence is complementary to the sequence in the 3′UTR of the target gene, inhibiting mRNA expression and translation. It has been confirmed that there are a large number of miRNAs in pig milk exosomes, and the miRNA encapsulated in exosomes is closely related to the pathological and physiological processes of the intestine. Studies have found that pig milk exosomal miRNA plays a very important regulatory role in intestinal epithelial cell damage induced by Deoxynivalenol (DON). Exosomal miR-207 can alleviate stress symptoms in mice. The transfer of exosomal microRNA to offspring through milk and its role in the development of the immune system have attracted widespread attention from scholars around the world. However, the mechanism by which pig milk exosomal miRNA regulates the inflammatory response of IPEC-J2 induced by LPS and Poly (I:C) is still unclear.

[0007] We previously performed miRNA-seq sequencing on milk exosomes from Bamei and Landrace pigs, and found through GO and KEGG enrichment analysis that ssc-miR-22-3p is closely related to processes such as cell physiology and immune system development (Breed-Related Differential microRNA Expression and Analysis of Colostrum and MatureMilk Exosomes in Bamei and Landrace Pigs).

[0008] Intestinal inflammatory diseases in piglets are widespread and seriously damage the economic benefits of pig farms. Exosomal miRNAs in pig milk play an important regulatory role in intestinal inflammation, and there is still a gap in the study of their role in intestinal inflammatory diseases. In the early stage, we compared and analyzed the exosomal miRNAs in the milk of Chinese native pigs and imported pig breeds and screened out miRNA ssc-miR-22-3p related to inflammation and immune response. However, the role of ssc-miR-22-3p in the immune response of IPEC-J2 is still unclear. Summary of the invention

[0009] In order to study the role of porcine milk exosome ssc-miR-22-3p in intestinal inflammation, we used LPS and Poly (I: C) to stimulate IPEC-J2 cells to construct an inflammatory injury model. We intend to further study the molecular mechanism of porcine milk exosome ssc-miR-22-3p in IPEC-J2 in resisting LPS and Poly (I: C)-induced intestinal epithelial cell damage, and provide important scientific basis for the study of porcine milk exosome miRNA regulating intestinal inflammatory response.

[0010] In this study, porcine milk exosome ssc-miR-22-3p was overexpressed and knocked down in IPEC-J2 by ​​overexpression and interference technology, and porcine intestinal epithelial cells (IPEC-J2) were stimulated with LPS and Poly (I: C) to construct an inflammatory response model. The regulatory role of porcine milk exosome ssc-miR-22-3p in regulating IPEC-J2 inflammatory damage induced by LPS and Poly (I: C) was studied by RT-qPCR, CCK-8, EdU staining, lactate dehydrogenase (LDH) activity detection, and dual luciferase reporter gene assay.

[0011] The present invention provides an application of porcine milk exosome ssc-miR-22-3p in the preparation of an inhibitor drug targeting the MAPK14 gene. The porcine milk exosome ssc-miR-22-3p promotes cell proliferation and improves cell viability by targeting the MAPK14 gene, thereby alleviating LPS and / or Poly (I:C)-induced cellular inflammatory response.

[0012] In one embodiment of the present invention, the cell is an IPEC-J2 cell.

[0013] In one embodiment of the present invention, the sequence of the porcine milk exosome ssc-miR-22-3p is shown in SEQ ID NO.1;

[0014] The porcine milk exosome ssc-miR-22-3p sequence (SEQ ID NO.1) is: AAGCTGCCAGTTGAAGAACTGT (5' to 3').

[0015] In one embodiment of the present invention, the inflammatory factors of the inflammatory response include but are not limited to IL-6, IL-8, TNF-α, and IL-1β.

[0016] In one embodiment of the present invention, the alleviation of inflammatory response further comprises reducing lactate dehydrogenase (LDH) activity and increasing IPEC-J2 cell proliferation and cell viability.

[0017] Relief of inflammatory response also includes decreased lactate dehydrogenase (LDH) activity, which may increase in cellular inflammatory response. Lactate dehydrogenase (LDH) is an enzyme that is stably present in the cell cytoplasm. Under normal circumstances, it only exists inside the cell. When cells are stimulated to die, the plasma membrane ruptures and lactate dehydrogenase is rapidly released outside the cell. Therefore, it is used as one of the widely used markers in cytotoxicity research. During the inflammatory response, cells may be damaged or die, resulting in the release of lactate dehydrogenase, which may cause an increase in lactate dehydrogenase activity. In addition, injuries such as burns can cause inflammatory responses and increased energy requirements, leading to local and systemic adverse reactions. In burn wounds, visualization of lactate dehydrogenase activity has been used to determine differences in metabolic activity, thereby determining cell viability and burn depth in burned skin. Studies have found that lactate dehydrogenase activity in the middle and deep areas of burned skin is significantly higher than that in the superficial area of ​​burned skin and uninjured tissue, and is positively correlated with the time after burn. Areas with increased lactate dehydrogenase activity showed cell infiltration, including CD3+ and CD4+ T lymphocytes and CD68+ macrophages, indicating that increased lactate dehydrogenase activity is associated with inflammatory infiltration. Therefore, it can be considered that in some inflammatory reactions, LDH activity may be increased, which is related to cell damage and death, and may also be related to the infiltration of inflammatory cells.

[0018] In one embodiment of the present invention, the MAPK14 gene binds to ssc-miR-22-3p at 1420-1436 bp of the 3'UTR sequence.

[0019] The present invention also provides a method for screening a drug for alleviating LPS and / or Poly (I: C)-induced cellular inflammatory response, the method comprising:

[0020] In the test group, the test compound and ssc-miR-22-3p are added to the culture system, and the expression amount and / or activity of the MAPK14 gene in the test group is observed; in the control group, the test compound is not added to the same culture system, and the expression amount and / or activity of the MAPK14 gene in the control group is observed;

[0021] If the expression level and / or activity of the MAPK14 gene in the test group is lower than that in the control group, it indicates that the test compound is an inhibitor drug targeting the MAPK14 gene.

[0022] In one embodiment of the present invention, the cell is an IPEC-J2 cell.

[0023] In one embodiment of the present invention, the sequence of the porcine exosome ssc-miR-22-3p is shown as SEQ ID NO.1.

[0024] In one embodiment of the present invention, the inflammatory factors of the inflammatory response include but are not limited to IL-6, IL-8, TNF-α, and IL-1β; the alleviation of the inflammatory response also includes reduced lactate dehydrogenase (LDH) activity, increased IPEC-J2 cell proliferation and cell viability; the MAPK14 binds to porcine exosome ssc-miR-22-3p at 1420-1436bp of the 3'UTR sequence.

[0025] The present invention provides an application of porcine exosome ssc-miR-22-3p in studying the functions of genes related to the alleviation of IPEC-J2 inflammatory response induced by LPS and / or Poly (I: C), or analyzing the application of porcine exosome ssc-miR-22-3p gene in inhibiting MAPK14 expression, or analyzing the application of drugs related to gene therapy for alleviating IPEC-J2 inflammatory response induced by LPS and / or Poly (I: C). The porcine exosome ssc-miR-22-3p alleviates IPEC-J2 inflammatory response induced by LPS and / or Poly (I: C) by targeting MAPK14.

[0026] In one embodiment of the present invention, the sequence of the porcine exosome ssc-miR-22-3p is shown in SEQ ID NO.1

[0027] In one embodiment of the present invention, the inflammatory factors of the inflammatory response include but are not limited to IL-6, IL-8, TNF-α, and IL-1β; the alleviation of the inflammatory response also includes reduced lactate dehydrogenase (LDH) activity, increased IPEC-J2 cell proliferation and cell viability; the MAPK14 binds to porcine exosome ssc-miR-22-3p at 1420-1436bp of the 3'UTR sequence.

[0028] The present invention also provides a method for studying the molecular mechanism of porcine exosome ssc-miR-22-3p alleviating LPS and / or Poly (I:C)-induced IPEC-J2 inflammatory response by targeting MAPK14 gene, the method comprising the following steps:

[0029] Porcine exosome ssc-miR-22-3p acts as a sponge and can competitively bind to the MAPK14 gene. By preparing porcine exosome ssc-miR-22-3p drugs, intestinal inflammatory damage can be alleviated.

[0030] The present invention also provides a cell model method for screening drugs, wherein the drug is used to alleviate the IPEC-J2 inflammatory response induced by LPS and / or Poly (I: C), and the method for constructing the cell model comprises:

[0031] The method is:

[0032] In the test group, the test compound, porcine exosome ssc-miR-22-3p and IPEC-J2 cells were added to the culture system and incubated together, and the expression amount and / or activity of the MAPK14 gene in the test group was observed; in the control group, the test compound was not added to the same culture system, and the expression amount and / or activity of the MAPK14 gene in the control group was observed;

[0033] If the expression level and / or activity of the MAPK14 gene in the test group is lower than that in the control group, it indicates that the test compound is an inhibitor drug targeting MAPK14.

[0034] In one embodiment of the present invention, the sequence of the porcine exosome ssc-miR-22-3p is shown as SEQ ID NO.1.

[0035] In one embodiment of the present invention, the inflammatory factors of the inflammatory response include but are not limited to IL-6, IL-8, TNF-α, and IL-1β; the alleviation of the inflammatory response also includes reduced lactate dehydrogenase (LDH) activity, increased IPEC-J2 cell proliferation and cell viability; the MAPK14 gene binds to ssc-miR-22-3p at 1420-1436bp of the 3'UTR sequence.

[0036] Beneficial Effects

[0037] Overexpression of porcine exosomal ssc-miR-22-3p reduced cytokine expression and promoted cell viability and proliferation. Functional enrichment analysis found that porcine exosomal ssc-miR-22-3p targeted genes enriched in pathways such as Negative regulation of inflammatory response and Bacterial invasion of epithelial cells. The effectiveness of porcine exosomal ssc-miR-22-3p binding site to MAPK14 gene was verified by dual luciferase reporter gene.

[0038] Porcine milk exosomes ssc-miR-22-3p promoted cell viability and proliferation by targeting the MAPK14 gene and alleviated the inflammatory response of IPEC-J2 cells induced by LPS and Poly(I:C). BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 :Schematic diagram of the construction of pmirGLO-MAPK14-3'UTR recombinant vector.

[0040] Figure 2: Effects of LPS and Poly(I:C) on the viability and cytokine expression of IPEC-J2; *P<0.05, **P<0.01, ns indicates no significant difference.

[0041] Figure 3 : Relative expression level of porcine exosomal ssc-miR-22-3p in IPEC-J2 induced by LPS and Poly(I:C); wherein, (A) is the conservation analysis of the mature sequence of miR-22-3p in different species; (B) is the relative expression level of ssc-miR-22-3p after IPEC-J2 was stimulated with LPS; (C) is the relative expression level of porcine exosomal ssc-miR-22-3p after IPEC-J2 was stimulated with Poly(I:C); *P<0.05, **P<0.01.

[0042] Figure 4 : Detection of transfection efficiency of porcine exosome ssc-miR-22-3p; *P<0.05, **P<0.01.

[0043] Figure 5 : Effects of porcine exosomal ssc-miR-22-3p on the inflammatory response of IPEC-J2 cells induced by LPS and Poly(I:C); *P<0.05, **P<0.01, ns indicates no significant difference.

[0044] Figure 6 :Effects of porcine exosomal ssc-miR-22-3p on LPS- and Poly(I:C)-induced IPEC-J2 cell cytotoxicity; *P<0.05, **P<0.01

[0045] Figure 7 : Analysis of porcine exosomal ssc-miR-22-3p on LPS- and Poly(I:C)-induced IPEC-J2 cell viability (AB) and cell proliferation (CF). *P<0.05, **P<0.01, ns indicates no significant difference.

[0046] Figure 8 : Functional enrichment analysis of porcine exosome ssc-miR-22-3p; (A) is the interaction network diagram of ssc-miR-22-3p and mRNA genes; the ellipse represents mRNA, the triangle represents miRNA, and the color of the ellipse represents the size of the free energy formed by the miRNA and mRNA sequences; (B) and (C) represent the GO and KEGG enrichment analysis of ssc-miR-22-3p target genes, respectively; (D) is the RT-qPCR verification of immune-related target genes; *P<0.05, **P<0.01, ns indicates that the difference is not significant.

[0047] Fig. 9: Study on the targeting relationship between porcine exosomal ssc-miR-22-3p and MAPK14; Note: (A) Restriction map of MAPK14 recombinant vector; Lane 1: red circle indicates the self-labeled empty vector before digestion, and yellow indicates the recombinant vector before digestion; Lane 2: vector and target fragment after digestion with HindIII; Lane 3: 1kb ladder; (B) Sanger sequencing peak map of pmirGLO-MAPK14-WT and pmirGLO-MAPK14-MUT; (C) Dual luciferase reporter gene detection of the targeting relationship between ssc-miR-22-3p and MAPK14; *P<0.05, **P<0.01, ns indicates that the difference is not significant. DETAILED DESCRIPTION

[0048] The raw data of miRNA obtained from colostrum and mature milk exosomes of Bamei pigs and Landrace pigs were stored in the NCBI SRA database (BioProject: PRJNA940673).

[0049] LPS and Poly(I:C) models are used to simulate bacterial infection and viral infection, respectively, and are mature models of bacterial and double-stranded RNA virus infection. Therefore, this study selected LPS and Poly(I:C) to construct the IPEC-J2 inflammatory response model.

[0050] The detection methods involved in the following embodiments are as follows:

[0051] Lactate dehydrogenase (LDH) activity assay

[0052] After cell transfection, the cells were treated with toxin for 24 h, and the cell culture fluid was collected and centrifuged at 4000 rpm for 5 min. The supernatant was tested. The LDH content in the cell supernatant was tested according to the instructions of the lactate dehydrogenase (LDH) assay kit (Jancheng Bioengineering Institute, Nanjing, China), and the absorbance value at a wavelength of 450 nm was measured using an enzyme marker.

[0053] CCK8 and EdU detection of cell viability and proliferation

[0054] IPEC-J2 cells were overexpressed with porcine exosome ssc-miR-22-3p and transfected with interference plasmid for 24 h, and then stimulated with LPS and Poly(I:C) for 24 h. 10 μL CCK-8 Solution (Beyotime, Shanghai, China) was added to each well. The cells were incubated in a cell culture incubator for 4 h. The absorbance at 450 nm was measured using an ELISA reader.

[0055] According to BeyoClick TMAccording to the instruction manual of EdU Cell Proliferation Kit with Alexa Fluor 555 (Beyotime, Shanghai, China), IPEC-J2 transfected and exposed to LPS and Poly(I:C) were incubated with EdU solution for 2 h, and EdU staining was performed. Finally, positive proliferating cells were observed using an Olympus IX71 fluorescence microscope (Olympus IX71, Tokyo, Japan).

[0056] Prediction and bioinformatics analysis of target genes of porcine exosome ssc-miR-22-3p

[0057] In order to further understand the mechanism of action of ssc-miR-22-3p, the OmicStudio tool (https: / / www.omicstudio.cn / tool / 7) based on TargetScan (v5.0) and miRanda (v3.3a) was used to predict the target genes of ssc-miR-22-3p. The common genes predicted by the two software were selected, and the target genes of ssc-miR-22-3p were predicted with TargetScan_score≥50 and miranda_Energy<-10 as the screening threshold. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis was performed using DAVID (https: / / david.ncifcrf.gov / ) software. Cytoscape (V3.8.0) was used to draw the interactive network diagram of porcine exosome ssc-miR-22-3p target genes. The homology between the mature sequences of porcine Susscrofa and miR-22-3p from other species was analyzed using MEGA11.0 software.

[0058] Dual-luciferase reporter gene activity assay

[0059] HEK-293T cells were cultured in DMEM high glucose medium containing 10% fetal bovine serum at 37°C and 5% CO. 2 The cells with good growth status were seeded into 24-well plates. Reagent2000 (Invitrogen, CA, USA) and miRNA mimic instructions were used. HEK-293T cells were co-transfected with mimic NC / miR-22-3pmimic and MAPK14-3′UTR wild-type and mutant recombinant plasmids, respectively. There were 4 groups in the experiment: pmirGLO-MAPK14-WT+mimic NC, pmirGLO-MAPK14-WT+miR-22-3p mimic, pmirGLO-MAPK14-Mut+mimic NC, and pmirGLO-MAPK14-Mut+miR-22-3p mimic simulation groups. The transfected HEK-293T cells were subjected to luciferase reporter gene assay after 48 h. The activities of firefly luciferase and Renilla luciferase were determined in 96-well ELISA plates according to the manufacturer's instructions of Dual Luciferase Reporter Assay Kit (Vazyme, Nanjing, China). The relative luciferase activity was calculated as the ratio of the firefly fluorescence value to the Renilla fluorescence value. Three biological replicates were evaluated for each treatment.

[0060] Real-time quantitative polymerase chain reaction (RT-qPCR)

[0061] Total RNA in cells was extracted with Trizol, and cDNA required for mRNA quantification was synthesized according to the instructions of the Evo M-MLV RT Mix Kit with gDNA Clean for qPCR Ver.2 (Accurate Biotechnology, Hunan, China). cDNA required for miRNA quantification was synthesized according to the instructions of the miRNA First strand cDNA synthesis kit (Accurate Biotechnology, Hunan, China). Green Premix Pro TaqHS qPCR Kit and LightCycler480Instrument II (Roche, Basel, Switzerland) were used for fluorescence quantitative PCR detection. RT-qPCR reaction conditions: 95°C pre-denaturation for 30 s; 95°C denaturation for 5 s, 60°C annealing for 30 s, 40 cycles. Each sample was repeated three times with 2 -ΔΔCt Law

[33] Calculate the relative expression.

[0062] The mature sequence of porcine exosome ssc-miR-22-3p was obtained from the miRBase (https: / / www.mirbase.org / ) database. Specific upstream primers were designed, and miRNA qPCR 3′primer was used downstream; U6 gene was used as an internal reference gene. mRNA sequence was downloaded from the National Center for Biotechnology Information (NCBI; https: / / www.ncbi.nlm.nih.gov / ); primers were designed by Primer-BLAST software, GAPDH was used as an mRNA internal reference gene, and was synthesized by GeneWeiZhi Biotechnology Co., Ltd. The detailed information of RT-qPCR primers is shown in Table 1.

[0063] Table 1: Real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR) primers amplifying specific genes.

[0064]

[0065]

[0066] Data Statistical Analysis

[0067] IBM SPSS25 was used to perform statistical analysis on the experimental data. The independent sample t-test was used for significance analysis, and the data were expressed as mean ± standard deviation (mean ± SD). Origin2018 software was used to draw graphs; *P < 0.05 indicates a significant difference, **P < 0.01 indicates an extremely significant difference, and ns indicates a non-significant difference.

[0068] Example 1: Screening of immune-related target genes

[0069] The specific steps are as follows:

[0070] (1) This study used TargetScan (v5.0) and miRanda (v3.3a) software to predict target genes simultaneously, and obtained 1608 common target genes by intersection prediction. According to the target gene interaction network, the matching score (TargetScan_score) and free energy (miranda_Energy) of the binding site were analyzed at the same time. The target gene set was further analyzed for functional enrichment. Combined with inflammation and immune-related GO and KEGG enrichment pathways, six key target genes were initially screened: FAS, MAPK14, WNT5A, CXCL12, CBL and AKT3. The NCBI transcript numbers are: NM_213839.1, XM_001929490.6, XM_005669660.3, XM_005671243.3, XM_003129932.4, XM_021063994.1.

[0071] (2) IPEC-J2 cells (purchased from: Beina Biotech) were transfected with miR-22-3p mimic and mimic NC, and the effects of ssc-miR-22-3p on the expression of these genes were detected by RT-qPCR assay, and genes with negative regulatory relationships were screened as putative target genes. The specific steps are as follows:

[0072] Referring to the instructions of miRNA mimics and inhibitors, first dilute the miRNA mimics and inhibitors to a 20 μM working solution. TM 2000 Transfection Reagent instructions for cell transfection. The transfection concentration of miRNA mimic / mimic NC is 50nM, and the transfection concentration of miRNA inhibitor / inhibitor NC is 100nM. The specific steps are as follows:

[0073] (1) When the cells are growing well and the density reaches 70% to 80%, transfection can be performed. Discard the old culture medium and replace it with Opti-MEM serum-free culture medium;

[0074] (2) Reagent dilution: Dilute the liposome Lipofectamine with Opti-MEM serum-free medium. TM 2000 and miRNA mimic / inhibitor, respectively, were mixed and incubated at room temperature for 5 min;

[0075] (3) Mix the diluted liposomes with the miRNA mimic / inhibitor, pipette to mix, and incubate at room temperature for 20 min;

[0076] (4) Add the mixed complex to the cell culture well and place in an incubator at 37°C containing 5% CO2 for further culture. After 6 hours, replace with complete medium containing serum;

[0077] (5) After 24 h of culture, the cells were collected and total cellular RNA was extracted using the TransZol method. The RNA concentration and purity were detected using a Nanodrop 2000 ultra-micro spectrophotometer. PT-qPCR was used after the test was qualified.

[0078] (6) RT-qPCR verification of the expression levels of six key target genes (FAS, MAPK14, WNT5A, CXCL12, CBL and AKT3) Figure 8 D) The negative regulatory target gene MAPK14 was screened and was related to immunity;

[0079] (7) Finally, dual luciferase reporter gene assay was performed to verify the targeting relationship between ssc-miR-22-3p and MAPK14.

[0080] Example 2: Construction of wild-type and mutant plasmids of MAPK14 3′UTR region

[0081] The specific steps are as follows:

[0082] (1) The gene sequence of MAPK14 (XM_001929490.6) was downloaded from NCBI, and the wild-type (sequence: AGGTGTCTTTTCCACCCTCCTTTGGAAAAAGGGTCTTCTTGGCAGCTTAACATTGACTTCTTGGTCTTGGTTTGAGG; SEQ ID NO. 2) and mutant (AGGTGTCTTTTCCACCCTCCTTTGGAAAAACCGAGAAGAACCGTCGATAACATTGACT TCTTGGTCTTGGTTTGAGG; SEQ ID NO. 3) sequences of the 3′UTR region of the MAPK14 gene were synthesized.

[0083] (2) The above genes were cloned into the dual luciferase reporter gene vector pmirGLO (cloning sites: 5'NheI and 3'XhoI) ( Figure 1 ), and the wild-type vector (pmirGLO-MAPK14-WT) and mutant vector (pmirGLO-MAPK14-MUT) of MAPK14 3′UTR dual luciferase reporter gene were constructed, respectively. The vectors were synthesized by GeneWeizhi Biotechnology Co., Ltd. (Jiangsu, China).

[0084] MAPK14 binds to porcine exosome ssc-miR-22-3p at 1420-1436bp in the 3'UTR sequence ( Figure 1 ). The recombinant vectors pmirGLO-MAPK14-WT and pmirGLO-MAPK14-MUT were constructed, the amplified products were detected by 1% agarose gel electrophoresis, and the recombinant vectors were double-digested with restriction endonucleases NheI and XhoI for verification.

[0085] The results showed that the target fragment size was consistent with the expected size ( Fig. 9 A), indicating that the recombinant vector of the 3'UTR region of the MAPK14 gene was successfully constructed. Using the constructed recombinant vector as a template, specific primers were designed to amplify and sequence the target fragment. After sequencing identification, its binding site was successfully mutated ( Fig. 9 B), the recombinant vector can be used for subsequent dual luciferase activity detection experiments.

[0086] (3) miRNA overexpression and interference plasmids were designed and synthesized by GenePharma (Shanghai, China). The sequences are shown in Table 2.

[0087] Table 2 MicroRNA mimic and inhibitor sequence information

[0088]

[0089] pmirGLO-MAPK14-WT and pmirGLO-MAPK14-MUT were prepared respectively.

[0090] Example 3: Cell culture, transfection and injury model construction

[0091] The specific steps are as follows:

[0092] (1) Porcine intestinal epithelial cells (IPEC-J2) were purchased from BeNa Culture Collection (Beijing, China) and cultured in high-glucose medium (DMEM) containing 10% fetal bovine serum (FBS; Gibco, Waltham, MA, USA) and 1% penicillin / streptomycin (Hyclone).

[0093] (2) Porcine intestinal epithelial cells (IPEC-J2) were inoculated into high-glucose medium DMEM and incubated at 37°C with 5% CO 2After the subculture, the cells were digested with 0.25% trypsin-EDTA (0.25%, Gibco, USA) when they reached 80% confluence and then seeded in 24-well plates.

[0094] (3) Lipofectamine was used according to the manufacturer's instructions. TM Reagent 2000 (Invitrogen, Waltham, MA, USA) was used for transfection, and miR-204 mimic and miR-204 inhibitor were transfected into the above-cultured porcine small intestinal epithelial cells (IPEC-J2), respectively.

[0095] (4) Different concentrations (10, 20, 30, 40, 50, 60, 70 and 80 μg / mL) of LPS (lipopolysaccharide 055:B5 from Escherichia coli, Sigma-Aldrich, Shanghai, China) and Poly(I:C) (Invitrogen, CA, USA) (10, 20, 30, 40, 50, 60, 70 and 80 μg / mL) were added to the transfected IPEC-J2 cells for 24 h to construct LPS cell injury model and Poly(I:C) cell injury model.

[0096] Finally, the optimal treatment dose was evaluated by measuring cell viability and inflammatory cytokine expression levels to determine the added doses of LPS and Poly(I:C) for subsequent functional verification.

[0097] Example 4: Experimental results

[0098] 1. Effects of LPS and Poly(I:C) on IPEC-J2 viability and cytokine expression

[0099] (1) IPEC-J2 cells were treated with different concentrations of LPS (10-80 μg / mL) for 24 hours and then the cell viability was detected. The results are shown in Table 3:

[0100] Table 3: Cell viability of IPEC-J2 cells after LPS treatment

[0101] 0μg / mL 10 μg / mL 20 μg / mL 30 μg / mL 40 μg / mL 50 μg / mL 60 μg / mL 70 μg / mL 80 μg / mL 100±0.35 90.13±1.19 85.75±0.47 85.4±0.21 83.46±0.34 72.92±0.52 72.83±0.54 71.96±0.19 65.82±0.09

[0102] The results showed that compared with the control group, 10 μg / mL LPS treatment could significantly reduce cell viability (P<0.01), and cell viability gradually decreased with increasing concentration ( Figure 2 A).

[0103] (2) After IPEC-J2 was stimulated with different concentrations of LPS, the expression levels of TLR4, IL-6, IL-8, TNF-α, and IL-1β genes are shown in Table 4:

[0104] Table 4: Expression levels of inflammatory factors after LPS stimulation of IPEC-J2

[0105]

[0106]

[0107] The results showed that after IPEC-J2 was stimulated by different concentrations of LPS, the expression levels of TLR4, IL-6, IL-8, TNF-α, and IL-1β genes increased rapidly, and there were significant differences compared with the control group (P<0.05) ( Figure 2 BF).

[0108] (3) Treatment of IPEC-J2 with 10-80 μg / mL Poly(I:C) for 24 h did not affect cell viability ( Figure 2 G). The results are shown in Table 5:

[0109] Table 5: Cell viability of IPEC-J2 cells after poly(I:C) treatment

[0110] 0μg / mL 10 μg / mL 20 μg / mL 30 μg / mL 40 μg / mL 50 μg / mL 60 μg / mL 70 μg / mL 80 μg / mL 100±0.82 99.78±0.08 101.92±1.39 98.58±3.33 98.33±6.78 99.24±3.36 99.89±0.54 99.53±1.63 101.38±2.43

[0111] (4) After IPEC-J2 was stimulated with different concentrations of Poly(I:C), the expression levels of TLR3, IL-6, IL-8, TNF-α, and IL-1β genes are shown in Table 6:

[0112] Table 6: Expression levels of inflammatory factors after Poly(I:C) stimulation of IPEC-J2

[0113] TLR3 IL-6 IL-8 TNF-α IL-1β 0μg / mL 1.01±0.21 1±0.01 1±0.10 1±0.05 1±0.02 10 μg / mL 1.66±0.35 1.25±0.24 1.45±0.26 1.36±0.19 1.24±0.31 20 μg / mL 2.83±0.08 3.05±0.12 1.53±0.25 3.53±0.06 6.9±0.48 30 μg / mL 6.51±0.38 4.18±0.34 13.9±1.69 4.7±0.52 16.61±0.64 40 μg / mL 14.87±1.33 7.61±0.94 18.69±2.25 4.76±0.43 27.13±1.62 50 μg / mL 29.5±2.20 21.81±1.88 50.25±2.49 28.17±2.15 76.68±3.08 60 μg / mL 37.94±4.12 67.41±3.80 58.54±3.12 67.78±5.18 102.81±3.34 70 μg / mL 39.85±8.83 80.88±3.86 68.16±8.62 77.06±4.00 143.68±12.08 80 μg / mL 51.76±1.65 123.36±10.30 100.25±4.03 144.71±20.86 205.62±24.58

[0114] The results showed that when IPEC-J2 was treated with 10 μg / mL Poly(I:C) for 24 h, only TNFα was significantly upregulated (P<0.05), while other cytokines showed no significant differences ( Figure 2 K). After IPEC-J2 was stimulated with 20-80μg / mL Poly(I:C), the expression levels of TLR3, IL-6, IL-8, TNF-α, and IL-1β genes were significantly higher than those in the control group (P<0.05). Figure 2 HL).

[0115] The results showed that LPS (10μg / mL) and Poly (I: C) (20μg / mL) induced IPEC-J2 cells for 24 hours to stimulate the immune response of IPEC-J2. We successfully established a cell injury model induced by LPS and Poly (I: C) in IPEC-J2.

[0116] 2. Expression level of ssc-miR-22-3p in IPEC-J2 stimulated by LPS and Poly(I:C)

[0117] The homology of the mature miR-22-3p sequences of 10 species, including pig Sus scrofa (ssc), human Homo sapiens (hsa), mouse Mus musculus (mmu), rat Rattus norvegicus (rno), sheep Ovis aries (oar), cattle Bos taurus (bta), rabbit Oryctolagus cuniculus (ocu), platypus Omithorhynchus anatinus (oan), jungle fowl Gallus galluscuniculus (gga) and African frog Xenopus tropicalis (xtr), was analyzed by MEGA11.0 software. It was found that the homology of miR-22-3p in these 10 species was high, and the seed sequences at positions 2 to 8 of the 5' end were completely consistent ( Figure 3 A).

[0118] The expression level of ssc-miR-22-3p was detected after IPEC-J2 cells were treated with LPS (10 μg / mL) and Poly (I:C) (20 μg / mL) for 24 h;

[0119] The results showed that the expression level of porcine exosome ssc-miR-22-3p in the LPS group (expression level: 0.31±0.03) and the Poly group (expression level: 0.65±0.05) was significantly lower than that in the control group (expression level: 1±0.05) (P<0.01) ( Figure 3 B, C), it is speculated that it may play a regulatory role in the inflammatory response of IPEC-J2 induced by LPS (10 μg / mL) and Poly (I:C) (20 μg / mL), which needs to be confirmed by further experiments.

[0120] 3. Detection of transfection efficiency of porcine exosomes ssc-miR-22-3p

[0121] The specific steps are as follows:

[0122] The chemically synthesized mimic NC / miR-22-3p mimic and inhibitor NC / miR-22-3pin inhibitor were transfected into IPEC-J2, respectively. 24 hours after transfection, the expression level of miR-22-3p was detected by RT-qPCR.

[0123] The results showed that compared with transfection with mimic NC, transfection with miR-22-3p mimic significantly enhanced the expression of miR-22-3p (increased by 63.26%) (P<0.01; Figure 4 ); Compared with the transfection of inhibitor NC, miR-22-3p inhibitor could significantly reduce the expression of miR-22-3p in porcine exosomes (reduced by 52%) (P<0.01; Figure 4 ).

[0124] The results showed that the overexpression and interference efficiency of miR-22-3p mimics and inhibitors were good and could be used in subsequent experiments.

[0125] 4. Upregulation of porcine exosome ssc-miR-22-3p significantly inhibited the expression of IPEC-J2 cytokines induced by LPS and Poly(I:C)

[0126] The specific steps are as follows:

[0127] IPEC-J2 cells were treated with LPS (10 μg / mL) and Poly (I:C) (20 μg / mL) for 24 h, and then transfected with miR-22-3pmimic. The inflammatory factors in IPEC-J2 cells were detected, and the results showed that the inflammatory cytokines IL-6, IL-8, TNF-α, and IL-1β were down-regulated to varying degrees;

[0128] After transfection with miR-22-3p inhibitor, the inflammatory factors in IPEC-J2 cells were detected. The results showed that the inflammatory cytokines IL-6, IL-8, TNF-α, and IL-1β were up-regulated to varying degrees (P<0.05) ( Figure 5 A, B).

[0129] These results suggest that miR-22-3p mimic alleviates cell damage and inflammatory responses.

[0130] 5. Lactate dehydrogenase (LDH) activity detection

[0131] IPEC-J2 cells were treated with LPS (10 μg / mL) and Poly (I:C) (20 μg / mL) for 24 h, and then transfected with miR-22-3pmimic. The LDH activity in the cell supernatant was detected. The results showed that the LDH activity in the cell supernatant was significantly decreased (P<0.05).

[0132] After transfection with miR-22-3p inhibitor, the LDH activity in the cell supernatant was detected, and the results showed that the LDH activity was significantly increased (P<0.01) ( Figure 6 A, B), indicating that ssc-miR-22-3p overexpression reduced cytotoxicity.

[0133] Table 7: Effects on LDH activity

[0134]

[0135] 6. Effect of ssc-miR-22-3p on cell viability and proliferation (EDU)

[0136] IPEC-J2 cells treated with LPS (10 μg / mL) and Poly(I:C) (20 μg / mL) for 24 hours showed that the cell viability was weakened after LPS treatment, while Poly(I:C) had no significant effect on cell viability.

[0137] Compared with the respective negative control groups, after 24 h of LPS (10 μg / mL) and Poly (I:C) (20 μg / mL) treatment, transfection of miR-22-3p mimic significantly increased the viability of IPEC-J2 cells (P<0.05), while transfection of miR-22-3pinhibitor significantly decreased the cell viability (P<0.05) ( Figure 7 A, B).

[0138] Table 8: Effects on IPEC-J2 cell viability

[0139]

[0140] The results of EdU staining test showed that ( Figure 7 CF), compared with the control group, the EdU positive signal in the LPS and Poly(I:C) treatment groups was weakened and cell proliferation was inhibited.

[0141] Compared with miR-22-3p mimic NC, the number of EdU cells in the miR-22-3p mimic transfection group increased significantly (P<0.05), promoting cell proliferation.

[0142] In contrast, the number of EdU-positive cells in the miR-22-3p inhibitor transfection group was significantly reduced (P<0.01). This indicates that ssc-miR-22-3p overexpression can promote LPS- and Poly(I:C)-induced IPEC-J2 cell proliferation and cell viability.

[0143] 7. ssc-miR-22-3p target gene and function enrichment analysis

[0144] To further study the function of ssc-miR-22-3p, we predicted target genes, constructed a target gene interaction network, and performed functional enrichment analysis to screen out genes related to immune response (FAS, MAPK14, WNT5A, CXCL12, CBL, AKT3) ( Figure 8 A). Significantly enriched GO terms include canonical Wnt signaling pathway, intracellular signal transduction, negative regulation of inflammatory response ( Figure 8 B). KEGG enrichment analysis found that the pathways of Pathways in cancer, Breast cancer, cAMP signaling pathway, and Bacterial invasion of epithelial cells were significantly enriched ( Figure 8 C).

[0145] In order to verify the reliability of the target gene prediction results, this study performed RT-qPCR verification on the mRNA expression of 6 key target genes ( Figure 8 D). The results showed that after IPEC-J2 cells were treated with LPS (10 μg / mL) and Poly (I:C) (20 μg / mL) for 24 h and transfected with ssc-miR-22-3p mimic, the expression levels of target genes MAPK14, WNT5A, and CXCL12 were significantly downregulated compared with the control group (P<0.05), and the specific expression levels were: 0.55±0.02, 0.78±0.08, and 0.54±0.06.

[0146] FAS, CBL and AKT3 showed a downward expression trend, but the difference was not significant (P>0.05). The specific expression levels were: 0.96±0.15, 0.91±0.07, and 0.86±0.12.

[0147] Based on this, we speculated that ssc-miR-22-3p may target and regulate MAPK14, WNT5A and CXCL12 genes, thereby regulating LPS- and Poly(I:C)-induced IPEC-J2 inflammatory damage.

[0148] 8. Verification of the targeting relationship between ssc-miR-22-3p and MAPK14

[0149] To further verify the accuracy of the targeting relationship between ssc-miR-22-3p and negatively regulated target genes, MAPK14 was randomly selected for dual luciferase experiments. The targeting relationship between ssc-miR-22-3p and MAPK14 was predicted using TargetScan and miRanda.

[0150] The specific steps are as follows:

[0151] (1) HEK 293T cells were co-transfected with the recombinant plasmids (pmirGLO-MAPK14-WT and pmirGLO-MAPK14-MUT) prepared in Example 2 and miRNA mimics / inhibitors for 48 h.

[0152] (2) The dual luciferase reporter system was used to verify whether ssc-miR-22-3p binds to the 3′-UTR of MAPK14.

[0153] The results show:

[0154] The luciferase activity of the pmirGLO-MAPK14-WT and miR-22-3p mimic co-transfection group (specifically: 4.53±0.27) was significantly lower than that of the pmirGLO-MAPK14-WT and mimic NC co-transfection group (specifically: 7.75±0.05) (P<0.01), while when co-transfected with pmirGLO-MAPK14-Mut, the luciferase activity of the mimic NC group (specifically: 7.95±0.13) and the miR-22-3p mimic group (specifically: 8.24±0.14) had no significant difference (P>0.05) ( Fig. 9 C).

[0155] The results of the dual luciferase reporter system showed that the ssc-miR-22-3p mimic participated in the regulation of MAPK14 expression by binding to the predetermined binding site in the 3′UTR. MAPK14 binds to the porcine exosome ssc-miR-22-3p at 1420-1436bp in the 3'UTR sequence ( Figure 1 ).

[0156] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. Application of porcine exosome ssc-miR-22-3p in the preparation of inhibitor drugs targeting MAPK14 gene, characterized in that: The porcine exosome ssc-miR-22-3p promotes cell proliferation and cell viability by targeting the MAPK14 gene, thereby alleviating LPS and / or Poly (I:C)-induced cellular inflammatory response.

2. The use according to claim 1, characterized in that: The sequence of the porcine exosome ssc-miR-22-3p is shown in SEQID NO.1; preferably, the inflammatory factors of the inflammatory response include but are not limited to IL-6, IL-8, TNF-α, IL-1β; the relief of inflammatory response also includes reduced lactate dehydrogenase (LDH) activity, increased IPEC-J2 cell proliferation and cell viability; the MAPK14 gene binds to the porcine exosome ssc-miR-22-3p at 1420-1436bp of the 3'UTR sequence.

3. A method for screening a drug for alleviating LPS and / or Poly (I: C)-induced cellular inflammatory response, characterized in that: The method is: In the test group, the test compound and porcine exosome ssc-miR-22-3p were added to the culture system, and the expression amount and / or activity of the MAPK14 gene in the test group was observed; in the control group, the test compound was not added to the same culture system, and the expression amount and / or activity of the MAPK14 gene in the control group was observed; If the expression level and / or activity of the MAPK14 gene in the test group is lower than that in the control group, it indicates that the test compound is an inhibitor drug targeting the MAPK14 gene.

4. The method according to claim 3, characterized in that The sequence of the porcine exosome ssc-miR-22-3p is shown in SEQID NO.1; preferably, the inflammatory factors of the inflammatory response include but are not limited to IL-6, IL-8, TNF-α, IL-1β; the relief of inflammatory response also includes reduced lactate dehydrogenase (LDH) activity, increased IPEC-J2 cell proliferation and cell viability; the MAPK14 binds to the porcine exosome ssc-miR-22-3p at 1420-1436bp of the 3'UTR sequence.

5. An application of porcine exosome ssc-miR-22-3p in studying the functions of genes related to the alleviation of LPS and / or Poly (I: C)-induced cellular inflammatory response, or analyzing the application of porcine exosome ssc-miR-22-3p gene in inhibiting the expression of MAPK14 gene, or analyzing the application of gene therapy in relieving LPS and / or Poly (I: C)-induced cellular inflammatory response, characterized in that: The porcine exosome ssc-miR-22-3p alleviates LPS and / or Poly (I:C)-induced cellular inflammatory response by targeting the MAPK14 gene.

6. The use according to claim 5, characterized in that: The sequence of the porcine exosome ssc-mi R-22-3p is shown in SEQ ID NO.1; preferably, the inflammatory factors of the inflammatory response include but are not limited to IL-6, IL-8, TNF-α, IL-1β; the relief of inflammatory response also includes reduced lactate dehydrogenase (LDH) activity, increased IPEC-J2 cell proliferation and cell viability; the MAPK14 gene binds to the porcine exosome ssc-miR-22-3p at 1420-1436bp of the 3'UTR sequence.

7. A method for studying the molecular mechanism of porcine exosome ssc-miR-22-3p alleviating LPS and / or Poly (I:C)-induced cellular inflammatory response by targeting MAPK14 gene, characterized in that: The method is as follows: porcine exosome ssc-miR-22-3p is used as a sponge to competitively bind to the MAPK14 gene, and porcine exosome ssc-miR-22-3p drugs are prepared to alleviate intestinal inflammatory damage.

8. A cell model method for screening drugs, wherein the drugs are used to alleviate LPS and / or Poly (I: C)-induced cellular inflammatory responses, characterized in that: The method for constructing the cell model comprises: The method is: In the test group, the test compound, porcine exosome ssc-miR-22-3p and IPEC-J2 cells were added to the culture system and incubated together, and the expression amount and / or activity of the MAPK14 gene in the test group was observed; in the control group, the test compound was not added to the same culture system, and the expression amount and / or activity of the MAPK14 gene in the control group was observed; If the expression level and / or activity of the MAPK14 gene in the test group is lower than that in the control group, it indicates that the test compound is an inhibitor drug targeting the MAPK14 gene.

9. The method according to claim 8, characterized in that The sequence of the porcine exosome ssc-miR-22-3p is shown in SEQ ID NO.

1.

10. The method according to claim 8 or 9, characterized in that: The inflammatory factors of the inflammatory response include but are not limited to IL-6, IL-8, TNF-α, and IL-1β; the alleviation of the inflammatory response also includes reduced lactate dehydrogenase (LDH) activity, increased IPEC-J2 cell proliferation and cell viability; the MAPK14 gene binds to porcine exosome ssc-miR-22-3p at 1420-1436bp of the 3'UTR sequence.

Images