Fusion polynucleotide, kit and method for detecting LSD1 protein binding site

Abstract

The invention relates to a fusion polynucleotide, a kit and a method for detecting an LSD1 protein binding site, the fusion polynucleotide comprises an LSD1 protein coding nucleotide and a Turbo ID protein coding nucleotide located at the downstream of the LSD1 protein coding nucleotide, and the LSD1 protein coding nucleotide and the Turbo ID protein coding nucleotide are connected through a connecting sequence; the nucleotide sequence of the connecting sequence is as shown in SEQ ID NO: 1; the method comprises the following steps: introducing the fusion polynucleotide into an LSD1 gene knockout cell line to obtain a recombinant expression cell line; and culturing the recombinant expression cell line, constructing a library, and sequencing. The detection method disclosed by the invention is relatively good in repeatability and high in accuracy, can cover more complete epigenome data, can effectively reveal regulation sites and downstream target genes of the LSD1, and promotes related research of epigenetics.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and relates to the field of epigenetic regulation technology, and specifically, to a fusion polynucleotide, a kit and a method for detecting LSD1 protein binding sites. Background Art

[0002] Epigenetics refers to the study of heritable information in organisms other than DNA sequences. Since the discovery of DNA sequences as genetic codes in biology, people have found that changes in non-nucleic acid sequences such as DNA methylation and histone modifications can also be preserved and passed on to future generations.

[0003] In the nucleus of eukaryotic cells, DNA is wrapped in chromatin. The nucleosome composed of histone octamers is the basic structure of chromatin. The nucleosome contains a central H3-H4 tetramer and two lateral H2A-H2B dimers, surrounded by 146 DNA base pairs (JENUWEIN T, ALLIS CD. Translating the histone code [J]. Science (New York, NY), 2001, 293 (5532): 1074-80). The four nucleosomal histones (H2A, H2B, H3, H4) are widely used in life activities related to chromosomes in the cell nucleus. They can have a variety of chemical modifications, including histone methylation, acetylation, phosphorylation and ubiquitination. Histone methylation activates or inhibits gene expression by monomethylating, dimethylating and trimethylating lysine residues. It mainly occurs on the arginine (R) and lysine (K) residues of histones H3 and H4, and is one of the most important epigenetic modifications. The histone methylation system is dynamically regulated by histone methyltransferases (Writers) that add marks and histone demethylases (Erasers) that remove marks, and effector proteins (Readers) that bind to histone modifications convert these dynamic regulatory signals into functional results (JENUWEIN T, ALLIS CD. Translating the histone code [J]. Science (New York, NY), 2001, 293 (5532): 1074-80). A large number of studies have shown that the variation or disorder of histone methylation, methyltransferases, demethylases and methyl-lysine binding proteins are closely related to a variety of diseases (GREER EL, SHIY. Histone methylation: a dynamic mark in health, disease and inheritance [J]. Nature reviews Genetics, 2012, 13 (5): 343-57.). Therefore, many histone methylation-related proteins are being regarded as potential therapeutic targets and have been widely studied.

[0004] Histone demethylases are a class of enzymes that have the ability to remove histone methylation modifications, including lysine-specific demethylase 1 (LSD1) and JmjC family demethylases. Studies have shown that in vitro, LSD1 is highly specific for monomethylated and dimethylated H3K4 and can specifically remove methylation modifications, while in vivo it can remove monomethylated and dimethylated modifications of H3K9 (SHIY, LAN F, MATSON C, et al. Histone demethylationmediated by the nuclear amine oxidase homolog LSD1 [J]. Cell, 2004, 119 (7): 941-53).

[0005] Since LSD1 binds to chromatin dynamically and has a weak ability to bind to the genome, there may be large differences between different time points, resulting in the ChIP-seq technology being able to analyze only some binding sites, with incomplete coverage and poor repeatability. Summary of the invention

[0006] Based on this, the purpose of the present invention is to provide a fusion polynucleotide, a kit and a method for detecting LSD1 protein binding sites (binding sites of LSD1 protein and DNA). The detection method of the present invention can obtain LSD1 protein binding site data with good repeatability, high accuracy and more comprehensive coverage.

[0007] The first aspect of the present invention is to provide a fusion polynucleotide for detecting LSD1 protein binding sites, wherein the fusion polynucleotide comprises an LSD1 protein encoding nucleotide and a TurboID protein encoding nucleotide located downstream thereof, and the two are connected by a connecting sequence; the nucleotide sequence of the connecting sequence is shown in SEQ ID NO: 1.

[0008] In some embodiments, the LSD1 protein encoding nucleotide sequence is shown as SEQ ID NO: 2.

[0009] In some embodiments, the TurboID protein encoding nucleotide sequence is shown as SEQ ID NO:3.

[0010] The second aspect of the present invention is to provide a recombinant expression vector, which contains the fusion polynucleotide as described above.

[0011] In some embodiments, the backbone of the recombinant expression vector is a lentiviral vector.

[0012] The third aspect of the present invention is to provide a kit for detecting LSD1 protein binding sites, wherein the kit comprises the fusion polynucleotide as described above or the recombinant expression vector as described above.

[0013] In some embodiments, the kit further comprises an sgRNA for silencing the LSD1 gene; preferably, the nucleotide sequence of the sgRNA is as shown in SEQ ID NO: 5.

[0014] In some embodiments, the kit further comprises biotin and / or biotin antibody.

[0015] The fourth aspect of the present invention is to provide a method for detecting LSD1 protein binding sites, using the kit as described above for detection, comprising the following steps: (1) constructing a cell line with LSD1 gene knockout; (2) introducing the fusion polynucleotide or recombinant expression vector into the cell line to obtain a recombinant expression cell line; (3) culturing the recombinant expression cell line, constructing a library, and sequencing.

[0016] In some of the embodiments, the construction of the library includes using biotin antibodies and adopting CUT&Tag technology.

[0017] In some of the embodiments, CRISPR-Cas9 technology is used to construct LSD1 gene knockout cell lines.

[0018] In some embodiments, the recombinant expression cell line is cultured and treated with biotin.

[0019] In some embodiments, the final concentration of the biotin in the recombinant expression cell line culture system is 250 μM to 500 μM.

[0020] In some embodiments, the biotin treatment time is 10 h to 15 h.

[0021] The present invention establishes a method and a kit for detecting LSD1 protein binding sites, creatively utilizes CRISPR-Cas9 technology to knock out the LSD1 gene in the cell line, inserts the TurboID coding gene behind the LSD1 gene, treats TurboID positive cells with biotin during cell culture, and uses Biotin antibodies to carry out CUT&Tag experiments targeting Biotin, so as to obtain epigenomic data with better repeatability and more comprehensive coverage. In addition, in the method, a fusion polynucleotide suitable for detection is constructed, the fusion polynucleotide comprises LSD1 protein coding nucleotides and TurboID protein coding nucleotides, the two are connected by a connection sequence composed of suitable nucleotides, and the fusion polynucleotide can be translated to form an LSD1-TurboID fusion protein. The connection sequence is optimized for the coding nucleotide sequences of the LSD1 protein and the TurboID protein, which can improve the efficiency and accuracy of the transcription of the fusion polynucleotide, ensure that the LSD1-TurboID fusion protein can be expressed efficiently and accurately, avoid the subsequent detection of the LSD1 protein binding site due to low translation efficiency or translation deviation, and thus improve the comprehensiveness and accuracy of the detection results.

[0022] The method for detecting LSD1 protein binding sites of the present invention has good repeatability and high accuracy, can cover more complete epigenomic data, can effectively reveal the regulatory sites and downstream target genes of LSD1, and promote related research on epigenetics. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is a schematic diagram of the detection principle of the present invention.

[0024] Figure 2 Schematic diagram of the VB241031-LSD1-Linker-TurboID plasmid structure.

[0025] Figure 3 Western Blot analysis of LSD1 knockout and LSD1-TurboID endogenous knock-in mESC cell lines.

[0026] Figure 4 Diagram of the experimental steps for detecting LSD1 binding sites in mouse embryonic stem cells.

[0027] Figure 5 This is the distribution diagram of all Peaks measured in the three experimental groups.

[0028] Figure 6 GO analysis of Peaks in the three experimental groups.

[0029] Figure 7 This is the Peaks comparison result between different detection methods. DETAILED DESCRIPTION

[0030] In order to facilitate the understanding of the present invention, the present invention will be described more fully below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0031] The experimental methods in the following examples without specifying specific conditions are usually carried out according to conventional conditions, such as the fourth edition of Molecular Cloning: A Laboratory Manual edited by Green and Sambrook, published in 2013, or according to the conditions recommended by the manufacturer. The various commonly used chemical reagents used in the examples are all commercially available products.

[0032] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art to which the present invention belongs. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used in the present invention includes any and all combinations of one or more of the related listed items.

[0033] In addition, as used in the present invention, the term "or" is an inclusive "or" symbol and is equivalent to the term "and / or", unless the context clearly dictates otherwise. The term "based on" is not exclusive and allows for being based on other factors not described, unless the context clearly dictates otherwise. In addition, throughout the specification, the meanings of "a", "an", and "the" include plural referents. The meaning of "in..." includes "in..." and "on...".

[0034] Definitions To facilitate understanding of this technology, certain terms and phrases are defined below.

[0035] Lysine-specific demethylase 1 (LSD1)

[0036] LSD1 is a nuclear amine oxidase homolog containing 852 amino acids. The crystal structure shows that it is mainly composed of three regions: the N-terminal variable domain, the Swi3p / Rsc8p / Moira (SWIRM) domain and the C-terminal amine oxidase (AOL) domain (CHENY, YANGY, WANG F, et al. Crystal structure of human histonelysine-specific demethylase 1 (LSD 1) [J]. Proceedings of the National Academy of Sciences of the United States of America, 2006, 103 (38): 13956-61). The oxidation reaction catalyzed by LSD1 depends on the cofactor flavin adenine dinucleotide (FAD). In the demethylation reaction, the methylated lysine group is oxidized to an imine intermediate by FAD and then hydrolyzed to formaldehyde. Thereafter, the reduced FADH2 is reoxidized by a catalase (FORNERIS F, BINDA C, VANONI MA, et al. Human histone demethylase LSD1 reads the histone code [J]. The Journal of biological chemistry, 2005, 280(50): 41360-5).

[0037] CUT&Tag

[0038] CUT&Tag is a new method for studying protein-DNA interactions. This technology uses a transposase fused with ProteinA / G, which can accurately target the target protein and fragment DNA around the target site under the guidance of antibodies.

[0039] Proximity Mark

[0040] Proximity labeling (PL) is a new technology that provides a new method for studying the interaction between proteins and nucleic acids. By using a tool enzyme with proximity labeling function to carry out gene fusion with the target protein, the molecules that interact with the target protein are labeled in living cells. These labeled molecules can be enriched and identified by mass spectrometry or nucleic acid sequencing. Combined with mass spectrometry-based proteomics technology and high-throughput sequencing technology, large-scale analysis of proximal biomolecules can be achieved (ROUX KJ, KIM DI, RAIDA M, et al. A promiscuous biotinligase fusion protein identifies proximal and interacting proteins inmammalian cells [J]. The Journal of cell biology, 2012, 196 (6): 801-10). BioID in the proximity labeling technique utilizes the mutation of the biotin ligase BirA in Escherichia coli (CRONAN J E. Targeted and proximity-dependent promiscuous protein biotinylation by a mutant Escherichia coli biotin protein ligase [J]. The Journal of nutritional biochemistry, 2005, 16 (7): 416-8). The biotin ligase BirA is a conserved enzyme that can attach biotin to the target protein (CHAKRAVARTTY V, CRONAN J E. Altered regulation of Escherichia coli biotin biosynthesis in BirA superrepressor mutant strains [J]. Journal of bacteriology, 2012, 194 (5): 1113-26).The active site of BirA was mutated to enable it to randomly biotinylate neighboring proteins in the absence of a biotin acceptor peptide (CHOI-RHEE E, SCHULMAN H, CRONAN JE. Promiscuous protein biotinylation by Escherichia coli biotin protein ligase [J]. Protein science: a publication of the Protein Society, 2004, 13 (11): 3043-50). This method is called BioID, and the BirA mutant used for proximity labeling is called BioID or BirA* (ROUX KJ, KIM DI, RAIDA M, et al. A promiscuous biotin ligase fusion protein identifies proximal and interacting proteins in mammalian cells [J]. The Journal of cell biology, 2012, 196 (6): 801-10.).

[0041] TurboID Enzyme

[0042] TurboID enzyme is a new enzyme with improved activity after BioID enzyme was modified. BioID was directed to evolve through yeast surface display technology. TurboID has the same size as the original BioID tag, but 14 mutations were introduced into its reactive biotin-5'AMP binding domain, which makes it have stronger biotinylation activity and greatly increases the protein labeling efficiency. In human HEK293T cells, TurboID can label a considerable number and type of proteins within 10 minutes, while it takes 18 hours to complete the labeling of the same number of proteins using BioID (BRANON TC, BOSCH JA, SANCHEZ AD, et al. Efficient proximity labeling in living cells and organisms with TurboID [J]. Nature biotechnology, 2018, 36 (9): 880-7).

[0043] Lentivirus

[0044] The lentivirus used in the present invention is prepared by conventional techniques known to those skilled in the art, see for example Morita S et al., Plat-E: an efficient and stable system for transient packaging of retroviruses. Gene Ther. 2000; 7(12): 1063-1066.

[0045] The "conditions suitable for cell growth" described in the present invention are conventional cell culture conditions in the art, and include some modifications suitable for each specific cell line but do not affect the basic properties of the cells. For culture methods and culture conditions, please refer to W. French Anderson et al., HANDBOOK OF STEM CELLS, Volume 2.

[0046] The CUT&Tag method described in the present invention is well known to those skilled in the art, see, for example, Ieda et al., Direct reprogramming of fibroblasts into functional cardiomyocytes by defined factors. Cell. 2010; 142(3): 375-386).

[0047] Unless otherwise specified, all reagents mentioned in this article are from Invitrogen, Sigma or Merck Chemical Technology (Shanghai) Co., Ltd. (Merck).

[0048] The present invention is further described in detail below with reference to specific embodiments.

[0049] The principle of the method for detecting LSD1 binding sites of the present invention is as follows Figure 1 shown.

[0050] Example 1

[0051] Five sets of ChIP-seq data (DRX013339, GSM4224364, GSE27841, GSE99022, GSE93952) that have been published were collected in the database. The common feature of these data is that the cell types are all mouse embryonic stem cells and the same antibodies (ab17721, Abcam) were used. These data were quality controlled, annotated, compared and analyzed according to the same standards (Table 1). The results showed that there were obvious deviations between the five sets of data. A total of 21,893 LSD1 regulatory site genes were identified, of which 20,529 genes were identified in two or more sets of data, accounting for about 93% of the total number of genes. However, among all five sets of data, only 2,488 genes were identified in common, accounting for less than 12% of the total number of genes, indicating that the identified LSD1-regulated genes have poor repeatability.

[0052] Further analysis found that the common peaks of the five groups of data accounted for a relatively low proportion of the peaks identified in each group of data, which were 18.70%, 24.39%, 6.27%, 6.50% and 21.92% respectively. This indicates that after using LSD1 antibody for ChIP-seq, the distribution of capture sites in each group of data varies greatly, and the reproducibility between data is poor. The reasons for this may be: 1) Different laboratories have different library construction and sequencing methods; 2) LSD1 is an epigenetic factor, and its binding to chromatin is dynamic, resulting in large differences between different time points. ChIP-seq of different groups can only analyze some binding sites and target genes; 3) LSD1 has a weak ability to bind to the genome, and ChIP-seq cannot identify the loosely bound parts.

[0053] Table 1 shows the analysis of 5 groups of ChIP-seq data using the same LSD1 antibody and cell type. According to the 5 published papers, the original data were downloaded from NCBI, and the ChIP-seq enriched regions were obtained by quality control, alignment, and enrichment analysis according to the same standards. The chipseeker package was used to analyze the distribution ratio of common peaks.

[0054] Table 1

[0055]

[0056] This embodiment provides a method for detecting LSD1 binding sites in mouse embryonic stem cells, comprising the following steps:

[0057] Take out the cryopreserved tube of R1 mESC cells (R1 mouse embryonic stem cells) from liquid nitrogen, thaw quickly in a 37℃ water bath with shaking, and wipe off the water droplets with absorbent paper after thawing. Disinfect the outer wall of the cryopreserved tube with 75% alcohol and put it into the biosafety cabinet. Pipette the cell suspension in the biosafety cabinet and add it to a 15ml centrifuge tube. Add 6ml of N2B27+2i+LIF culture medium formula dropwise, shake while adding, centrifuge at 200g for 5min. Discard the supernatant, add N2B27+2i+LIF culture medium formula to resuspend, and transfer the cells to a culture dish. After shaking and spreading evenly, culture at 37℃ and 5% CO2. When the cells fill 80% of the 10cm culture dish, subculture. The formula of N2B27+2i+LIF culture medium is: DMEM / F12 23mL, Neurobasal Medium 23mL, NEAA 1%, GlutaMAX 1%, N2 0.5%, B27 1%, β-Mercaptoethanol 0.1mM, PD03259011μM, CHIR99021 3μM, mLIF 1000U / mL.

[0058] 1. Recombinant expression vector containing fusion polynucleotide (LSD1 protein encoding nucleotide-linker sequence-TurboID protein encoding nucleotide) (VB241031-LSD1-Linker-TurboID plasmid)

[0059] In this embodiment, the fusion polynucleotide (LSD1 protein encoding nucleotide-linker sequence-TurboID protein encoding nucleotide) is composed of LSD1 protein encoding nucleotide, linker sequence, and TurboID protein encoding nucleotide in order from 5'→3', and the linker sequence connects the upstream LSD1 protein encoding nucleotide and the downstream TurboID protein encoding nucleotide. The LSD1 protein encoding nucleotide sequence is shown in SEQ ID NO: 2, and the TurboID protein encoding nucleotide sequence is shown in SEQ ID NO: 3:

[0060]

[0061]

[0062]

[0063]

[0064] The composition of the linker sequence in the fusion polynucleotide will affect the translation efficiency and accuracy of the fusion polynucleotide, because different nucleotide sequences may form different mRNA secondary structures, which may affect the efficiency of translation, the assembly of the initiation complex, and the degradation rate of mRNA. This example studies the detection effect of fusion polynucleotides containing different linker sequences on LSD1 binding sites, and screens out a nucleotide sequence with better detection effect from a variety of linker sequences, such as the linker sequence of the present invention shown in SEQ ID NO: 1 (Linker sequence 1, Linker 1).

[0065] Taking linker sequence 1 and linker sequence 2 (Linker 2) as an example, the nucleotide sequence of Linker 2 is shown in SEQ ID NO: 4:

[0066]

[0067] The fusion polynucleotide containing Linker1 is LSD1-Linker1-TurboID; the fusion polynucleotide containing Linker2 is LSD1-Linker2-TurboID. The LSD1-Linker1-TurboID and LSD1-Linker2-Turbo ID sequences were synthesized by Genewise.

[0068] Use pLV-EGFP plasmid (purchased from addgene https: / / www.addgene.org / 36083, structure as Figure 2 As shown in the figure, XbaI and SalI endonucleases were selected to cut the plasmid. The LSD1-Linker1-TurboID and LSD1-Linker2-TurboID were connected to the restriction vectors by Novazon recombinase at 37°C for 1 hour, and then the competent cells were transformed and plated, and single clones were picked out. After the cells were expanded by shaking, the plasmids were extracted and identified to obtain VB241031-LSD1-Linker1-TurboID plasmids and VB241031-LSD 1-Linker2-TurboID plasmids.

[0069] 2. LSD1-sgRNA plasmid construction

[0070] The Gene ID of LSD1 (Gene ID 99982) was found in the NCBI database, the location where gene editing was required was determined, and then sgRNA was designed to obtain the following sgRNAs: sgRNA1 (nucleotide sequence as shown in SEQ ID NO: 5: GATGTTGTCTGGGAAGAAGG), sgRNA2 (nucleotide sequence as shown in SEQ ID NO: 6: GGAATAGCCGAGACCCCGGA), sgRNA3 (nucleotide sequence as shown in SEQ ID NO: 7: GTTGTCTGGGAAGAAGGCGG). All sgRNAs were synthesized by GENEWIZ. The lentiCRISPR v2 plasmid containing the cas9 protein sequence was cut with BsmbI endonuclease, and the sgRNA was annealed and connected to the restriction vector through SolutionI at 16°C for 3 hours, and then the competent cells were transformed and plated, and single clones were picked out, and the plasmid was extracted after the bacteria were expanded.

[0071] 3. Construction of LSD1 gene knockout R1mESC cell line

[0072] (1) Resuscitation of 293T cells, culture the cells to a better state under conditions suitable for cell growth, prepare two EP tubes, add 250 μL Opti-MEM culture medium and 27 μL PEI to one EP tube, add 250 μL Opti-MEM culture medium and target plasmids (LSD1-sgRNA1, LSD 1-sgRNA2, LSD1-sgRNA3,), psPAX2 plasmid, pMD2.G plasmid to the other EP tube, and gently blow and mix the liquids in the two EP tubes with a pipette, and let stand for 5 minutes. After 5 minutes, the liquid in one EP tube was moved into the other EP tube, that is, the two EP tubes were mixed, and then let stand for 15 minutes. Replace 3 mL of fresh culture medium with 293T cells, and then slowly drip the mixture that has been left to stand into the culture dish. After 12 hours, change the medium for the cells. The type of culture medium to be replaced at this time needs to be determined according to the type of target cell infected. In this embodiment, the target cell is R1 mESC cell.

[0073] (2) After 36 hours, collect the virus once, use a sterile syringe to aspirate all the culture medium along the wall of the culture dish, remove the sterile syringe needle, install a 0.45μμm filter membrane, and filter the virus-containing culture medium. Add the collected virus liquid to the Amicon Ultra-15 centrifugal filter, weigh the filter tube, record its weight, and centrifuge at 4000×g for 30 minutes. Aspirate the concentrate, replace the medium with the mESC cells to be infected, and then completely add the virus concentrate to the culture dish. Replace the medium with fresh culture medium 6 to 8 hours after infection.

[0074] (3) After 24 hours, collect the secondary virus using the same procedure as above.

[0075] (4) 24 hours after the first addition of the virus solution, a second infection was performed using the same steps as above.

[0076] (5) The infected cells were first screened with puromycin, and then the surviving cells were digested and diluted to 1 / 200 μL. Then, the cell dilution was added to a 96-well plate at a volume of 200 μL per well, and the 96-well plate was placed in a 37°C incubator and cultured for 7 days under conditions suitable for cell growth. After 7 days, the wells with only a single cell clone were found and the single clone was expanded and cultured. The cells were collected to extract genomic DNA, and upstream and downstream primers were designed around ±500 bp near the LSD1 site. PCR amplification was performed using genomic DNA as a template, and the PCR products were identified by agarose gel electrophoresis. After the band results obtained by electrophoresis were correct, they were sent to the company for sequencing to confirm that the gene knockout of the cell line was successful. Subsequently, the protein expression of the target gene LSD1 was further identified by Western Blot experiments to confirm that it was also knocked out at the protein level. The protein expression of LSD1 could not be detected, and the mESC cell line with LSD1 gene knockout was obtained.

[0077] After testing, sgRNA 1 has the highest target efficiency when used to knock out the LSD1 gene, which can reach 67%, while the target efficiency of sgRNA2 and sgRNA3 is much lower than that of sgRNA 1. This shows that sgRNA 1 has a better affinity with the LSD1 gene and a higher hybridization efficiency, thereby effectively improving the success rate of constructing LSD1 gene knockout cells. Therefore, sgRNA1 is more suitable for constructing LSD1 gene knockout cell lines.

[0078] 4. Introduce VB241031-LSD1-Linker-TurboID plasmid into LSD1 knockout mESC cell line and express

[0079] The VB241031-LSD 1-Linker1-TurboID and VB241031-LSD 1-Linker2-TurboID plasmids were respectively introduced into the cell line in which the LSD1 gene was knocked out using sgRNA1, and the method was as described in steps (1)-(5) in 3. above, to obtain the LSD1 gene knocked out mESC cell line in which the LSD1-TurboID fusion protein was endogenously knocked in. Figure 3 As shown, the expression of LSD1 protein was not detected in the mESC cell line with LSD1 gene knockout, indicating successful knockout. Figure 3Among them, LSD1-TurboID-1, LSD1-TurboID-2 and LSD1-TurboID-3 are mESC cell lines into which VB241031-LSD1-Linker1-TurboID plasmids are introduced, and LSD 1-TurboID-4 and LSD 1-TurboID-5 are mESC cell lines into which VB241031-LSD 1-Linker2-TurboID plasmids are introduced. According to the test results, LSD1-TurboID fusion protein (because LSD1-TurboID is a fusion protein, the molecular weight will be slightly larger than LSD1, so the LSD1 protein band of LSD1-TurboID cells is slightly higher than the wild-type LSD1 protein band in the Western Blot results) was selected for subsequent experiments.

[0080] 5. Cultivate the mESC cell line obtained in 4. During the cell culture process, add biotin label to the culture medium; the final concentration of the biotin in the culture medium is: 0 μM, 250 μM, 500 μM; the treatment time is 12 hours.

[0081] 6. Digest and collect cell samples, and build CUT&Tag library according to Vazyme kit Hyperactive Universal CUT&TagAssay Kit for Illumina (TD903-02). The library construction operation method is strictly in accordance with the instructions. Among them, the primary antibody uses biotin antibody (ab1227). After library construction, it is sent to Genewise for sequencing.

[0082] The sequencing method is double-end 150bp, and the sequencing volume of each sample is 8G. At the same time, H3K4ME2 antibody is used to construct CUT&Tag library for mESC and send it for testing ( Figure 4 ).

[0083] After the experimental data was filtered by quality control, MACS2 was used to perform genome-wide peak calling. The statistical results of CUT&Tag sequencing showed that the peak numbers of the VB241031-LSD1-Linker1-TurboID plasmid group containing linker sequence 1 were 31674, 30870 and 39671 at 0μM, 250μM and 500μM biotin concentrations, respectively. There was no significant difference in the number of peaks at 0μM and 250μM biotin concentrations, because there was background expression of biotin in the cells, so detection could be achieved at 0μM. However, further analysis found that under the condition of Log10(p)>=10, the number of peaks in the groups treated with 250μM and 500μM biotin was significantly higher than that of 0μM, indicating that adding a certain concentration of biotin treatment can improve the reliability of the detection results. The peak numbers of the VB241031-LSD1-Linker2-TurboID plasmid group with linker sequence 2 at 0μM, 250μM and 500μM biotin concentrations were 21377, 27616 and 33235, respectively. In contrast, the peak number of the VB241031-LSD1-Linker2-TurboID plasmid group with linker sequence 2 at the same concentration was significantly lower than that of the VB241031-LSD1-Linker1-TurboID plasmid group with linker sequence 1. This may be due to the negative impact of linker sequence 2 on the expression efficiency or accuracy of the VB241031-LSD1-Linker2-TurboID plasmid, resulting in the failure of the LSD1 protein to effectively bind to the corresponding DNA site, thereby significantly reducing the number of peaks in the sequencing results. This indicates that the composition of the connecting sequence used to connect the LSD1 protein encoding nucleotide and the TurboID protein encoding nucleotide in the fusion polynucleotide has a significant effect on the detection of the LSD1 protein binding site. Using the connecting sequence 1 to connect the LSD1 protein encoding nucleotide and the TurboID protein encoding nucleotide can enable the LSD1-TurboID fusion protein to be expressed efficiently, stably and accurately, thereby improving the accuracy of subsequent LSD1 binding site detection results.

[0084] Next, other aspects of the sequencing results of the VB241031-LSD1-Linker1-TurboID overexpressing cell line containing linker sequence 1 were analyzed.

[0085] The distribution positions of all Peaks of 0μM, 250μM, and 500μM samples were plotted to observe the distribution of protein binding sites. The results among the three groups of samples were similar, and they all mainly bound to the promoter region of the gene ( Figure 5). By observing the distance distribution between the protein binding site and TSS, it was found that the distance distribution between the three groups of samples and the TSS of the nearest gene was similar. GO analysis showed that some biological processes enriched, such as axon formation and histone modification, had no significant differences in the three groups of data ( Figure 6 ). Comparing the data of the three groups of samples treated with different concentrations of Biotin, the number of Peaks in the 500μM group increased by about 26.59%, but the distribution ratio of each sample at each position did not change significantly, indicating that the binding sites of the three groups of samples had good repeatability and high binding accuracy. However, the 500μμM biotin group can obtain more Peaks, indicating that the added biotin concentration will affect the number of Peaks, and the preferred biotin concentration is 250μM to 500μM.

[0086] The differentially expressed genes among the three samples of LSD1-TurboID data with 0μM Biotin added, the reported LSD1 ChIP-seq data (GSM4224364), and the CUT&Tag data of H3K4me2 in mESC were compared. It can be seen that most of the GSM4224364 data can be included in the Peaks of LSD1-TurboID, and on this basis, LSD1-TurboID can also discover new Peaks related to H3K4me2 ( Figure 7 (A).

[0087] The CUT&Tag data of the two experimental groups (250μM biotin group and 500μM biotin group) obtained using the Biotin antibody were analyzed with the data obtained using the H3K4me2 antibody. The Venn diagram compared the three groups of sample Peaks and found that the Peaks obtained using the Biotin antibody and the Peaks obtained using the H3K4me2 antibody partially overlapped, with an overlap rate of 52.10% ( Figure 7 (B) LSD1, as a demethylase of H3K4me2, is involved in regulating gene expression and cell function. H3K4me2 is also one of the known LSD1 binding sites. Therefore, H3K4me2 can be used as a control indicator to evaluate the accuracy and reliability of the detection method. The peaks overlap rate of the three groups of samples is 52.10%, indicating that the detection method of the present invention has a high certainty.

[0088] In summary, it is shown that the detection of LSD1 binding sites using the method of the present invention can obtain peaks data with wider coverage and better repeatability, and undiscovered peaks can be found in mESC with higher accuracy.

[0089] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A fusion polynucleotide for detecting LSD1 protein binding sites, characterized in that: The fusion polynucleotide includes LSD1 protein encoding nucleotides and TurboID protein encoding nucleotides located downstream thereof, and the two are connected via a connecting sequence; the nucleotide sequence of the connecting sequence is shown in SEQ ID NO:

1.

2. The fusion polynucleotide according to claim 1, wherein The LSD1 protein encoding nucleotide sequence is shown in SEQ ID NO:

2.

3. The fusion polynucleotide according to claim 1, characterized in that The TurboID protein encoding nucleotide sequence is shown in SEQ ID NO:

3.

4. A recombinant expression vector, characterized in that: The recombinant expression vector contains the fusion polynucleotide according to any one of claims 1 to 3.

5. The recombinant expression vector according to claim 4, characterized in that The backbone of the recombinant expression vector is a lentiviral vector.

6. A kit for detecting LSD1 protein binding sites, characterized in that: The kit comprises the fusion polynucleotide according to any one of claims 1 to 3 or the recombinant expression vector according to any one of claims 4 to 5.

7. The kit according to claim 6, characterized in that The kit also includes an sgRNA for silencing the LSD1 gene; preferably, the sgRNA nucleotide sequence is shown in SEQ ID NO:

5.

8. The kit according to claim 6, characterized in that The kit also includes biotin and / or biotin antibody.

9. A method for detecting LSD1 protein binding sites, characterized in that: The detection is performed using the kit as described in any one of claims 6 to 8, comprising the following steps: (1) constructing a cell line with LSD1 gene knockout; (2) introducing the fusion polynucleotide as described in any one of claims 1 to 3 or the recombinant expression vector as described in any one of claims 4 to 5 into the cell line to obtain a recombinant expression cell line; (3) Cultivating the recombinant expression cell line, constructing a library, and sequencing.

10. The method according to claim 9, characterized in that In step (3), the recombinant expression cell line is cultured and treated with biotin; preferably, the final concentration of the biotin in the recombinant expression cell line culture system is 250 μM to 500 μM; and / or, The biotin treatment time is 10h to 15h; and / or, The library was constructed using biotin antibody and CUT&Tag technology.

Images