Application of X201415 acting on GPR75 protein in preparation of medicine for treating non-alcoholic steatohepatitis

Abstract

The invention belongs to the technical field of medicines, and relates to application of X201415 acting on GPR75 protein in preparation of drugs for treating non-alcoholic steatohepatitis. Experiments show that the lipid-lowering effect of the GPR75 protein in liver cells is achieved through the GPR75 protein. In CDAHFD-induced NASH mice, after X201415 treatment, the liver morphology of the mice is improved, the body weight and the liver index are reduced, and the TC and TG contents of the liver are remarkably reduced; in addition, the epididymis fat volume is also significantly reduced. Liver histomorphology shows that X201415 can effectively improve lipid metabolism disorder and fibrosis degree, so that liver lobules are arranged more orderly, and fat accumulation and collagenous fibers are reduced; the expression level of lipid metabolism related genes is reduced, and synthesis of fatty acid and triglyceride is inhibited. Meanwhile, the X201415 obviously inhibits the expression of inflammatory factor genes and fibrosis related genes, and shows the potential efficacy of the medicine in the process of regulating and controlling inflammation and fibrosis. Experimental basis and thought are provided for X201415 synthesis, a new target spot and application of the new target spot in NASH.

Description

Technical Field

[0001] The present application belongs to the field of medical technology and relates to the application of X201415 acting on GPR75 protein in the preparation of drugs for treating non-alcoholic fatty liver disease. Background Art

[0002] Non-alcoholic steatohepatitis (NASH) is a liver fat accumulation disease that is not related to drinking, accompanied by necrotic inflammation and hepatocellular damage. If not intervened, it may develop into liver fibrosis, cirrhosis or liver cancer. Previous epidemiology has shown that the global incidence of non-alcoholic fatty liver disease (NAFLD) is about 25%, of which about 30% is NASH, which has become the main cause of chronic liver disease. The pathogenesis of NASH is still unclear and may be related to oxidative stress, inflammatory response, mitochondrial damage, and intestinal flora disorders. For a long time, NASH patients have lacked effective drug treatment and mainly rely on lifestyle changes. Resmetirom, a thyroid hormone receptor-β (THR-β) agonist, was approved by the FDA in March 2024 for the treatment of NASH, filling the gap in this field and opening a new chapter in treatment.

[0003] G protein-coupled receptors (GPRs) are cell surface receptors that activate guanine-nucleotide binding proteins. They are widely distributed in organisms and participate in most signal transductions, becoming about 40% of modern drug targets. GPR75 is a member of the GPRs family, activated by CCL5 / RANTES and 20-HETE, and activates downstream signaling pathways such as PI3, Akt and MAPK. Many data show that the GPR75 gene is involved in regulating obesity in mice. Recent studies have found that it is related to appetite-regulating neurons, and its deletion can prevent obesity and NAFLD progression induced by a high-fat diet in mice (DOI: 10.1002 / oby.23692). In addition, patent CN118141920A discloses a GRP75 inhibitor that can be used to prevent the occurrence and development of cachexia in esophageal squamous cell carcinoma. Therefore, GPR75 is a potential target for the treatment of metabolic diseases, neurological diseases, cancer and other diseases, and has become a hot spot for drug research and development.

[0004] X201415 is a biaryl-substituted 1,8-naphthyridine-4(1H)-one compound. Currently, compounds in the same series of this compound have been studied in the treatment of chronic obstructive pulmonary disease and asthma (DOI: 10.1016 / j.bmcl.2008.09.009). Currently, there is no report on the use of X201415 in the treatment of NASH. Summary of the invention

[0005] Purpose of the Invention

[0006] The present invention provides a new use of X201415.

[0007] Technical Solution

[0008] A biaryl-substituted 1,8-naphthyridine-4(1H)-one compound X201415 and a pharmaceutically acceptable salt or prodrug thereof in the preparation of an antagonist of GPR75 protein, characterized in that the structural formula of X201415 is as follows:

[0009]

[0010] Application of the biaryl-substituted 1,8-naphthyridine-4(1H)-one compound X201415 and its pharmaceutically acceptable salt or prodrug in preparing a drug for treating non-alcoholic fatty hepatitis acting on GPR75 protein

[0011] The application is characterized in that X201415 is prepared by the following steps: 2-chloronicotinoyl chloride X201415-a is used as a raw material, and esterification, hydrolysis, nucleophilic substitution, and coupling reaction are performed to obtain compound X201415, and the preparation route is as follows:

[0012]

[0013] The application is characterized in that the X201415 is a complex formed by X201415 and a pharmaceutically acceptable carrier or excipient.

[0014] The present application predicts that X201415 can directly bind to GPR75 protein through molecular docking technology. The applicant synthesized X201415 powder, prepared X201415 suspension containing 0.5% CMC-Na, intervened in NASH mice constructed by CDAHFD diet and evaluated the effect. At the same time, cell experiments verified that its lipid-lowering effect in hepatocytes depends on GPR75 protein.

[0015] Preferably, the above-mentioned drug can effectively reduce the body weight and liver index of mice.

[0016] Preferably, the above-mentioned drug can significantly improve the volume of liver and epididymal fat, and reduce the content of TC and TG in liver.

[0017] Preferably, the above-mentioned drug can effectively down-regulate the mRNA expression levels of TNF-α, IL-1β and IL-6, the downstream pro-inflammatory mediators of the NF-κB pathway.

[0018] Preferably, the above-mentioned drug can effectively inhibit the mRNA expression level of genes related to lipid metabolism and liver fibrosis.

[0019] Preferably, the above-mentioned drug can reduce the lipid accumulation of HepG2 cells stimulated by 200 μM PA (palmitic acid) in a dose-dependent manner.

[0020] Preferably, the above-mentioned drug reduces the TG level of HepG2 cells stimulated by PA via GPR75 protein.

[0021] Preferably, the above-mentioned medicine or health product includes compound X201415, and also includes pharmaceutically acceptable carriers, additives or excipients, and inevitable impurities.

[0022] The present application provides a GPR75 protein inhibitory drug or health product, which includes compound X201415.

[0023] In experiments, animals are often modeled with a high-fat diet, such as a choline-deficient methionine high-fat diet (CDAHFD). Amino acids are used to replace protein in a high-fat model feed. Choline deficiency can aggravate liver fat accumulation, and partial methionine supplementation can prevent weight loss. The CDAHFD diet formula simulates the pathological and physiological conditions of human NAFLD, especially the NASH mouse model, so this application uses this method to model.

[0024] Beneficial effects:

[0025] This application provides a biaryl-substituted 1,8-naphthyridine-4(1H)-one compound X201415 obtained based on virtual docking, which uses the GPR75 protein as a target in the treatment of NASH. This application proposes and verifies for the first time the new binding target of X201415 and its new indication. X201415 effectively inhibits the progression of NASH by targeting the GPR75 protein, and there is no related report on X201415.

[0026] Specifically, based on the small molecule database, we used molecular docking virtual screening to discover a compound (named X201415 in this application), whose IUPAC name is N-cyclopropyl-1-(3-(6-(2-hydroxypropan-2-yl)pyridin-3-yl)phenyl)-4-keto-1,4-dihydro-1,8-naphthyridine-3-carboxamide (CAS: 477252-30-5, chemical formula: C 26 H 24 N4O3) can form key hydrogen bonds and pi-pi interactions with GPR75 protein and has stable binding ability.

[0027] This application proposes for the first time that X201415 binds to a new target, GPR75 protein, and provides a synthetic route for X201415. X201415 can effectively improve liver inflammation, fibrosis, and lipid accumulation in CDAHFD-induced NASH mice, and has been verified in HepG2 cells that its effect of reducing lipid accumulation is achieved by inhibiting GPR75 protein, and is expected to be developed as a new anti-NASH drug. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] For ease of explanation, the present application is described in detail through the following specific implementations and drawings.

[0029] Figure 1 BODIPY staining of lipid content (A) and TG content (B) of HepG2 cells under PA stimulation and compound X201415 intervention.

[0030] Figure 2 The following are the liver morphology of mice in each group (A); the epididymal fat status of mice (B); the statistical graph of mouse body weight and liver index (C); and the statistical results of TC and TG content in the liver of mice (D).

[0031] Figure 3 H&E, Oil Red O, and MASSON staining images of the liver of mice in each group.

[0032] Figure 4 is the mRNA expression level of genes related to liver lipid metabolism in each group of mice.

[0033] Figure 5 is the mRNA expression level of liver inflammation-related genes in each group of mice.

[0034] Figure 6 is the mRNA expression level of liver fibrosis-related genes in each group of mice.

[0035] Figure 7 2D (A) and 3D (B) images of virtual docking of compound X201415 and GPR75 protein. DETAILED DESCRIPTION

[0036] In order to make the purpose, technical scheme and advantages of the embodiments of the present application clearer, the technical scheme and specific operation process of the embodiments of the present application are described in detail in conjunction with the accompanying drawings, but the content of the present application is not limited to the following examples. The reagents or equipment used without indicating the manufacturer are regarded as conventional products available on the market.

[0037] All data in this application are expressed as mean ± standard error of the mean (SEM). One-way ANOVA was used, followed by Tukey post hoc test for multiple group comparisons. Statistical analysis and bar graphs were analyzed and plotted using GraphPad Prism 10.1.1 (GraphPad, LaJolla, California) (*p<0.05, ***p<0.001). Differences with a p value <0.05 were considered statistically significant.

[0038] Example 1: Synthesis of Compound X201415

[0039] 1. Synthesis of intermediate X201415-b

[0040]

[0041] Under nitrogen protection, potassium salt of monoethyl malonate (171mmol, 3eq), magnesium chloride (171mmol, 3eq) and THF (150mL) were placed in a 500mL three-necked flask and stirred. Then, triethylamine (342mmol, 6eq) was added dropwise to the reaction solution at -10°C. After 30 minutes, the reaction solution was stirred at room temperature for 1 hour. A THF (50mL) solution of 2-chloronicotinoyl chloride (X201415-a) (57mmol, 1eq) was added dropwise to the reaction solution at -10°C. The reaction solution was placed at room temperature for 30 minutes, and then heated to 60 degrees for overnight reaction. Stop the reaction. Add 100mL of water and 100mL of ethyl acetate to the reaction solution and stir. Adjust the pH to 2 with 2NHCl. Separate the liquid, and extract the water layer with 100mL of ethyl acetate. Combine the organic layers, wash with water and saturated sodium chloride in turn, desolventize the organic layer, make sand, and column chromatography. 8 g of intermediate X201415-b) were obtained.

[0042] 2. Synthesis of intermediate X201415-c

[0043]

[0044] X201415-b (33.1mmol, 1eq), DMFDMA (99.3mmol, 3eq) and toluene (70mL) were placed in a 250mL three-necked flask and protected with nitrogen. Then reacted in an oil bath at 100℃ for 3 hours. When the raw material disappeared, the reaction was stopped and the solvent was directly removed to dryness. Then 3-iodoaniline (39.73mmol, 1.2eq), dioxane (100mL) and potassium carbonate (66.2mmol, 2eq) were added to the concentrated residue, and nitrogen was replaced three times. The reaction solution was placed at 100℃ for 4 hours. When the reaction was complete, the reaction solution was removed to dryness. 100mL of water and 100mL of dichloromethane were added to the concentrated residue, stirred and separated. The aqueous phase was extracted once with 100mL of dichloromethane. The organic phases were combined, washed with saturated sodium chloride in turn, and dried over anhydrous sodium sulfate. The organic phase was desolventized to dryness, and then 30 mL of methanol was added to the concentrated residue for slurrying, and the mixture was filtered. The filter cake was dried to obtain 7.4 g of a white solid, X201415-c.

[0045] 3. Synthesis of intermediate X201415-d

[0046]

[0047] Add X201415-c (10mmol, 1eq), MeOH (20mL) and 2NNaOH (20mL) to a 100mL single-mouth bottle and stir for 2 hours. After the reaction is complete, adjust the pH of the reaction solution to 7 with 2MHCl, and then desolventize to dryness. Add 20mL of water to the reaction solution and stir. Then adjust the pH to 3 with 2MHCl, and a large amount of solid precipitates. Filter and dry the filter cake. Then place the filter cake, HATU (15mmol, 1.5eq), DMF (20mL), and DIPEA (20mmol, 2eq) in a 100mL single-mouth bottle and stir. Add cyclopropylamine (12mmol, 1.2eq) dropwise to the reaction solution and stir for 1 hour. After the reaction is complete, add 60mL of water to the reaction solution and stir, and a large amount of solid precipitates. Filter and wash the filter cake with 100mL of water. The filter cake was then dried to obtain 3.6 g of intermediate X201415-d.

[0048] 4. Synthesis of Intermediate X201415-e

[0049]

[0050] X201415-d (5.8mmol, 1eq), B2Pin2 (8.7mmol, 1.5eq), Pd(dppf)Cl2 (0.58mmol, 0.1eq), KOAc (11.6mmol, 2eq) and DMF (40mL) were placed in a 100mL single-mouth bottle under nitrogen protection. The reaction solution was placed in a 100°C oil bath and stirred for 5 hours. When the reaction was complete, the reaction solution was filtered through diatomaceous earth and the filter cake was washed with 5mL DMF. The filtrate obtained was X201415-e, which was directly used for the next step without treatment.

[0051] 4. Synthesis of Compound X201415

[0052]

[0053] 2-(5-bromopyridin-2-yl)propan-2-ol (8.7mmol, 1.5eq), Pd(dppf)Cl2 (0.58mmol, 0.1eq) and potassium carbonate (11.6mmol, 2eq) were added to the DMF solution of X201415-e and protected with nitrogen. The reaction solution was placed in a 100°C oil bath and stirred for 5 hours. When the reaction was complete, 100mL of water and 100mL of ethyl acetate were added to the reaction solution, stirred and separated. The aqueous phase was extracted once with 100mL of ethyl acetate. The organic phases were combined, washed with saturated sodium chloride in turn, and dried over anhydrous sodium sulfate. The organic phase was desolventized to dryness, sanded, and column chromatographed. 3.6g of crude X201415 was obtained. 2g of the target product was purified by column chromatography, and its characteristic results are as follows:

[0054] 1 HNMR(400MHz,DMSO-d6)δ9.73(d,J=4.4Hz,1H),8.87(d,J=2.4Hz,1H),8.84(s,1H),8.79(dd ,J=4.5,1.9Hz,1H),8.73(dd,J=8.0,1.9Hz,1H),8.13(dd,J=8.3,2.4Hz,1H),8.03(t,J=1.9H z,1H),7.95(dt,J=7.9,1.4Hz,1H),7.78–7.69(m,2H),7.69–7.61(m,2H),5.28(s,1H),2.90( td,J=7.3,3.7Hz,1H),1.47(s,6H),0.78(dd,J=7.0,2.2Hz,2H),0.57(dd,J=4.2,2.2Hz,2H).

[0055] MS (ESI) +: 441.2.

[0056] Example 2: HepG2 cell experiment

[0057] 1. Cells and Main Reagents

[0058] Human hepatoma cell line (HepG2) was purchased from Pronocell; dimethyl sulfoxide (DMSO) was purchased from Solarbio; bovine serum albumin (BSA) and puromycin were purchased from Beyotime; palmitic acid (PA) was purchased from Merck; high glucose medium (DMEM) and fetal bovine serum were purchased from Gibco; shGPR75 lentivirus and auxiliary infection reagents A and B were purchased from Primi Technology; BODIPY dye was purchased from ThermoFisher; triglyceride (TG) determination kit was purchased from Prilep.

[0059] Among them, the lentivirus contains the following interfering sequences:

[0060] The nucleotide sequence of scramble (control group, this sequence does not knock down shGPR75) is:

[0061] CCTAAGGTTAAGTCGCCCTCGgctcgaggCGAGGGCGACTTAACCTTAGGC;

[0062] The nucleotide sequence of shGPR75 (experimental group, interference sequence knockdown of shGPR75) is:

[0063] GAACCTGTCCTTCTGTGACCTTTCAAGAGAAGGTCACAGAAGGACAGGTTC.

[0064] 2. Experimental Methods

[0065] 2.1 Establishment of HepG2 cell line infected with lentivirus

[0066] The HepG2 cell line to be infected was planted in a 6-well plate one day in advance. When the cell density reached 40-50%, the culture medium was removed, and the lentivirus was diluted to 10 MOI with 2 ml of fresh culture medium. Auxiliary infection reagents A and B were added, and the infection efficiency was observed under an inverted fluorescence microscope 48-72 hours after infection. Puromycin with a final concentration of 1 μg / mL was used for screening 72 hours after infection, and the screening time was 7 days. After puromycin screening, puromycin with a final concentration of 0.5 μg / mL was used to maintain the HepG2 stable cell line, and the cell line was frozen and revived when needed.

[0067] 2.2 Establishment of cell NASH model and drug administration

[0068] Resuscitated HepG2 cell lines infected with lentivirus, cells in the logarithmic growth phase were taken, single cell suspension was prepared in serum-containing DMEM medium, and 4×10 5Cells / well were inoculated in a 12-well culture plate, with 3 replicates per group. After shaking, the cells were incubated at 37°C and 5% CO2 until the cell density reached 70%-80%. The original culture medium was discarded, and a blank solvent (10% BSA solution) was added to the control group, a 200μM PA solution was added to the model group, and 5μM, 10μM, and 100μM X201415 were added to the drug-treated group on the basis of the 200μM PA solution, using serum-free DMEM medium containing 0.1% DMSO. Samples were collected 24 hours after drug administration.

[0069] 2.3 Cell BODIPY staining

[0070] Discard the culture medium and wash twice with PBS. Add 100 μL of 4% paraformaldehyde fixative and incubate at room temperature for 30 minutes. After fixing the cells, discard the fixative and wash three times with PBS. Add 100 μL of BODIPY working solution (1:1000 dilution) to each well, incubate in the dark for 25 minutes, discard the working solution, and wash three times with PBS. Finally, add 200 μL of PBS to each well and use a live cell imager (GFP channel) to observe and record the accumulation of lipid droplets.

[0071] 2.4 Cellular TG content detection

[0072] Discard the culture medium, wash twice with PBS, collect the cells, add lysis solution and mix well, and let stand at room temperature for 10 minutes. Take an appropriate amount of supernatant, heat at 70℃ for 10 minutes, and centrifuge at 2000rpm for 5 minutes. Add 10μL of supernatant to a 96-well plate, add 190μL of working solution, react at 37℃ for 15 minutes, and measure the OD value at 550nm. Calculate the TG content of each sample according to the standard curve, and correct it with protein content to obtain the final TG content.

[0073] 3. Experimental results

[0074] PA is a substance used to cause cellular lipid accumulation, such as Figure 1 As shown in A, after PA treatment, BODIPY staining of scramble HepG2 cells showed that green fluorescence was significantly enhanced, indicating an increase in lipid content; after intervention with X201415 (5μM, 10μM and 100μM), the cellular lipid content decreased in a dose-dependent manner, with 100μM having the most significant effect. In addition, Figure 1 B (left) shows that when GPR75 protein is present, the TG content of HepG2 cells induced by PA is reduced, and there is a significant difference among the groups treated with X201415; Figure 1 B (right) shows that when the GPR75 protein was knocked down, there was no significant change after the administration of X201415, suggesting that the inhibitory effect of X201415 on PA-induced lipid accumulation in HepG2 cells is exerted through the GPR75 protein.

[0075] Example 3: Animal Experiment

[0076] 1. Materials and Methods

[0077] 1.1 Experimental animals

[0078] C57BL / 6J male mice (SPF grade) aged 6 to 7 weeks and weighing 21-23 g were purchased from Weitonglihua Experimental Animal Technology Co., Ltd. and housed in standard cages with constant temperature (22±1°C) and constant humidity (55±5%), with 12-h alternating light and dark lighting, free access to water and food, and experiments were carried out after one week of adaptation.

[0079] 1.2 Drugs and reagents

[0080] 1) CDAHFD feed: purchased from Nantong Trofi Feed Technology Co., Ltd., product number TP36225MCD.

[0081] 2) 0.5% CMC-Na solution: Weigh 2.5 g of sodium carboxymethyl cellulose, slowly add it into 500 mL of ultrapure water, and let it stand until it is completely dissolved before use.

[0082] 3) Preparation of 20 mg / kg X201415 suspension: 20 mg of X201415 powder was weighed, ground and added with 10 mL of 0.5% CMC-Na solution to prepare a 2 mg / mL suspension; for the efficacy test in NASH model mice, the suspension was administered orally at a dose of 20 mg / kg at a rate of 0.2 mL / 20 g body weight.

[0083] 4) Main reagents: Triglyceride (TG) and total cholesterol (TC) kits were purchased from Nanjing Jiancheng Bioengineering Institute.

[0084] 2. Experimental Methods

[0085] 2.1 Establishment of NASH mouse model and administration of X201415

[0086] C57BL / 6J mice that had adapted for one week were randomly divided into a CMC-Na group and a drug-treated group, and both were fed with CDAHFD feed. The CMC-Na group was given 0.5% CMC-Na solution, and the drug-treated group was given 20 mg / kg of X201415 suspension, gavage once a day. The NASH model was established after 2 weeks of feeding, followed by 2 weeks of gavage. After the experiment, the mice were fasted and deprived of water for 12 hours, anesthetized with 1% sodium pentobarbital and weighed. After orbital blood was drawn, the mice were killed, the liver was weighed, some liver tissues were fixed in 4% paraformaldehyde fixative for paraffin sections, some were embedded in OCT for frozen sections, and the rest were placed in a -80°C refrigerator for standby use.

[0087] 2.2 Histomorphological observation

[0088] Liver samples fixed with 4% paraformaldehyde and embedded in OCT were sent to the Pathology and PDX Center of China Pharmaceutical University, where pathologists performed H&E, MASSON, and Oil Red O staining, and each section was recorded using a Zeiss MDS digital scanning system.

[0089] 2.3 Detection of liver triglyceride (TG) and total cholesterol (TC) content

[0090] About 20 mg of mouse liver was weighed, and the absorbance was determined according to the instructions of the triglyceride (TG) and total cholesterol (TC) determination kit, and the TG and TC contents in the liver were calculated based on the protein concentration correction.

[0091] 2.4 qRT-PCR detection of metabolism, inflammation and fibrosis-related gene expression levels

[0092] Weigh 15 mg of mouse liver, cut it into pieces, add 3 zirconium beads and 1 mL RNAiso Plus lysis buffer. After homogenization, let it stand at room temperature for 5 minutes, add 200 μL of chloroform, shake vigorously for 15-30 seconds, let it stand for 5 minutes, and then centrifuge at 12000g for 15 minutes at 4°C, and take 350 μL of the top aqueous phase. Add an equal volume of isopropanol, mix well to precipitate RNA, let it stand for 10 minutes, and centrifuge at 12000g for 10 minutes at 4°C. Discard the supernatant, add 1 mL of 75% ethanol (anhydrous ethanol: DEPC water = 3:1) to wash the precipitate, and centrifuge at 12000g for 5 minutes at 4°C. Dry the RNA precipitate and dissolve it in DEPC water.

[0093] Take 2 μL RNA and add 198 μL DEPC water to dilute 100 times, and read the absorbance at 230 nm, 260 nm, 280 nm and 320 nm (OD230, OD260, OD280, OD320). RNA purity is OD260 / 280, and a value between 1.8 and 2.1 indicates high purity. (OD260-OD320)×0.04×100 is the RNA concentration (μg / μL). According to the concentration results, dilute the RNA to 0.5 μg / μL with DEPC water, and reverse transcribe according to the ratio of RNA: RT reagent: DEPC water = 1:2:7: 37°C for 15 minutes, 85°C for 5 seconds, cool to 4°C, and the generated cDNA is stored at -20°C.

[0094] The mRNA content in liver tissue was detected by qRT-PCR using the system of Sybr (7.5 μL), DEPC water (4.5 μL), Forward primer (10 μM, 1 μL), Reverse primer (10 μM, 1 μL) and cDNA (1 μL).

[0095] 3. Experimental results

[0096] See attached for the results Figures 2 to 6Compared with the CMC-Na group, Figure 2 A shows that the liver morphology of mice was significantly improved after administration of X201415, with reduced volume, smooth surface, ruddy color and soft texture; Figure 2 B shows a decrease in epididymal fat volume; Figure 2 C shows a decrease in body weight and liver index. Liver TC and TG are indicators for evaluating individual lipid metabolism status. Figure 2 D shows that the TC and TG levels in the liver decreased significantly after 2 weeks of X201415 administration. Figure 3 The results of H&E, Oil Red O, and MASSON staining showed that compared with the mice in the CMC-Na group, the liver lobules of the mice after administration of X201415 were more neatly arranged, the fat accumulation and collagen fiber content were significantly reduced, and the lipid metabolism disorder and fibrosis degree were improved. Figure 4 The results showed the changes in the expression levels of lipid metabolism-related genes after X201415 drug intervention. Compared with the CMC-Na group, the expression of key enzyme genes such as Srebp-1c, Scd1, Fasn, Dpat and Gpat decreased significantly, indicating that the drug effectively inhibited the synthesis of fatty acids and triglycerides. However, there was no significant change in the expression level of the Acc1 gene. At the same time, Il-1β, Tnf-α, Mcp1, Il-6 and ccl2 are a series of pro-inflammatory factor-related genes. Figure 5 The results showed that compared with CMC-Na, X201415 administration significantly downregulated the expression of this series of inflammation-related genes. Fibrosis is often accompanied in NASH, and the expression of Acta2, Col1a1 and Tgfβ genes is usually positively correlated with the degree of fibrosis. Figure 6 As shown, compared with the CMC-Na group, the X201415 drug significantly inhibited the expression of these key fibrosis genes, demonstrating its potential efficacy in regulating the process of fibrosis.

[0097] Example 4: Virtual molecular docking simulation of X201415 and GPR75 protein binding site

[0098] 1. Materials used

[0099] SDF file of X201415: 3D structure downloaded from pubchem website, changes are: 10203632.

[0100] GPR75 protein: PDB file downloaded from the AlphaFold Protein Structure Database website, number AF-O95800-F1-v4.

[0101] Software: Maestro (version 2018), PyMOL.

[0102] 2. Molecular docking method

[0103] GPR75 protein was pre-processed, possible binding pockets / sites were generated using SiteMap, and receptor grids were generated using Glide. X201415 was pre-processed with ligands, and flexible docking was performed using the Ligand Docking module, and finally visualized on PyMOL to generate a small molecule ligand-protein interaction map.

[0104] 3. Prediction results

[0105] The prediction results are as follows Figure 7 As shown, X201415 can increase the binding affinity and stability of the compound to the target protein by forming a hydrogen bond with ASN78 of the GPR75 protein, and the overlap of the π electron cloud with TYR486 forms a pi-pi bond, which helps to further enhance the binding stability. This shows that X201415 has a certain selectivity for the GPR75 protein and has strong stability.

[0106] The above results show that X201415 can directly act on GPR75 protein, produce NASH-improving effects, reduce liver damage, improve lipid metabolism, inhibit inflammatory response, and alleviate fibrosis. These results provide experimental evidence for X201415's potential application in the treatment of NAFLD and NASH by acting on GPR75 protein, and also provide important clues for further studying its mechanism of action and developing new lipid metabolism regulators.

[0107] The preferred embodiments of the present application are used to illustrate the present application and are not intended to limit the present application. Any replacement and modification made without departing from the concept of the present invention may be deemed to be included in the present invention. These embodiments are selected and described to better explain the principles and practical applications, so as to facilitate the understanding and use of the present application by persons skilled in the art. The present invention is limited only by the claims and their full scope and equivalents.

Claims

1. A biaryl-substituted 1,8-naphthyridine-4(1H)-one compound X201415 and a pharmaceutically acceptable salt or prodrug thereof in the preparation of an antagonist of GPR75 protein, characterized in that: The structural formula of the X201415 is as follows:

2. Use of a biaryl-substituted 1,8-naphthyridine-4(1H)-one compound X201415 and a pharmaceutically acceptable salt or prodrug thereof according to claim 1 in the preparation of a drug or product acting on GPR75 protein for the treatment of non-alcoholic fatty hepatitis.

3. The use according to claim 1, characterized in that: The X201415 is prepared by the following steps: 2-chloronicotinoyl chloride X201415-a is used as a raw material, and esterification, hydrolysis, nucleophilic substitution and coupling reaction are performed to obtain compound X201415. The preparation route is as follows:

4. The use according to claim 1 or 2, characterized in that: The X201415 is a complex formed by X201415 and a pharmaceutically acceptable carrier or excipient.

Images