Pro.ALP conopeptide for instantly resisting and fading wrinkles as well as biosynthesis method and application of Pro.ALP conopeptide

Abstract

The invention discloses a Pro.ALP conopeptide for instantly resisting and fading wrinkles. The amino acid sequence of the conopeptide is as shown in any one of SEQ ID No.1-3. The invention further discloses a preparation method of the conopeptide. The invention also discloses a coding gene, an expression vector, host bacteria, a biosynthesis method and application of the gene. The prokaryotic system is used for expression, the system is simple, the yield is high, and the cost is low. The conopeptide disclosed by the invention can be efficiently expressed in a prokaryotic system, the defects of chemical synthesis are overcome, and the purification difficulty is reduced; the biosynthesized conopeptide has the advantages of stable quality, instant skin firming effect and good solubility, and has good application in the field of cosmetics.

Description

Technical Field

[0001] The invention relates to a Pro.ALP conopeptide for immediate anti-wrinkle and anti-line effect and a biosynthesis method and application thereof, belonging to the technical field of protein expression. Background Art

[0002] Conotoxins are a class of biologically active peptide toxins extracted from the marine organism Conus. They are also called arginine / lysine peptides. They are a special class of peptide venom secreted by Conus through the venom tube. They are mainly used for predation and defense. They are divided into multiple superfamilies and subtypes according to their structure and mechanism of action. These superfamilies include A, O, T, M, P, I, etc., and each superfamily is further divided into α, ω, μ, δ and other subtypes according to their different targets and pharmacological activities on the organism. There are more than 2,000 known conotoxins. These small peptide toxins are generally composed of 10-46 amino acids, rich in disulfide bonds, and have a special structure. They can specifically act on receptors or ion channels, thereby paralyzing and relaxing muscles, helping to relieve wrinkles in a relatively short period of time, and retaining 5% of the neuromuscular current conduction of muscles, so they can provide a very natural wrinkle removal effect.

[0003] At present, there are three main ways to synthesize cono peptides: extraction from natural cono, genetic engineering synthesis and artificial chemical synthesis. Extraction from natural cono is the most primitive method, but the amount of cono peptide obtained is very small. Due to the destruction of marine ecology, the number of wild cono has dropped sharply. This method is not only inefficient, but also may aggravate environmental deterioration. Chemical synthesis is widely used in the synthesis of short peptides with a short number (number of amino acids ≤ 10). Although the chemical synthesis process is mature and easy to industrialize, the cono toxin has more amino acid residues, the yield and purity of artificial synthesis are low, and the synthesized peptide needs to be oxidatively folded to obtain an active conformation. The chemical synthesis method also faces the disadvantage of a sharp increase in production costs. This long peptide is often difficult to mass produce in industry, such as patent publication number CN110894225A. The preparation and purification method of cono peptides includes the preparation of linear peptide amino resins, cracking, linear peptide folding, crude peptide purification and other steps, which is very complicated and costly. Genetic engineering synthesis refers to the gene transformation of conotoxin into microorganisms to make it naturally expressed, and then separation and purification are carried out, but the cono peptide synthesized by genetic engineering has poor stability and is easily degraded due to its small molecular weight and lack of partial base modification. When the patent publication number CN104334155A chemically synthesizes cono peptide, the glutamine at the N-terminal of cono peptide is converted into pyroglutamic acid, which blocks protein degradation, reduces its sensitivity to aminopeptidase degradation, and amidates the carboxyl group at the C-terminal, changes the charge property brought by the carboxyl group, and converts the carboxyl group originally carrying a negative charge into an amide group close to neutrality, thereby improving the stability of protein or peptide segment to some extent. Therefore, a preparation method with low cost and large-scale production is provided, and the cono peptide protein with high biological activity, instant anti-wrinkle and long-term repair is of great application value. Summary of the invention

[0004] The purpose of the present invention is to provide a biosynthetic method of Pro.ALP cono peptide for immediate anti-wrinkle and anti-line effect in view of the poor stability of the cono peptide currently synthesized by genetic engineering.

[0005] The technical solution adopted by the present invention is:

[0006] A Pro.ALP cono peptide for immediate anti-wrinkle and anti-line treatment, the amino acid sequence of which is shown in SEQ ID No. 1-3.

[0007] The gene encoding the above-mentioned conopeptide.

[0008] Preferably, the base sequence is shown as SEQ ID No.5-8.

[0009] An expression vector is provided for expressing the above-mentioned conopeptide.

[0010] Preferably, the expression vector is pET32a or pET30a.

[0011] The host bacteria express the above-mentioned conopeptide.

[0012] Preferably, the host bacteria is Escherichia coli.

[0013] The biosynthetic preparation method of the above-mentioned conopeptide is characterized in that the steps include:

[0014] (1) constructing the above-mentioned conopeptide plasmid expression vector and transforming it into a host bacterium;

[0015] (2) Cultivating the expression host bacteria and inducing protein expression;

[0016] (3) Purify the expressed product to obtain cono peptide.

[0017] A conopeptide with anti-wrinkle effect is prepared by the above-mentioned biosynthesis method.

[0018] Application of the above-mentioned conopeptide in the preparation of anti-wrinkle products.

[0019] Beneficial effects of the present invention:

[0020] The invention provides a biosynthesis method of cono peptide, which has stable quality and low cost. The cono peptide synthesized by the invention has high stability, instant skin tightening efficacy and good solubility. The cono peptide can be expressed by a prokaryotic system, has a simple system, high yield and low cost, has anti-wrinkle efficacy, and can be used to prepare anti-wrinkle products. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 The expression vector pET32a-conopeptide map of the present invention.

[0022] Figure 2 The stability of the cono peptide liquid of the present invention at different temperatures, wherein the left figure is at 25°C and the right figure is at 45°C.

[0023] Figure 3 Photographs showing the wrinkle-removing efficacy of the cono peptide of the present invention. DETAILED DESCRIPTION

[0024] The present invention is further illustrated by examples below, but is not intended to be limiting of the present invention. The specific materials used in the embodiments of the present invention and their sources are provided below. However, it should be understood that these are merely exemplary and are not intended to limit the present invention, and materials identical or similar to the types, models, qualities, properties or functions of the following reagents and instruments can be used to implement the present invention. The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources.

[0025] Example 1: Preparation of conopeptide expression vector

[0026] (1) Gene design and synthesis

[0027] In the present invention, the expression vector of cono peptide is constructed, and the amino acid sequence designed for the expression of cono peptide is shown in SEQ ID No.1-4, wherein the amino acid sequence shown in SEQ ID No.1 includes a linker, a cono peptide, and 6*His connected in sequence, and SEQ ID No.2 and SEQ ID No.3 replace the amino acid sequence of the linker on the basis of SEQ ID No.1 to increase the expression amount of the protein, and SEQ ID No.4 is a linker without adding a linker at the N-terminus, and only a 6*His purification tag is added to the C-terminus of the cono peptide, and the corresponding coding gene is shown in SEQ ID No.5-8. At the same time, a control plasmid is constructed, and SEQ ID No.4-6 is designed into the primer, and the primer synthesis is handed over to Sangon Biotech (Shanghai) Co., Ltd.

[0028] Table 1: Primer design:

[0029] Primer name Primer sequences Skeleton-F GATCCGGCTGCTAACAAAG(SEQ ID No.9) Skeleton-R ATGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCT(SEQ ID No.10) Conopeptide-1-F TAAGAAGGAGATATACATATGCCGACGCCGACCCCAC(SEQ ID No.11) Conopeptide-1-R CTTTGTTAGCAGCCGGATCTCAGTGGTGGTGGTGGTGGTGGCA(SEQ ID No.12) Conopeptide-2-F TAAGAAGGAGATATACATATGGAAGCAGCAGCAAAACAGGGTT(SEQ ID No.13) Conopeptide-2-R CTTTGTTAGCAGCCGGATCTCAGTGGTGGTGGTGGTGGTGGCA(SEQ ID No.12) Conopeptide-3-F TAAGAAGGAGATATACATATGGAAGCAGCAGCAAAACAGGGTT(SEQ ID No.14) Conopeptide-3-R CTTTGTTAGCAGCCGGATCTCAGTGGTGGTGGTGGTGGTGGCA(SEQ ID No.12) Conopeptide-4-F TAAGAAGGAGATATACATATGCAGGGTTGCTGCAACGGT(SEQ ID No.15) Conopeptide-4-R CTTTGTTAGCAGCCGGATCTCAGTGGTGGTGGTGGTGGTGGCA(SEQ ID No.12)

[0030] (2) Construction of expression vector

[0031] The above primers were used for PCR amplification, and the amplified products were recovered by gel agarose gel. The recovered products were subjected to blunt-end T4 ligation to obtain the corresponding plasmid.

[0032] Table 2: PCR amplification system

[0033] System components Ingredient volume Primer F 2.5μL Primer R 2.5μL 2xSuperNova PCR Mix(Dye) 25μL pET32a plasmid 1μL <![CDATA[ddH 2 The]]> To 50μL

[0034] After the PCR system was prepared, it was mixed and centrifuged. The PCR amplification conditions were as follows: the first stage was pre-denaturation at 98°C for 30s; the second stage was denaturation at 98°C for 10s, annealing at 50-72°C for 30s, extension at 72°C for 30s / kb, and 33 cycles; the third stage was final extension at 72°C for 2min. The PCR product was recovered using a universal DNA purification kit (Tiangen Biochemical Technology Co., Ltd.) and the operation steps in the product manual were followed.

[0035] Table 3: Gibson connection: system

[0036]

[0037]

[0038] After mixing the above components on ice, place in a 50°C heat bath for 60 min. The obtained ligation product is stored on ice or at -20°C for subsequent competent cell transformation.

[0039] The ligation product was transformed into the host bacteria E. coli-DH5α by heat shock method, coated on LB culture resistance plate, incubated at 37°C overnight, randomly picked positive clones, cultured in LB liquid medium, 37°C, 220rpm overnight, and the plasmid was extracted using a plasmid rapid extraction kit to successfully construct plasmids pET32a-conopeptide-1, pET32a-conopeptide-2 and pET32a-conopeptide-3. The plasmid maps are shown in Figure 1 .

[0040] (3) Construction of engineered bacteria

[0041] The recombinant expression plasmid obtained above was transferred into the competent E. coli cells Origami B (DE3) by heat shock, and positive E. coli genetically engineered bacteria were screened. The specific process was as follows: ① 5 μL of the recombinant expression plasmid was added to 100 μL of the competent E. coli cells Origami (DE3), and the mixture was placed on ice for 30 min; ② the mixture was heat shocked in a 42°C water bath for 90 s, and then quickly placed on ice for 2 min; ③ 500 μL of non-resistant LB liquid culture medium (10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride) was added to the mixture, and cultured at 37°C, 220 rpm for 0.5 h; ④ Take 200 μL of the bacterial solution and evenly spread it on an LB solid culture medium plate containing ampicillin resistance (10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride, 15 g / L agar, 50 μg / mL ampicillin); ⑤ Incubate the plate upside down in a 37°C incubator for about 16 hours until clearly visible colonies grow to obtain the corresponding DE3-pET32a-conopeptide-1, DE3-pET32a-conopeptide-2, DE3-pET32a-conopeptide-3 and DE3-pET32a-conopeptide-4 engineered bacteria.

[0042] Example 2: Inducible expression of recombinant conopeptide

[0043] The single colony on the plate was placed in LB liquid medium containing ampicillin antibiotics and cultured at 37°C, 220rpm for 12 hours. This is the first-level seed solution. It was inoculated into a new LB medium at a 1% inoculum and cultured at 37°C overnight. This is the second-level seed solution. It was then inoculated into a new LB medium at a 5% inoculum and cultured at 37°C until OD 600 The final concentration of IPTG was 0.5 mM and the expression was induced at 18°C ​​for 20 hours. The cells were collected by centrifugation at 4000 g and 4°C for 20 minutes.

[0044] The cells were resuspended in lysis buffer (20 mM Tris-HCl, 1 mM EDTA, 500 mM NaCl, pH 8.5), 100X protease inhibitor PMSF was added, and then the cells were disrupted by ultrasonication at 360W for 30 min (ultrasonication for 3 s and 6 s intervals). Then 1 mL of the disrupted liquid was centrifuged at 4 °C and 10000 g for 10 min, 80 μL of the supernatant was taken, and the precipitate was resuspended with 1000 μL of lysis buffer. 80 μL of the resuspended liquid was taken, and 20 μL of 5X protein loading buffer was added to the supernatant and the precipitate. After mixing, the mixture was heated in a boiling water bath for 10 min for SDS-PAGE electrophoresis, Coomassie Brilliant Blue staining, decolorization, and observation of protein expression. The results are shown in Table 3. Under induction, the constructed engineering bacteria DE3-pET32a-conopeptide-1, DE3-pET32a-conopeptide-2, DE3-pET32a-conopeptide-3 and DE3-pET32a-conopeptide-4 all expressed proteins. According to the grayscale analysis of the SDS-PAGE gel image, the percentage of DE3-pET32a-conopeptide-1 in the total bacterial protein was 40%, and the protein expression level of DE3-pET32a-conopeptide-1 was higher than that of DE3-pET32a-conopeptide-2, DE3-pET32a-conopeptide-3 and DE3-pET32a-conopeptide-4.

[0045] Table 3: Protein expression test results

[0046] Conopeptide-1 Conopeptide-2 Conopeptide-3 Conopeptide-4 Amino acid length (AA) 34 34 34 29 Molecular weight (kD) 3.8 3.7 3.8 3.4 Percentage of total bacterial protein (%) 40 36 35 30 Soluble expression yes yes yes yes

[0047] Example 3: Purification of recombinant conopeptide expression products

[0048] The crushed liquid obtained in Example 2 was centrifuged at 10000g and 4°C for 30min, the supernatant was collected, the Ni affinity column material was washed with clean water, the column material was equilibrated with buffer 1 (25mMTris, 200mM NaCl, pH8.0), the sample was loaded, the impurities were rinsed with a washing buffer containing 20mM imidazole (20mM imidazole, 25mM Tris, 200mM NaCl, pH8.0), and the target protein was eluted with a solution containing 250mM imidazole (250mM imidazole, 25mM Tris, 200mM NaCl, pH8.0); the column material was washed with a solution containing 1M imidazole, then washed with water, and finally filled with 20% ethanol.

[0049] The protein solution purified by the Ni affinity column was passed through a desalting column to remove high concentration imidazole, thereby obtaining the purified recombinant conopeptide-1, conopeptide-2, conopeptide-3 and conopeptide-4. The SDS-PAGE electrophoresis showed that the impurity proteins were less and the protein purity was high.

[0050] Example 4: Stability Test

[0051] The recombinant cono peptide obtained in Example 3 was tested for stability. The cono peptide-1 liquid was prepared into a 1 mg / ml solution with 1×PBS without endotoxin, filtered through a 0.22 μm filter membrane, and dispensed into sterile centrifuge tubes. The tubes were placed at 45°C and 25°C, and samples were taken on the first, third, and seventh days for SDS-PAGE detection. The results are shown in FIG. Figure 2 As shown in the figure, the degradation rates of conopeptide-1, conopeptide-2 and conopeptide-3 placed at 25°C and 45°C were within 20%, with no obvious degradation. Conopeptide-1 had the highest stability, while the stability of conopeptide-1, conopeptide-2 and conopeptide-3 were significantly higher than that of conopeptide-4 without a linker at the front end. The results showed that adding a linker at the front end could significantly improve the stability of conopeptide, and conopeptide-4 was not used in the subsequent wrinkle removal effect test.

[0052] Example 5: Test on the wrinkle-removing effect of recombinant cono peptide

[0053] The recombinant conopeptide-1, conopeptide-2 and conopeptide-3 obtained in Example 3 were used for testing. The concentration of the conopeptide-1 liquid was 50 ppm. A placebo (pure water) was used as a blank control. The samples were evenly applied to the test area. No other cosmetics were used during the test. After 15 minutes, the immediate wrinkle removal effect of the samples was evaluated. The results are shown in the figure. Figure 3 As shown, after using recombinant conopeptide-1, the depth of the subjects' wrinkles was significantly reduced. On the surface, recombinant conopeptide-1, conopeptide-2 and conopeptide-3 all had immediate and significant wrinkle-removing effects, and the effect of recombinant conopeptide-1 was more obvious than that of conopeptide-2 and conopeptide-3.

Claims

1. A Pro.ALP conopeptide for immediate anti-wrinkle and anti-line treatment, characterized in that: The amino acid sequence is shown in any one of SEQ ID No. 1-3.

2. The gene encoding the Pro.ALP conopeptide according to claim 1.

3. The coding gene according to claim 2, characterized in that Its base sequence is shown in any one of SEQ ID No.5-7.

4. An expression vector expressing the Pro.ALP conopeptide according to claim 1.

5. The expression vector according to claim 4, characterized in that The vector is pET32a or pET30a.

6. An expression host bacterium, which is obtained by transforming the expression vector according to claim 4 or 5 into a host bacterium.

7. The expression host bacteria according to claim 6, characterized in that The host bacteria is Escherichia coli.

8. A method for biosynthesis of Pro.ALP conopeptide, characterized in that: The steps include: (1) constructing the expression vector according to claim 4 or 5, and transforming it into a host bacterium; (2) Cultivating the expression host bacteria and inducing protein expression; (3) purifying the expression product to obtain the Pro.ALP conopeptide described in claim 1.

9. The biosynthesis method according to claim 8, characterized in that In step (3), the protein is purified using a Ni affinity chromatography column.

10. Use of the Pro.ALP conopeptide according to claim 1 in the preparation of anti-wrinkle products.

Images