DsRNA of targeted BcMucin gene and application of dsRNA in preparation of preparation for preventing and treating gray mold

Abstract

The invention provides dsRNA (double-stranded ribonucleic acid) targeting a BcMucin gene and application of the dsRNA in preparation of a preparation for preventing and treating gray mold. The dsRNA is obtained by taking a coding sequence of a target gene BcMucin as a template through manual design and in-vitro synthesis. The dsRNA with the BcMucin as the target can be used for effectively inhibiting the occurrence of the botrytis cinerea. Experiments prove that after the deletion of the target gene BcMucin provided by the invention, botrytis cinerea hyphae grow slowly, the pathogenicity to tomatoes is completely lost, and the target gene BcMucin is a key gene for botrytis cinerea growth and pathogenicity regulation. The dsRNA provided by the invention can effectively interfere the expression of a target gene BcMucin in botrytis cinerea so as to inhibit the growth and development of the botrytis cinerea and the infection of the botrytis cinerea on host plants and reduce the biomass of the botrytis cinerea on scabs. The dsRNA provided by the invention can be used for RNA pesticide development based on RNAi, is applied to effective prevention and treatment of gray mold, and has a good market application prospect.

Description

Technical Field

[0001] The invention belongs to the technical field of crop disease prevention and control genes, and particularly relates to a dsRNA targeting a BcMucin gene and an application thereof in preparing a preparation for preventing and controlling gray mold. Background Art

[0002] Botrytis cinerea is a common fungal disease caused by infection with Botrytis cinerea. Botrytis cinerea has a wide range of hosts and can infect more than 1,000 plant species, including more than 200 crops. Botrytis cinerea can cause damage both in the field and after crops are harvested. Large-scale occurrence leads to a decrease in crop yields or even a complete loss, causing significant economic losses. At present, the prevention and control of botrytis cinerea is still mainly chemical control, but due to the characteristics of Botrytis cinerea's wide host range, short life cycle, and easy gene mutation, coupled with the irrational use of chemical pesticides, Botrytis cinerea has developed multidrug resistance to almost all chemical fungicides in use, greatly reducing the control effect of chemical fungicides. In addition, with people's attention to food safety and environmental safety, and the implementation of the national "weight loss and drug reduction" plan, the use of chemical pesticides has been greatly challenged. In order to reduce the use of chemical pesticides and ensure that grain yields are not significantly reduced due to pathogen infection, it is urgent to seek alternatives to traditional chemical pesticides to ensure and achieve the safe, green and sustainable development of my country's agricultural production.

[0003] RNA interference (RNAi) technology is a cutting-edge gene post-transcriptional regulation technology. It can target mRNA through double-stranded RNA (dsRNA), leading to the silencing of target genes, and has potential application value in the fields of medicine and agriculture. RNA pesticides developed by RNAi technology use dsRNA that specifically targets key genes of pests as the active ingredient. They have the advantages of strong targeting, excellent efficacy, high environmental and ecological safety, and low resistance to pesticides. They are considered to be the "third revolution" in the history of pesticide development. RNA pesticides are highly potential new biological pesticides that adapt to the future direction of agricultural development, with broad application prospects and huge application value. Promoting the creation and development of RNA pesticides is of great significance to the development of green agriculture and ecological agriculture in China. Screening key genes that regulate growth and development and pathogenicity in pests, and designing dsRNA with good interference effects based on key gene targets are one of the key factors affecting the success of RNA pesticide development. However, there are currently few key target genes of Botrytis cinerea suitable for RNAi, which makes it difficult to meet the development and application of RNA pesticides in the prevention and control of Botrytis cinerea. Summary of the invention

[0004] In view of the technical problem that there are currently insufficient key target genes of Botrytis cinerea that can be used for the development of RNA pesticides, the present invention aims to provide a dsRNA targeting the BcMucin gene and its use in the preparation of a preparation for preventing and controlling Botrytis cinerea. The dsRNA targeting the BcMucin gene is used for the prevention and control of Botrytis cinerea, which has a significant prevention and control effect.

[0005] In order to achieve the above invention objectives, the present invention is implemented through the following technical solutions:

[0006] The present invention provides application of the BcMucin gene in regulating the pathogenicity of gray mold. The encoding nucleotide sequence of the BcMucin gene is shown in SEQ ID No.2.

[0007] Furthermore, the BcMucin gene encodes an extracellular protein carrying an exocrine signal peptide, and its amino acid sequence is shown in SEQ ID No.3.

[0008] Furthermore, the deletion of the target gene BcMucin leads to slow growth of Botrytis cinerea hyphae.

[0009] Furthermore, the deletion of the target gene BcMucin results in the loss of pathogenicity of gray mold to tomato leaves.

[0010] The present invention also provides a dsRNA targeting the BcMucin gene, the nucleic acid sequence of the dsRNA synthesis template is shown as SEQ ID No.4, and the sequence of the dsRNA is shown as SEQ ID No.6.

[0011] Furthermore, the dsRNA is synthesized in vitro using the target gene BcMucin as a template; the template is obtained by adding a T7 promoter to the 5' end of the upstream primer and the downstream primer and amplifying the template by PCR.

[0012] The present invention also provides the use of the dsRNA in preparing a preparation for preventing and treating gray mold, and the dsRNA can target the BcMucin gene.

[0013] Furthermore, the dsRNA can reduce the mRNA level of the BcMucin gene by RNA interference.

[0014] Furthermore, the application is that the dsRNA can effectively inhibit the occurrence of tomato gray mold.

[0015] Furthermore, when applied, the dsRNA is used at a concentration of 100 mg / L to 500 mg / L, and the dsRNA is applied by leaf spraying.

[0016] Compared with the prior art, the present invention has the following advantages and beneficial effects: the present invention has experimentally proved that the BcMucin gene is a key gene for the hyphae growth and pathogenicity regulation of gray mold, and can be used as an RNAi target gene. The present invention designs dsRNA with BcMucin as the target, and experimentally proves that the dsRNA can effectively interfere with BcMucin, thereby effectively preventing and controlling the occurrence of gray mold, and has a significant prevention and control effect. The dsRNA provided by the present invention can be used for the creation of new biological pesticides, and has a good market application prospect. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 It is the signal peptide prediction result of the protein encoded by the BcMucin gene of the present invention.

[0018] Figure 2 The BcMucin gene knockout transformants (△BcMucin) were verified by PCR.

[0019] Figure 3 The invention discloses the mycelial growth and colony diameter statistics of the BcMucin gene knockout mutant (△BcMucin), the complemented mutant (△BcMucin-C) and the wild-type B05.10 strain of Botrytis cinerea on PDA plates.

[0020] Figure 4 This is an analysis of the pathogenicity of various Botrytis cinerea strains (B05.10, △BcMucin, △BcMucin-C) on tomato leaves.

[0021] Figure 5 This is the electrophoresis detection result of BcMucin-dsRNA and GFP-dsRNA of the present invention.

[0022] Figure 6 This is a test of the control effect of the BcMucin-dsRNA of the present invention on tomato gray mold, with GFP-dsRNA as a control.

[0023] Figure 7 The BcMucin-dsRNA of the present invention can significantly reduce the biomass of Botrytis cinerea on the host, with GFP-dsRNA as a control.

[0024] Figure 8 The invention is a test of the interference effect of the BcMucin-dsRNA of the present invention on the target gene BcMucin of Botrytis cinerea, with GFP-dsRNA as a control. DETAILED DESCRIPTION

[0025] The technical scheme of the present invention is further described in detail below in conjunction with the accompanying drawings and specific embodiments. The experimental methods in the following embodiments are conventional methods unless otherwise specified and are not described in detail; for non-conventional experimental operations, the specific steps are described in detail as follows. The experimental materials, drugs, instruments, etc. used in the following embodiments are all commercially available products unless otherwise specified. The quantitative statistics in the following embodiments are all repeated experiments three times and the average value is taken.

[0026] Example 1: Knockout of BcMucin gene of Botrytis cinerea

[0027] 1. Obtaining the gene sequence of BcMucin and constructing the knockout fragment

[0028] The present invention obtains the gene sequence of Botrytis cinerea BcMucin (Bcin05g01970) from the fungal genome database (EnzemblFungi, http: / / fungi.ensembl.org / index.html), with a total length of 1216 bp, as shown in SEQ ID No. 1; the coding sequence (CDS) is 750 bp long, as shown in SEQ ID No. 2; it encodes 249 amino acids, as shown in SEQ ID No. 3. According to the prediction of the SignalP-5.0 (https: / / services.healthtech.dtu.dk / services / SignalP-5.0 / ) online server, the amino acids at positions 1-18 are a protein exocytosis signal peptide sequence, as shown in Figure 1 As shown, it indicates that BcMucin protein is a secreted protein.

[0029] DNA of Botrytis cinerea was extracted by CTAB method as template, up and down fragments of BcMucin were amplified by primers in Table 1, hygromycin gene (HPH) was amplified from pSilent-1 plasmid by HPH-F / R primers in Table 1, up and down fragments of BcMucin were connected to 5' and 3' ends of HPH respectively by fusion RCR method, and large fragment up-HPH-down was constructed. PCR amplification was performed by large fragment amplification primers, and large fragments were obtained after agarose gel electrophoresis and gel recovery of PCR products, which were used directly or stored at -20℃ for future use.

[0030] Table 1 Primers used for vector construction

[0031]

[0032] 2. Construction and identification of BcMucin knockout mutant of Botrytis cinerea

[0033] The BcMucin gene was knocked out by PEG-mediated protoplast transformation technology. Collect the mycelium of Botrytis cinerea, use cell wall degrading enzymes to enzymatically hydrolyze the cell wall of the mycelium to obtain the protoplast cells of Botrytis cinerea, add the large fragments obtained by PCR amplification and PEG and other reagents to complete the protoplast transformation. The transformation product of the double-wall culture is added to the PDA medium containing hygromycin resistance to prepare the screening plate. After 3-5 days of culture, pick a single colony from the plate and inoculate it on a new PDA plate containing hygromycin, which is a positive transformant. Extract the transformant genome, and verify the presence of the target gene BcMucin in the transformant by PCR technology. The results are as follows Figure 2 As shown, the target gene can be detected in the wild-type strain B05.10, but no corresponding band is detected in the transformant, indicating that the BcMucin gene is successfully knocked out.

[0034] Example 2: Growth and Pathogenicity Analysis of BcMucin-deficient Botrytis cinerea

[0035] The selected transformants were cultured on PDA medium without antibiotics, and the colony growth of the transformants was observed and counted. Figure 3 After 3 days of cultivation, the colony diameters of the wild type (B05.10) and the complemented transformant (△BcMucin-C) exceeded 5 cm, while the colony diameter of the BcMucin deletion strain (△BcMucin) was only 3 cm, which was significantly smaller than that of the wild type and the complemented strain.

[0036] Each strain of Botrytis cinerea was cultured on PDA medium without antibiotics for about 3 days. A hole with a diameter of 5 mm was punched at the edge of the colony. The bacterial cake was inoculated in the center of the plant leaf. After 3 days of moisturizing culture, photos were taken and the diameter of the lesions was measured. The specific results are as follows: Figure 4 B05.10 and △BcMucin-C can normally infect tomato leaves and produce more than 1cm 2 lesions, while leaves inoculated with knockout transformants △BcMucin-1 and △BcMucin-2 showed no disease at all.

[0037] The above results indicate that the BcMucin gene is a key gene for the regulation of hyphal growth and pathogenicity of Botrytis cinerea and can therefore be used as a target for the design and development of dsRNA.

[0038] Example 3: Design and preparation of dsRNA fragments of BcMucin encoding gene

[0039] The coding sequence of the BcMucin gene (as shown in SEQ ID No.2) was submitted to the siDirect version 2.1 server (http: / / sidirect2.rnai.jp / ) for small interfering RNA (siRNA) prediction, and the region with the most siRNA production within the sequence of 200-500bp was selected as the dsRNA template. Upstream and downstream amplification primers of the dsRNA template were designed, and T7 promoter sequences (TAATACGACTCACTATAGGGAGA) were added to the 5' ends of the upstream and downstream primers, respectively. The amplification primers are shown in Table 2. The cDNA of Botrytis cinerea was used as a template for PCR amplification. The PCR product was subjected to agarose gel electrophoresis and gel recovery to obtain DNA, which was the synthetic template for dsRNA. The sequence was shown in SEQ ID No.4. In the same way, the GFP dsRNA synthetic template was amplified from the plasmid containing the green fluorescent protein (GFP) coding gene. The sequence was shown in SEQ ID No.5, and the primers used were shown in Table 2. The template can be used to synthesize dsRNA immediately, or it can be stored in a -20℃ refrigerator for later use.

[0040] Table 2 dsRNA synthetic template amplification primers

[0041]

[0042] The dsRNA of BcMucin and GFP were synthesized using a dsRNA in vitro synthesis kit. The dsRNA in vitro transcription system was: NTPMix 8 μL, 10×Transcription Buffer 2 μL, T7 Enzyme Mix 2 μL, template 8 μL, ddH 2 Add 40 μL of sterile ddHO to the crude extract. 2 O was dissolved to obtain dsRNA of genes BcMucin and GFP, which were respectively recorded as BcMucin-dsRNA and GFP-dsRNA. The concentration of dsRNA was measured by spectrophotometer, and the purity of dsRNA was detected by agarose gel electrophoresis. The dsRNA agarose gel electrophoresis diagram is shown in Figure 5 According to the instructions in the kit, the T7 promoter starts transcription from the first guanine (G) after the core recognition sequence, that is, the BcMucin-dsRNA sequence obtained by in vitro transcription is shown in SEQ ID No.6, and the GFP-dsRNA sequence is shown in SEQ ID No.7.

[0043] Example 4: Application of dsBcMucin in the prevention and treatment of gray mold

[0044] Select 4-week-old tomato seedlings with uniform growth, take 20 leaves and randomly divide them into 2 groups, 10 leaves in each group, and place them on moist filter paper. 2 BcMucin-dsRNA and GFP-dsRNA were diluted to a final concentration of 200ug / ml and sprayed evenly onto the two groups of leaves using a small spray bottle. Conidia were collected from the PDA plate with gray mold, counted, and diluted to a conidia concentration of 10 6 After the solution on the leaf surface is dried naturally, 6ul of the above spore solution is inoculated on the leaves. Keep moist for 60-96 hours, observe the infection of gray mold, measure the diameter of the lesions by the cross method, and perform statistical analysis on the lesion areas on the two groups of leaves.

[0045] The results are as follows Figure 6 As shown in the figure, the lesions on the leaves treated with BcMucin-dsRNA were significantly smaller than those on the leaves treated with GFP-dsRNA. Leaves with lesions of the same size were taken, total DNA was extracted, and the biomass of Botrytis cinerea in the leaves was detected by fluorescent quantitative PCR. The results are shown in the figure. Figure 7 As shown, the biomass of Botrytis cinerea on the leaf lesions of the group with BcMucin-dsRNA added was significantly lower than that of the group with GFP-dsRNA added. The above results show that BcMucin-dsRNA has a significant control effect on Botrytis cinerea.

[0046] Mycelium of Botrytis cinerea was collected from the lesions, total RNA was extracted, and cDNA was obtained by reverse transcription. The mRNA level of the target gene BcMucin was detected by fluorescence quantitative PCR. Figure 8 As shown, after treatment with BcMucin-dsRNA, the mRNA level of the target gene BcMucin of Botrytis cinerea was significantly reduced, indicating that BcMucin-dsRNA can interfere with the expression of BcMucin.

[0047] Based on all the above results, the loss of BcMucin gene leads to slow growth and loss of pathogenicity of Botrytis cinerea, proving that it is a key gene for Botrytis cinerea pathogenicity. dsRNA designed with the key gene BcMucin as the target can effectively interfere with the expression of BcMucin gene in Botrytis cinerea, thereby effectively preventing and controlling Botrytis cinerea, and has the potential to be developed into RNA pesticides.

[0048] SEQ ID No. 6: BcMucin-dsRNA sequence GAGAGAAGCAAGAGAUUCCUUGCAAGCUCGCGAGCCAACCAAGCUCAAGGUUGAUCGCAACGCCGAGCCAGAACCCACUAAGCUUAAGGUUGACCGUCGCACCAAGCUCAAGGUUGAUAGAAACGCCGAAGCCGAGCCAACAAAGCUUAAGGUUGACCGUCGCACCAAGCUCAAGGUCGAUCGCAACGCUGAGCCAGAACCUACAAAACUUAAAGUUGACAGAAGCGCUGAAGCCGAGCCAACUCUC

[0049] SEQ ID No. 7: GFP-dsRNA sequence GAGAUCGAACUCGAUGGUGACGUCAAUGGCCAUAAGUUCUCAGUCAGCGGAGAGGGUGAGGGAGACGCUACAUAUGGUAAAUUGACUCUUAAGUUCAUCUGCACCACAGGUAAAUUGCCUGUACCUUGGCCUACACUCGUCACCACCCUCACCUACGGAGUUCAAUGCUUUUCCCGUUACCCAGAUCACAUGAAACAACAUGACUUUUUCAAGUCUGCAAUGCCAGAGGGAUAUGUCCAAGAGAGAACAAUCUUCUUUAAGGAUGACGGAAAUUAUAAGACUCGUGCCGAGGUUAAGUUCGAGGGUGAUACUCUCGUCAACCGUAUUGAGUUGAAGGGCAUCGAUUUCAAGGAAGACGGAAAUAUCCUCGGCCAUAAGCUUGAAUACAACUACAACAGUCACAACGUUUAUAUCAUGGCCGACAAGCAAAAAAAUGGAAUCAAGGUCAACUUCAAAAUCAGACACAACAUUGAGGAUGGCUCUGUUCAAUUGGCAGAUCACUACCAACAGAAUACUCUC

[0050] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for a person skilled in the art to modify the technical solutions described in the aforementioned embodiments, or to replace some of the technical features therein by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions claimed to be protected by the present invention.

Claims

1. The application of BcMucin gene in regulating the pathogenicity of Botrytis cinerea, characterized in that: The coding nucleotide sequence of the BcMucin gene is shown in SEQ ID No.

2.

2. The use according to claim 1, characterized in that: The BcMucin gene encodes an extracellular protein carrying an exocrine signal peptide, and its amino acid sequence is shown in SEQ ID No.

3.

3. The use according to claim 1, characterized in that: Knocking out the BcMucin gene will lead to slow growth of Botrytis cinerea hyphae and loss of pathogenicity of Botrytis cinerea.

4. A dsRNA targeting the BcMucin gene, characterized in that: The nucleotide sequence of the dsRNA synthetic template is shown in SEQ ID No.4, and the sequence of the dsRNA is shown in SEQ ID No.

6.

5. The dsRNA according to claim 4, characterized in that The amplification primers for the dsRNA synthetic template are SEQ ID No.16 and SEQ ID No.

17.

6. The dsRNA according to claim 4, characterized in that The in vitro transcription system of dsRNA is: NTPMix 8μL, 10×Transcription Buffer 2μL, T7 Enzyme Mix 2μL, template 8μL, and ddH2O is added to 20μL.

7. Use of the dsRNA targeting the BcMucin gene according to claim 4 in the preparation of a preparation for preventing and controlling gray mold.

8. The use according to claim 7, characterized in that: The dsRNA can target the BcMucin coding sequence and reduce the mRNA level of the BcMucin gene by RNA interference.

9. The use according to claim 7, characterized in that: The dsRNA can effectively inhibit the infection of gray mold on plant leaves.

10. The use according to claim 7, characterized in that: The dsRNA is prepared to a concentration of 100 mg / L to 500 mg / L and sprayed on plant leaves.

Images