Fluorescent quantitative PCR primer group for detecting paenibacillus mucilaginosus and application of fluorescent quantitative PCR primer group

Abstract

The invention discloses a fluorescent quantitative PCR (polymerase chain reaction) primer group for detecting paenibacillus mucilaginosus and application of the fluorescent quantitative PCR primer group. The sequence of the primer group is shown as SEQ ID NO.1-3, the reaction system comprises the primer group, a PCR buffer, Taq DNA polymerase, UDG enzyme, positive control and negative control, and the detection steps comprise: extracting nucleic acid of a sample to be detected, constructing the reaction system, carrying out a reaction according to a reaction program, and carrying out result interpretation. The method has the advantages that the detection method is efficient, simple and convenient, the specificity is high, the sensitivity can reach 10 < 2 > CFU / mL, and the detection result is accurate and reliable.

Description

Technical Field

[0001] The invention relates to the technical field of molecular detection, in particular to the molecular detection technology of jelly-like Paenibacillus. Background Art

[0002] Paenibacillus mucilaginosus is a major member of the genus Paenibacillus, also known as silicate bacteria, a Gram-positive bacterium widely distributed in nature. It is an important functional bacterium in the soil, which can decompose potassium and phosphorus in ores such as feldspar, mica, and apatite, and has multiple functions such as potassium solubilization, phosphorus solubilization, and nitrogen fixation. Its application in agricultural production can increase crop yields and improve the quality of agricultural products. In addition, Paenibacillus mucilaginosus also produces secondary metabolites with antagonistic effects, which can promote plant growth absorption, inhibit the growth of pathogens, and increase soil permeability. Therefore, Paenibacillus mucilaginosus has been promoted as a biological potash fertilizer product both at home and abroad.

[0003] At present, various types of jelly-like Paenibacillus products are mainly tested at various stages of production using microscopic observation, biochemical identification, and culture methods to control product quality. Due to the complex and professional microscopic observation, aseptic operation, and microbial culture, there are high requirements for personnel, equipment, and experimental environment, and microbial culture generally takes more than 8 hours, which greatly reduces the detection efficiency. Nowadays, PCR-based in vitro amplification technology is very mature and has been widely used in the fields of transgenics, epidemiological screening, and animal disease detection. However, for jelly-like Paenibacillus, there is only one literature report based on culture-PCR technology, "A gyrB-targeted PCR for rapid identification of Paenibacillus mucilaginosus". In order to improve its detection sensitivity, the literature introduces microbial culture technology, and electrophoresis testing is required at the same time, which greatly increases the detection time and reduces the detection efficiency. In order to further improve the detection efficiency and accuracy, the development of a new jelly-like Paenibacillus detection technology has huge market prospects. Summary of the invention

[0004] The purpose of the present invention is to provide a fluorescent quantitative PCR primer set for detecting Paenibacillus gelatinosa, and application thereof, so as to overcome the problems of long detection time and low efficiency in the existing molecular detection technology.

[0005] In order to achieve the above object, the present invention adopts the following technical solutions:

[0006] The present invention provides a fluorescent quantitative PCR primer set for detecting jelly-like Paenibacillus with the gyrB gene sequence (GeneBank: FJ009520) of Paenibacillus jelly as a target, comprising: a forward primer Muc-Y1-F, whose sequence is shown in SEQ ID NO.1; a reverse primer Muc-Y1-R, whose sequence is shown in SEQ ID NO.2; a probe Muc-Y1-P, whose sequence is shown in SEQ ID NO.3;

[0007] The 5' end of the probe is modified with a fluorescent group, and the 3' end is modified with a quenching group.

[0008] Furthermore, the fluorescent group is a FAM group, and the quenching group is a BHQ1 group.

[0009] The present invention also provides an application of the fluorescent quantitative PCR primer set in preparing a reagent or a kit for detecting jelly-like Paenibacillus.

[0010] The present invention also provides a kit for detecting jelly-like Paenibacillus containing the fluorescent quantitative PCR primer set, comprising the primer set, PCR buffer, Taq DNA polymerase, UDG enzyme, negative control, and positive control. The primer set, PCR buffer, Taq DNA polymerase, and UDG enzyme are pre-mixed into a reaction solution.

[0011] Furthermore, the negative control is ultrapure water, stored in a 0.5 mL storage tube;

[0012] The positive control is a recombinant plasmid containing the target sequence at a concentration of 10-100 pg / μL, stored in a 0.5 mL storage tube.

[0013] Furthermore, the recombinant plasmid is prepared by inserting the target sequence into a vector containing Ampicillin resistance, and the target sequence is shown as SEQ ID NO.4.

[0014] The reagents in the above kits can be pre-packed in PCR tubes or stored in brown tubes.

[0015] A reaction system for detecting jelly-like Paenibacillus containing the primer set, the reaction system has a total of 25 μL, and the components include 1×PCR Buffer, 0.04-0.06U / μL Taq DNA polymerase, 0.01-0.04U / μL UDG enzyme, 0.2-0.6μM forward primer, 0.2-0.6μM reverse primer, 0.05-0.3μM probe, 5μL nucleic acid to be tested, and the balance is ultrapure water.

[0016] More preferably, the concentration of the Taq DNA polymerase is 0.05 U / μL, the concentration of the UDG enzyme is 0.01 U / μL, the concentration of the forward primer is 0.4 μM, the concentration of the reverse primer is 0.4 μM, and the concentration of the probe is 0.2 μM.

[0017] More preferably, the 1×PCR Buffer comprises 45-55 mmol / L KCl, 8-12 mmol / L Tris-HCl, 1.4-1.6 mmol / L MgCl2, 90-110 μg / mL bovine serum albumin (BSA), and 190-210 μmol / L of dNTPs.

[0018] The kit will come with an instruction manual describing the usage scenarios and methods of the kit. The general contents are as follows:

[0019] (1) The present invention is applicable to the detection of jelly-like Paenibacillus in samples such as soil, microbial fertilizer products, and pure cultures, and also recommends a suitable nucleic acid extraction scheme;

[0020] (2) The reaction system of the present invention is 25 μL / test, of which 20 μL is premixed and 5 μL is template.

[0021] (3) After adding the negative control, positive control and the sample nucleic acid to the three reaction systems in order, the PCR reaction was performed on a real-time fluorescence quantitative PCR instrument according to the following procedures: decontamination, 50°C, 5 minutes, 1 cycle; pre-denaturation, 95°C, 5 minutes, 1 cycle; amplification, 95°C, 15 seconds, 60°C, 30 seconds, 40 cycles; fluorescence collection;

[0022] (4) Determine whether the nucleic acid of the sample to be tested contains Bacillus jelly-like according to the amplification curve and Ct value. The judgment rules are as follows:

[0023] a. If the Ct value of the test sample is greater than 40, the curve is a straight line or a slightly oblique line, and there is no "S"-shaped amplification curve, it can be determined that the sample does not contain jelly-like Bacillus or the content is below the detection limit;

[0024] b. The Ct value of the test sample is ≤40, and the curve is an "S"-shaped amplification curve, which can be judged that the sample contains jelly-like Bacillus;

[0025] If the Ct value of the test sample is between 35 and 40, the template concentration should be adjusted and the real-time fluorescence PCR should be repeated. If the Ct value of the sample after re-amplification is ≤40, it can be determined that the sample contains jelly-like Bacillus; if the Ct value of the sample after re-amplification is >40, it can be determined that the sample does not contain jelly-like Bacillus or the content is below the detection limit.

[0026] The advantages of the present invention include: the present invention introduces fluorescent quantitative PCR technology to detect jelly-like Bacillus, which can greatly reduce the detection time, and the detection operation is simple, which greatly reduces the professional requirements for personnel. The present invention omits the process of sample cultivation and electrophoresis, which greatly saves the detection time, and the sensitivity is better (up to 10 2 CFU / mL, equivalent to about 0.2×10 -4 cells / test), the specific and standard primers are consistent, with good stability, not prone to nonspecific amplification, and real-time detection can be achieved. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] The drawings described herein are used to provide a further understanding of the present invention, constitute a part of the present application, and do not constitute an improper limitation of the present invention. In the drawings:

[0028] Figure 1 is an amplification graph of the amplification results of candidate primer set 1 in Example 1;

[0029] Figure 2 is an amplification graph of the amplification results of candidate primer set 2 in Example 1;

[0030] Figure 3 This is the sensitivity amplification graph of nucleic acid of candidate primer set 1 reaction system for detecting jelly-like Paenibacillus;

[0031] Figure 4 This is the specific amplification diagram of nucleic acid of Paenibacillus jelly-like by the reaction system of candidate primer set 1;

[0032] Figure 5 This is the repeatability amplification diagram of the nucleic acid reaction system for detecting jelly-like Paenibacillus by candidate primer set 1;

[0033] Figure 6 is the standard curve of candidate primer set 1. DETAILED DESCRIPTION

[0034] The present invention will be described in detail below in conjunction with the accompanying drawings and specific embodiments. The exemplary embodiments and descriptions of the present invention are used to explain the present invention, but are not intended to limit the present invention.

[0035] Embodiment 1

[0036] Taqman primer design was performed using the gyrB gene sequence of Bacillus jelly-like as shown in SEQ ID NO.4 (GeneBank: FJ009520) as the target, and two groups of candidate primers were obtained. Candidate primer group 1 includes primers shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3. The 5' end of the primer shown in SEQ ID NO.3 is modified with a fluorescent group FAM, and its 3' end is modified with a quenching group BHQ1. Candidate primer group 2 includes primers shown in SEQ ID NO.5, SEQ ID NO.6, and SEQ ID NO.7. The 5' end of the primer shown in SEQ ID NO.7 is modified with a fluorescent group FAM, and its 3' end is modified with a quenching group BHQ1. The sequences are shown in Table 1.

[0037] Table 1 Specific primers for Paenibacillus jelly

[0038] ID Primer name sequence SEQ ID NO.1 Muc-Y1-F ACGAGGGCGGCATTATTTC SEQ ID NO.2 Muc-Y1-R ACATAGATCGGCGGTTGGTG SEQ ID NO.3 Muc-Y1-P TCGTCGAGCACTTGAACCAGAACCG SEQ ID NO.5 Muc-Y2-F GAGGTAAGTTCCCTTCCCGG SEQ ID NO.6 Muc-Y2-R TATACACTTCGGAGATCGAAGCG SEQ ID NO.7 Muc-Y2-P AGCTCGCCGACTGCTCTTCGAAGG

[0039] SEQ ID NO.4:

[0040] CATGCCGGCGGTAAATTCGGCGGCGAGGGCTATAAAGTTTCCGGCGGTCTG

[0041] CACGGCGTTGGTGTATCCGTCGTGAATGCTTTGTCCAAGAAGCTCGAGGTA

[0042] CAGGTCAAACGGGAAGGCAAGGTCTATCAGCAGGAATACCGCTGTGGAGC

[0043] GCCTCAGTATGACATCAAGGAGATCGGTGAATCCGAGATGACCGGTACCCA

[0044] GGTTACCTTCTGGCCGGATGAGGAGATCTTTACCGAAACGACGGAGTATGA

[0045] CTTCGACACCCTTCAATCGCGTATCCGTGAACTGGCGTTTTGAACAAGGG

[0046] CATTGAGATTGTGCTGACCGATGAGCGTACGGATATCTCCCAGACGTTCATT

[0047] TACGAGGGCGGCATATTATTCATTCGTCGAGCACTTGAACCAGAACCGGGA

[0048] ACCGGTTCACCAACCGCCGATCTATGTGGAAGGCGAGAAGGATCATATCCA

[0049] GGTTGAAGTTGCGCTTCCAGTAACGACAGCTATACGGAGAATTTTATTC

[0050] GTTCGCGAACATATCAATACCCATGAGGCGGAACCCACGAGTCCGGATT

[0051] CAAGAGCGCCCTTACCCGATTCTGAATGAGTACGCACGCAAATATAATGC

[0052] GATCAAAGAGGCGATGCAAACCTGTCCGGCGACGATGTCCGCGAAGGCC

[0053] TGACGGCGATTATCTCCGTGAAGATCCCGGATCCCCAGTTCGAGGGACAG

[0054] ACGAAGACGAAACTCGGCAACAGCGAGGTCCGCGGGATTGTGGAGTCTC

[0055] TGTTCGCTGAGAAGCTCGAAGAGTTCTTCAGGAGAACCCGGCGATCGCG

[0056] AAGAAGATCGTGGAGAAAGGCGTACAGGCGCAGCGTGCCCGTGAAGCGG

[0057] CGCGTAAGGCCCGTGAGCTCACCCGGCGCAAGAGTGCCCTGGAGGTAAGT

[0058] TCCCTTCCCGGCAAGCTCGCCGACTGCTCTTCGAAGGACGCTTCGATCTCC

[0059] GAAGTGTATCGTCGAAGGGGACTCCGCAGGCGGTTCCGCCAAGCAGGG

[0060] ACGCGACCGCCACTTCCAGGCGATCCTGCCGTTGCGCGGTAAGATTCTCA

[0061] ACGTTGAGAAAGCACGTCTCGACAAGATTTTGTCCAATGCGGAGATCCGT

[0062] GCGATCATTACCGCCTTGGGGACGGGAATCGGGGAGGATTTTGACATCTCC

[0063] AAAGCCCGCTACCACAAAATTATCATCATGACGGATGCGGACGTCGACGG

[0064] In order to compare the performance of the two sets of primers, 2 negative control experiments and 2 positive control experiments were set for each set of primers. The template of the positive control experiment was a recombinant plasmid containing the target sequence (hereinafter referred to as the recombinant plasmid), which was obtained by inserting the target sequence into a vector containing Ampicillin resistance. The positive control experiment reaction system was prepared with reference to Table 2. The negative control experiment reaction system did not add the recombinant plasmid containing the target sequence, and the rest was the same as Table 2.

[0065] Table 2 Concentration of each component

[0066]

[0067]

[0068] The reaction procedure for each experiment was carried out according to Table 3.

[0069] Table 3 Thermal cycle program

[0070]

[0071] The amplification results of candidate primer set 1 are as follows Figure 1 As shown, Figure 1 Curve 1 in the figure is a positive control experiment, and curve 2 is a negative control experiment. The amplification results of candidate primer set 2 are shown in Figure 2 As shown, Figure 2 Curve 1 in the figure is a positive control experiment, and curve 2 is a negative control experiment. According to the amplification results, candidate primer set 1 has an earlier peak and a higher plateau phase, which is better than candidate primer set 2. Candidate primer set 1 is selected as the detection primer set for subsequent experiments.

[0072] Embodiment 2

[0073] Take 10 8 CFU / mL of pure culture of Paenibacillus jelly was used as the basis, and 10 7CFU / mL, 10 6 CFU / mL, 10 5 CFU / mL, 10 4 CFU / mL, 10 3 CFU / mL, 10 2 U / mL and 10 1 CFU / mL seven gradient concentrations and extracted nucleic acids from them respectively to obtain 10 7 CFU / mL, 10 6 CFU / mL, 10 5 CFU / mL, 10 4 CFU / mL, 10 3 CFU / mL, 10 2 CFU / mL and 10 1 CFU / mL templates at seven concentrations. The detection reagent was prepared using the system in Example 1 (candidate primer set 1). Three replicates of each gradient of nucleic acid were loaded, with 5 μL of template loaded in each replicate, and the reaction was carried out according to the reaction procedure in Example 1.

[0074] The detection results using candidate primers are as follows Figure 3 As shown, curves 1-6 are respectively the concentration of 10 7 CFU / mL, 10 6 CFU / mL, 10 5 CFU / mL, 10 4 CFU / mL, 10 3 CFU / mL, 10 2 Amplification curves of the template at CFU / mL concentration. Amplification curves appeared in the three replicates of the six concentrations. Curve 7 corresponds to a concentration of 10 1 CFU / mL amplification results, 3 10 1 Only one of the replicates of CFU / mL showed an amplification curve. Curve 8 was the negative control, and no amplification curve appeared. The results showed that the detection sensitivity of the candidate primers was 10 2 CFU / mL (about 2×10 -5 ~2×10 -4 cells / tests). In addition, Figure 6 As shown, in 10 7 CFU / mL~10 2 Within the CFU / mL concentration range, this primer set has good linearity. 2 =0.999, indicating good accuracy and stability within this concentration range.

[0075] In summary, compared with the scheme provided in "A gyrB-targeted PCR for rapid identification of Paenibacillusmucilaginosus", candidate primer set 1 has better sensitivity and saves bacterial enrichment and electrophoresis time.

[0076] Embodiment 3

[0077] Nucleic acids were extracted from positive samples or pure cultures of Bacillus jelly, Bacillus cereus, Bacillus subtilis, Pseudomonas aeruginosa, Staphylococcus aureus, Salmonella, and Escherichia coli respectively by relevant standards or by equivalent commercial extraction kits. Before loading, the concentration of each nucleic acid to be tested needs to be adjusted to 20 to 300 ng / μL of the nucleic acid sample to be tested. A recombinant plasmid containing a target sequence at 10 pg / μL was used as a positive control, and ultrapure water was used as a negative control. The detection reaction system was constructed with reference to Example 1. The template addition volume of each experimental group was 5 μL, and each sample was repeated only once. The reaction was carried out according to the reaction procedure of Example 1.

[0078] The specificity test results of candidate primers are as follows Figure 4 As shown, 1 is the positive control, 2 is the jelly-like Bacillus, and 3 is the positive samples (or pure cultures) of other pathogens and the negative control. The results show that the nucleic acids of other pathogens and the negative controls were not amplified and were negative. Only the jelly-like Bacillus nucleic acid and the positive control were amplified, proving that the kit and primer set have good specificity.

[0079] Embodiment 4

[0080] Using the recombinant plasmid containing the target sequence at a concentration of 10 pg / μL as the template DNA, two parallel experiments were set up; at the same time, ultrapure water was used as the negative control, 20 parallel experiments were set up, and candidate primer group 1 was used as the primer. The reaction system of Example 1 was used for detection, and the template addition volume was 5 μL.

[0081] like Figure 5 As shown, the two curves indicated by 1 are positive controls, and the curves indicated by 2 are 20 negative controls. The results show that the repeatability is good, the primers will not spontaneously produce non-specific amplification, and the reaction system of the present invention has good stability.

[0082] The technical solutions provided by the embodiments of the present invention are introduced in detail above. Specific examples are used herein to illustrate the principles and implementation methods of the embodiments of the present invention. The description of the above embodiments is only applicable to help understand the principles of the embodiments of the present invention. At the same time, for those skilled in the art, according to the embodiments of the present invention, there will be changes in the specific implementation methods and application scopes. In summary, the content of this specification should not be understood as limiting the present invention.

Claims

1. A fluorescent quantitative PCR primer set for detecting jelly-like Bacillus, characterized in that: include: The forward primer Muc-Y1-F, whose sequence is shown in SEQ ID NO.1; the reverse primer Muc-Y1-R, whose sequence is shown in SEQ ID NO.2; the probe Muc-Y1-P, whose sequence is shown in SEQ ID NO.3; The 5' end of the probe is modified with a fluorescent group, and the 3' end is modified with a quenching group.

2. The fluorescent quantitative PCR primer set for detecting Paenibacillus jelly-like according to claim 1, characterized in that: The fluorescent group is a FAM group, and the quenching group is a BHQ1 group.

3. Use of the fluorescent quantitative PCR primer set according to claim 1 or 2 in preparing a reagent or a kit for detecting Paenibacillus gelatinosa.

4. A kit for detecting Paenibacillus jelly-like containing the fluorescent quantitative PCR primer set according to claim 1 or 2, characterized in that: The method comprises the primer set according to claim 1 or 2, PCR buffer, Taq DNA polymerase, UDG enzyme, negative control and positive control.

5. The kit for detecting jelly-like Paenibacillus according to claim 4, characterized in that: The negative control is ultrapure water; The positive control is a recombinant plasmid containing the target sequence at a concentration of 10-100 pg / μL.

6. The kit for detecting jelly-like Paenibacillus according to claim 5, characterized in that: The recombinant plasmid is prepared by inserting a target sequence into a vector containing Ampicillin resistance, and the target sequence is shown as SEQ ID NO.

4.

7. A reaction system for detecting Paenibacillus jelly-like containing the primer set according to claim 1 or 2, characterized in that: The reaction system has a total volume of 25 μL, and its components include 1×PCR Buffer, 0.04-0.06 U / μL Taq DNA polymerase, 0.01-0.04 U / μL UDG enzyme, 0.2-0.6 μM forward primer according to claim 1 or 2, 0.2-0.6 μM reverse primer according to claim 1 or 2, 0.05-0.3 μM probe according to claim 1 or 2, 5 μL of nucleic acid to be tested, and the balance is ultrapure water.

8. The reaction system for detecting jelly-like Paenibacillus according to claim 7, characterized in that: The 1×PCR Buffer comprises 45-55 mmol / L KCl, 8-12 mmol / L Tris-HCl, 1.4-1.6 mmol / L MgCl2, 90-110 μg / mL bovine serum albumin, and 190-210 μmol / L of dNTPs.

9. The reaction system for detecting jelly-like Paenibacillus according to claim 7, characterized in that: The concentration of the Taq DNA polymerase was 0.05 U / μL, the concentration of the UDG enzyme was 0.01 U / μL, the concentration of the forward primer was 0.4 μM, the concentration of the reverse primer was 0.4 μM, and the concentration of the probe was 0.2 μM.

10. A method for detecting jelly-like Paenibacillus using the reaction system of any one of claims 7 to 9, characterized in that: The steps include: (1) After adding negative control, positive control and sample nucleic acid to the three reaction systems according to any one of claims 7 to 9 in order, PCR reaction was performed on a real-time fluorescence quantitative PCR instrument according to the following procedures: decontamination, 50°C, 5 minutes, 1 cycle; pre-denaturation, 95°C, 5 minutes, 1 cycle; amplification, 95°C, 15 seconds, 60°C, 30 seconds, 40 cycles; fluorescence collection; (2) Determine whether the nucleic acid of the sample to be tested contains jelly-like Bacillus according to the amplification curve and Ct value. The judgment rules are as follows: a. If the Ct value of the test sample is greater than 40, the curve is a straight line or a slightly slanted line, and there is no "S"-shaped amplification curve, it can be determined that the sample does not contain jelly-like Paenibacillus or the content is below the detection limit; b. The Ct value of the test sample is ≤40, and the curve is an "S"-shaped amplification curve, which can be judged that the sample contains jelly-like Bacillus; If the Ct value of the test sample is between 35 and 40, the template concentration should be adjusted and the real-time fluorescence PCR should be repeated; if the Ct value of the sample after re-amplification is ≤40, it can be determined that the sample contains Bacillus jelly-like; if the Ct value of the sample after re-amplification is >40, it can be determined that the sample does not contain Bacillus jelly-like or the content is below the detection limit.

Images