Molecular marker related to sucrose content of peanut seed kernels, KASP primer group and application of molecular marker and KASP primer group

Abstract

The invention discloses a molecular marker related to the sucrose content of peanut seed kernels, a KASP primer group and application of the molecular marker and the KASP primer group, and belongs to the technical field of molecular genetic breeding. The molecular marker disclosed by the invention is positioned at 108307340bp of a B03 chromosome, and the polymorphism of the molecular marker is G / A. The molecular marker related to the sucrose content of the peanut seed kernels is provided, a KASP primer group and a KASP analysis technology are developed according to the molecular marker, and the molecular marker can be used for detecting the sucrose content of the peanut seed kernels. When the molecular marker and the KASP primer group thereof are used for early identification and genetic breeding or genetic resource improvement of peanut strains, the peanut breeding period can be shortened, the genetic resource improvement process is accelerated, and new genetic resources and theoretical basis are provided for molecular assisted breeding.

Description

Technical Field

[0001] The invention relates to the technical field of molecular genetic breeding, and in particular to a molecular marker related to the sucrose content of peanut kernels, a KASP primer set and applications thereof. Background Art

[0002] Sucrose is the main source of sweetness in peanuts, affects the taste of peanuts, and is the main quality indicator of edible peanuts. The sucrose content of peanut kernels is a quantitative trait controlled by multiple genes. Studying the main quantitative trait loci that control sucrose content and developing related molecular markers will be beneficial to the breeding research of edible peanuts. Most existing studies have used RIL populations to locate QTLs related to sucrose content. For example, Ren Jingyue used genetic populations to locate 3 QTL loci related to the soluble sugar content in mature peanut kernels; Li Weitao used RIL populations to detect 16 QTL loci related to sucrose content; Li et al. used a RIL population containing 140 families to locate 12 QTL loci related to sucrose content; Guo Jianbin et al. used a recombinant inbred line population (RIL) constructed with Xuhua 13 and Zhonghua 6 as parents as materials, and detected 10 QTLs for sucrose content. The development of molecular markers using located QTLs has gradually become a research hotspot. Zhang Xiaojun used BSA-seq to locate a major QTL related to soluble sugar content on peanut chromosome B06, and developed molecular markers related to soluble sugar content on both sides of the QTL. Guo Junjia used an F2 segregation population containing 831 families constructed by hybridizing Jitianhua No. 1 and PI478819, identified 6 candidate intervals related to sucrose content, and developed KASP markers for two of them. Therefore, fully exploring the variation sites related to sucrose content and developing related molecular markers and detection methods can provide a theoretical basis for the subsequent exploration of genes related to sugar content and molecular-assisted breeding. Summary of the invention

[0003] The purpose of the present invention is to provide a molecular marker related to the sucrose content of peanut kernels, a KASP primer set and its application, so as to solve the problems existing in the above-mentioned prior art. The present invention provides a molecular marker related to the sucrose content of peanut kernels, and develops a KASP primer set and a KASP analysis technology based on the molecular marker, which can be used to detect the sucrose content of peanut kernels. The molecular marker and its KASP primer set are used for early identification and genetic breeding or genetic resource improvement of peanut strains, which can shorten the peanut breeding cycle, accelerate the genetic resource improvement process, and provide new genetic resources and theoretical basis for molecular assisted breeding.

[0004] To achieve the above object, the present invention provides the following solutions:

[0005] The present invention provides a molecular marker related to the sucrose content of peanut kernels, wherein the molecular marker is located at 108307340 bp of chromosome B03, and its polymorphism is G / A;

[0006] The nucleotide sequences of the upstream 200 bp and downstream 200 bp of the molecular marker are shown in SEQ ID NO.1.

[0007] The present invention also provides the use of the above molecular marker in any of the following:

[0008] A1. Detect the sucrose content of peanut kernels;

[0009] A2. Early identification of peanut varieties with high sucrose content in kernels;

[0010] A3. Peanut molecular genetic breeding;

[0011] A4. Improvement of peanut germplasm resources;

[0012] A5. Conduct genetic analysis and fine positioning of genes related to sucrose content in peanut kernels.

[0013] The present invention also provides a KASP primer set for detecting the above molecular markers, the primer set comprising a forward primer 16-F1 as shown in SEQ ID NO.2, a forward primer 16-F2 as shown in SEQ ID NO.3, and a universal reverse primer 16-R as shown in SEQ ID NO.4.

[0014] The present invention also provides a reagent for detecting the above molecular marker, wherein the reagent comprises the above KASP primer set.

[0015] The present invention also provides a kit for detecting the above molecular markers, wherein the kit comprises the above KASP primer set.

[0016] The present invention also provides the use of the above-mentioned KASP primer set or the above-mentioned reagent or the above-mentioned kit in any of the following items:

[0017] B1. Detect the sucrose content of peanut kernels;

[0018] B2. Early identification of peanut varieties with high sucrose content in kernels;

[0019] B3. Conduct genetic analysis and fine positioning of genes related to sucrose content in peanut kernels.

[0020] The present invention also provides a KASP analysis method for detecting the sucrose content of peanut kernels, comprising the following steps:

[0021] Using the DNA of the plant to be tested as a template, the above-mentioned KASP primer set is used for PCR amplification, and the genotype of the plant to be tested is determined according to the fluorescence result;

[0022] When the fluorescence color is blue, the genotype of the plant to be tested is determined to be AA; when the fluorescence color is red, the genotype of the plant to be tested is determined to be GG;

[0023] The sucrose content in the kernels of plants with genotype AA was higher than that in plants with genotype GG.

[0024] Optionally, the reaction system for PCR amplification is: 0.86 μL template DNA, 5 μL 2×AQP main component mixture, 0.14 μL KASP primer set, 4 μL ddH2O;

[0025] In the reaction system, the working concentrations of 16-F1 and 16-F2 were both 0.168 μM, and the working concentration of 16R was both 0.42 μM.

[0026] Optionally, the reaction program of the PCR amplification is: 95°C, 10 minutes; 95°C for 20 seconds, 61°C for 40 seconds for 1 cycle; continue for 10 cycles, with the annealing temperature decreasing by 0.6°C in each cycle; 95°C for 20 seconds, 55°C for 40 seconds, for 31 cycles.

[0027] The present invention discloses the following technical effects:

[0028] The present invention provides a molecular marker related to the sucrose content of peanut kernels, and develops a KASP primer set and a KASP analysis technology based on the molecular marker, which can accurately distinguish peanut strains with high sucrose content from peanut strains with low sucrose content. The molecular marker and its KASP primer set are used for early identification and genetic breeding or genetic resource improvement of peanut strains, which can shorten the peanut breeding cycle, accelerate the genetic resource improvement process, and provide new genetic resources and theoretical basis for molecular assisted breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0030] Figure 1 It is the Manhattan plot of the KASP molecular marker screening process in Example 1;

[0031] Figure 2 This is the genotyping test result of the test material in Example 2. DETAILED DESCRIPTION

[0032] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0033] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0034] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0035] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0036] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0037] Example 1 Screening of molecular markers

[0038] 1. Test materials: 103 natural populations of peanut (numbered A-001-A-103), originating from the germplasm bank preserved by the Peanut Genetic Breeding Innovation Team of Hebei Agricultural University.

[0039] 2. Data collection: The test materials were planted in the Qingyuan Experimental Station of Hebei Agricultural University in Baoding, Hebei Province. Ten planting holes were planned for each row, with single hole and single seed sowing. The row length was 1.5m and the distance between rows was 41cm. The planting was carried out according to the standard management process of the local field. Peanut pods were harvested after maturity, and 20 plump kernels were selected for each strain. The sucrose content in the kernels was detected by liquid chromatography.

[0040] 3. Data statistics and analysis: Statistical analysis of the collected data was performed using Excel to obtain the phenotypic characteristics of the group, including its minimum, maximum, mean, standard deviation, skewness, and kurtosis.

[0041] Tassel 5.0 software was used to conduct a comprehensive genome-wide association study (GWAS) of the SNPs of sucrose content in peanuts using the statistical model framework, namely the general linear model (GLM). The screening criteria of the minimum allele frequency (MAF) threshold not exceeding 0.05 were adopted, and the level of significant association between the trait and SNP was set to a p value less than 1.0×10^-3. Subsequently, the Manhattan plot was drawn using R language software. The stably detected SNPs were used to use the Browse A.ipaensis (https: / / legacy.peanutbase.org / gbrowse_araip1.0) in the Peanut base website, and candidate genes were screened in the "Tifrunner" genome sequence according to the LD decay distance within the 200kb interval upstream and downstream of the stably detected SNPs site.

[0042] 4. Screening results: Manhattan map Figure 1 As shown, it can be seen that a SNP associated with the sucrose content of peanuts is located on chromosome 13 (B03) ("Tifrunner" genome). After annotation of the SNP, it was found that the SNP is located at 108307340bp on chromosome 13 (B03), and its polymorphism is G / A.

[0043] The SNP was named AX-176816968, and the nucleotide sequence consisting of 200 bp upstream and 200 bp downstream of the SNP was shown in SEQ ID NO.1:

[0044] GATGAACCAACTTCCAATTATGAAACTTTCCTCCCAAACCATGAACCTTTCCTTCACCATCACCTCCTGATGAAGCCCCCACGCAGGAATTGAGAGATCTTGAATCTCATATCCCAAGGCGACACGAGGAAGATGAAAAGAAGTTTGCGGAGTTAAGAGCAAAAATGGCTATCATGGTAGAAGCCGTTAGCAACATGGT[G / A]TCCTCCCGACTAAGCCTAAGCAACCAAGGC ACTCCCATTGACGAATGTGGAGAAGCAACCAAGGAGTATAGTAAGGGAGTGAGTTTAG AGCTTCAAGGTGAAGAAGAGGAGTTGAAGAAAGAATTGCCACAAGGAAAGGAAGATG AGACAATTGAGCCGGAATGAGTGGTTGAAGACCTAGGAGATGTTGGAAGTCCATG.

[0045] Molecular markers were developed based on this SNP, and a KASP primer set was designed. The primer sequences are shown in Table 1.

[0046] Table 1 KASP primer set sequences

[0047]

[0048] Example 2 Functional verification of molecular markers

[0049] 1. Test materials: 32 peanut materials were randomly selected from the germplasm bank preserved by the Peanut Genetic Breeding Innovation Team of Hebei Agricultural University.

[0050] 2. Testing process:

[0051] The DNA of the test plant is extracted, and the PCR amplification reaction is performed using the DNA as a template, and the fluorescence results are read.

[0052] The PCR amplification reaction system was as follows: the total volume was 10 μL: 0.86 μL genomic DNA (50 ng), 5 μL 2× AQP main component mixture (Beijing Jiacheng Biotechnology Co., Ltd., China), 0.14 μL KASP primer set (the working concentrations of 16-F1 and 16-F2 were 0.168 μM, and the working concentration of 16R was 0.42 μM), and 4 μL ddH2O.

[0053] PCR amplification reaction program: 95°C, 10 min; 95°C for 20 s, 61°C for 40 s as one cycle; continue for 10 cycles, with the annealing temperature decreasing by 0.6°C in each cycle; 95°C for 20 s, 55°C for 40 s for 31 cycles.

[0054] PCR amplification reactions were performed on an ABI QuantStudio 6 machine (ABI Life Technologies, CA, USA).

[0055] 3. Test results

[0056] Fluorescence results such as Figure 2 As shown, the genotype of the plant with blue fluorescence is AA, the genotype of the plant with red fluorescence is GG, and the plant with orange fluorescence failed the test due to poor DNA quality. The statistical results of the genotype and seed kernel sucrose content of the remaining plants are shown in Table 2. The seed kernel sucrose content of the plant with genotype AA is 5.53%-7.91%, and the average sucrose content is 6.38%; the seed kernel sucrose content of the plant with genotype GG is 2.01%-3.67%, and the average sucrose content is 3.18%. The seed kernel sucrose content of the plant with genotype AA is significantly higher than that of the plant with genotype GG, and the genotype and phenotypic data are consistent.

[0057] Table 2 Statistical results of sucrose content in each plant genotype and seed kernel

[0058]

[0059]

[0060] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A molecular marker related to the sucrose content of peanut kernels, characterized in that: The molecular marker is located at 108307340bp on chromosome B03, and its polymorphism is G / A; The nucleotide sequences of the upstream 200 bp and downstream 200 bp of the molecular marker are shown in SEQ ID NO.

1.

2. Use of the molecular marker according to claim 1 in any of the following: A1. Detect the sucrose content of peanut kernels; A2. Early identification of peanut varieties with high sucrose content in kernels; A3. Peanut molecular genetic breeding; A4. Improvement of peanut germplasm resources; A5. Conduct genetic analysis and fine positioning of genes related to sucrose content in peanut kernels.

3. A KASP primer set for detecting the molecular marker according to claim 1, characterized in that: The primer set includes a forward primer 16-F1 as shown in SEQ ID NO.2, a forward primer 16-F2 as shown in SEQ ID NO.3, and a universal reverse primer 16-R as shown in SEQ ID NO.

4.

4. A reagent for detecting the molecular marker according to claim 1, characterized in that: The reagent comprises the KASP primer set according to claim 3.

5. A kit for detecting the molecular marker according to claim 1, characterized in that: The kit comprises the KASP primer set according to claim 3.

6. Use of the KASP primer set according to claim 3, the reagent according to claim 5, or the kit according to claim 6 in any of the following: B1. Detect the sucrose content of peanut kernels; B2. Early identification of peanut varieties with high sucrose content in kernels; B3. Conduct genetic analysis and fine positioning of genes related to sucrose content in peanut kernels.

7. A KASP analysis method for detecting sucrose content in peanut kernels, characterized in that: The following steps are involved: Using the DNA of the plant to be tested as a template, using the KASP primer set described in claim 3 to perform PCR amplification, and determining the genotype of the plant to be tested based on the fluorescence result; When the fluorescence color is blue, the genotype of the plant to be tested is determined to be AA; when the fluorescence color is red, the genotype of the plant to be tested is determined to be GG; The sucrose content in the kernels of plants with genotype AA was higher than that in plants with genotype GG.

8. The KASP analysis method according to claim 7, characterized in that The reaction system of the PCR amplification is: 0.86 μL template DNA, 5 μL 2×AQP main component mixture, 0.14 μL KASP primer set, 4 μL ddH2O; In the reaction system, the working concentrations of 16-F1 and 16-F2 were both 0.168 μM, and the working concentration of 16R was both 0.42 μM.

9. The KASP analysis method according to claim 7, characterized in that: The reaction program of the PCR amplification is: 95°C, 10 minutes; 95°C for 20 seconds, 61°C for 40 seconds as one cycle; continue for 10 cycles, with the annealing temperature decreasing by 0.6°C in each cycle; 95°C for 20 seconds, 55°C for 40 seconds, for 31 cycles.

Images