Application of ABC transporter family gene OsABCA3 in plant breeding regulation

Abstract

The invention discloses an application of an ABC transporter family gene OsABCA3 in regulation and control of plant breeding. Belongs to the field of plant genetic engineering. According to the application of the ABC transport protein family gene OsABCA3 in plant breeding regulation and control, the amino acid sequence of the protein encoded by the ABC transport protein family gene OsABCA3 is shown as SEQ ID No: 2. According to the invention, the ABC transporter gene OsABCA3 is knocked out in rice, so that the Cd absorption in a knockout plant under Cd stress is obviously reduced compared with that of a wild type plant, the Cd content of grains in the knockout plant planted in Cd-polluted soil is obviously reduced compared with that of the wild type plant, but the content of essential elements in the grains and the yield of rice are not negatively influenced; therefore, a new candidate gene resource is provided for creating safe rice with low Cd grains, and a potential repair method is also provided for rice Cd pollution treatment.

Description

Technical Field

[0001] The present invention relates to the field of plant genetic engineering, in particular to ABC transporter family genes OsABCA3 Application in plant breeding regulation. Background Art

[0002] With the accelerated advancement of urbanization, cultivated land has been seriously polluted by heavy metals, especially cadmium (Cd), which has become an important problem that needs to be solved for the sustainable development of agriculture. Cd is a highly toxic heavy metal element that is not essential for plants and humans. It is identified as a Class I human carcinogen by the International Agency for Research on Cancer (IARC). The deposition of industrial waste gas, irrigation with mining and smelting wastewater, emission of automobile exhaust, and modern process technologies such as the burning of garbage and crop straw are some of the main sources of Cd pollution. In addition, the excessive application of Cd-containing fertilizers and organic fertilizers in agricultural production has also caused serious pollution to the environment. The Cd-containing waste gas in the atmosphere infiltrates into farmland with rainwater, further aggravating the heavy metal pollution of the soil. These pollution sources lead to the enrichment of Cd in farmland soil, posing great risks to farmland ecosystems and food security.

[0003] After plants absorb Cd from the soil through their roots, Cd will be transported to the aboveground parts of the plants, especially the edible parts of cereal crops. Compared with other heavy metals, Cd is more likely to enter the food chain from the soil, causing great harm to food and human health. Excessive accumulation of Cd in plants will interfere with the nutritional balance of plants, damage proteins, DNA and cell membranes, and induce the accumulation of toxic reactive oxygen, which will have an adverse effect on the growth and yield of crops. Rice is the most important food crop, and more than 60% of the population relies on rice as their staple food. Its production safety is highly valued. Studies have shown that rice is more likely to absorb Cd than other cereal crops, so rice has become the main way for people to ingest Cd, with a contribution rate of up to 56%, and for people who like rice, it is increased to 65%. Therefore, studying the absorption, transportation and accumulation mechanism of rice for Cd and discovering its related regulatory genes are of great significance for the cultivation of low Cd accumulation rice varieties, food security and human health.

[0004] ABC transporters are a large class of widely existing conserved proteins that play a very important role in plants. In the biological world, the currently known ABC protein family includes 8 subfamilies from ABCA to ABCI, while plants lack the ABCH subfamily. ABC transporters usually contain two characteristic domains, namely the trans-membrane domain (TMD) and the nucleotide binding domain (NBD). The two domains work together to drive the transport of various substrates on the biological membrane through the energy released by ATP hydrolysis. These substrates include small inorganic or organic molecules, such as amino acids, sugars, nucleosides, vitamins and metal ions, as well as large organic compounds, such as peptides, lipid molecules, oligonucleotides and polysaccharides. ABC proteins regulate the transmembrane transport of substrates, regulate key physiological processes in plants, such as hormone and lipid metabolism, stomatal opening and closing, and metal ion transport, thereby improving their ability to cope with various biological or abiotic stresses and enabling plants to adapt to the ever-changing environment.

[0005] However, the specific genes of the ABC transporter family in plants and how to use the ABC transporter family genes to avoid the accumulation of Cd in plants, especially in edible parts, need further study. Summary of the invention

[0006] The purpose of the present invention is to overcome the shortcomings and deficiencies of the prior art and provide a novel ABC transporter family gene OsABCA3 Application in plant breeding regulation.

[0007] The purpose of the present invention is achieved through the following technical solutions: ABC transporter family genes OsABCA3 Application in plant breeding regulation, the ABC transporter family gene OsABCA3 The amino acid sequence of the encoded protein is shown in SEQ ID No: 2.

[0008] Furthermore, the ABC transporter family gene OsABCA3 The nucleotide sequence is shown in SEQ ID No: 1.

[0009] Furthermore, the plant breeding regulation refers to knocking out the ABC transporter family gene in the plant OsABCA3 , improve plant tolerance to Cd, increase plant biomass, and reduce the Cd content in plant seeds.

[0010] Furthermore, the plant is a grass plant; furthermore, it is at least one of wheat, corn and rice; and furthermore, it is rice.

[0011] ABC transporter family genes OsABCA3 Application in improving plant tolerance to Cd and / or preparing / cultivating plant varieties with low Cd accumulation in seeds.

[0012] Furthermore, the plant is a grass plant; furthermore, it is at least one of wheat, corn and rice; and furthermore, it is rice.

[0013] ABC transporter family genes OsABCA3 Application of knockout vectors in improving plant tolerance to Cd and / or preparing / cultivating plant varieties with low Cd accumulation in grains.

[0014] Furthermore, the ABC transporter family gene OsABCA3 Knockout vectors are targeted OsABCA3 Knockout vector for two gene targets; the two targets are U3 and U6a ; gRNA vector U3 The target primers are: Forward primer: 5′-GGCAGCAAGAACGCCACGCTCACC -3′; and Reverse primer: 5′- AAACGGTGAGCGTGGCGTTCTTGC -3′; gRNA vector U6a The target amplification primers are: Forward primer: 5′- GCCGCGAACTCCACTCCGGTAGCT -3′; and Reverse primer: 5'-AAACAGCTACCGGAGTGGAGTTCG -3'.

[0015] Furthermore, the plant is a grass plant; furthermore, it is at least one of wheat, corn and rice; and furthermore, it is rice.

[0016] A method for enhancing plant tolerance to Cd and / or reducing the Cd content in plant seeds, comprising: OsABCA3 Knockout steps.

[0017] Furthermore, the plant is a grass plant; furthermore, it is at least one of wheat, corn and rice; and furthermore, it is rice.

[0018] Compared with the prior art, the present invention has the following advantages and effects: (1) The present invention involves the ABC transporter family gene OsABCA3 Knockout in rice, so that under Cd stress, OsABCA3The growth of the knockout strains was significantly better than that of the wild type, and the Cd content in the grains of the knockout strains was significantly lower than that of the wild type. At the same time, the knockout strains had no obvious adverse effects on rice yield-related traits and the content of essential metal elements. OsABCA3 It can be used as a potential candidate gene to breed rice varieties with low Cd accumulation to reduce the threat of Cd pollution to food safety and human health, and also provide a potential remediation method for rice Cd pollution control.

[0019] (2) The present invention knocks out OsABCA3 , which can effectively improve the tolerance of rice to Cd and reduce the Cd content in rice grains, providing candidate gene resources for low-Cd molecular breeding of rice and Cd pollution control. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 Rice ABC transporter family gene OsABCA3 Gene information diagram; the blank rectangle and the black line in the middle of the diagram are the 5' untranslated region (UTR), the blank pentagon represents the 3'UTR, the black rectangle represents the exon, the black line represents the intron, and the double arrows below the diagram represent the coding sequence (CDS) region of the gene.

[0021] Figure 2 Schematic diagram of the empty GFP vector pCAMBIA35s-EGFP for protein subcellular localization.

[0022] Figure 3 The subcellular localization observation of OsABCA3, a member of the rice ABC transporter family, in rice protoplasts. (a) is the result of subcellular localization in rice protoplasts; (b) is the result of subcellular localization in tobacco mesophyll cells. The excitation wavelength and observation wavelength of GFP observation are 488 nm and 507 nm, respectively, emitting green fluorescence; the excitation wavelength and emission wavelength of the membrane marker protein OsRac3-Mcherry are 587 nm and 610 nm, respectively, emitting red fluorescence; the scale of the OsABCA3 subcellular localization map is 130 μm.

[0023] Figure 4 Rice ABC transporter family gene OsABCA3 Relative expression detection results under different Cd concentrations (0, 1, 10, 100 μM CdCl2), 3 independent biological replicates; t Test; * stands for P <0.05; ** represents P <0.01.

[0024] Figure 5 Rice ABC transporter family gene OsABCA3 The relative expression detection results of different culture time under the condition of final concentration of 10 μM CdCl2, where the experiment was repeated three times independently; t Test; * stands for P <0.05; ** represents P <0.01.

[0025] Figure 6 Rice ABC transporter family gene OsABCA3 Relative expression detection results under different metal element treatments (100 μM); CK is the blank control, and rice Actin1 Gene( Os10g0510000 ) was used as an internal reference gene, and the experiment was repeated three times independently; t Test; * stands for P <0.05.

[0026] Figure 7 Rice ABC transporter family gene OsABCA3 The relative expression detection results in different growth stages of rice and various tissues of rice; Actin1 Gene( Os10g0510000 ) was used as an internal reference gene, and the experiment was repeated three times independently.

[0027] Figure 8 Schematic diagram of gene overexpression vector and knockout vector; (a) is the map of rice gene overexpression vector pOX (containing 5×flag tag); (b) is the map of CRISPR / gRNA intermediate vector; (c) is the map of pYLCRISPR / Cas9-MH binary expression vector.

[0028] Figure 9 for OsABCA3 Gene overexpression lines ( OE-A3-1 , OE-A3-2 ), knockout strains ( cas-a3-1 , cas-a3- 2 ) and wild type (ZH11) and statistical graphs of growth traits; (a) shows the growth of ZH11 after 7 days of culture under hydroponic conditions without Cd and containing 10 μM CdCl2 and 100 μM CdCl2. OsABCA3 Overexpression lines ( OE-A3-1 , OE-A3-2 ), knockout strains ( cas-a3-1 , cas-a3-2 ) and wild type (ZH11), the scale bar is 5 cm; (b) after 7 days of cultivation under Cd (100 μM CdCl2; +Cd) or Cd-free (-Cd) conditions,OsABCA3 Overexpression lines ( OE-A3-1 , OE-A3-2 ), knockout strains ( cas-a3-1 , cas-a3-2 ) and wild type (ZH11); (c) after 7 days of cultivation under Cd (100 μM CdCl2; +Cd) or Cd-free (-Cd) conditions. OsABCA3 Overexpression lines ( OE-A3-1 , OE-A3-2 ), knockout strains ( cas-a3-1 , cas-a3-2 ) and wild type (ZH11); (d) fresh weight statistics of ZH11 after 7 days of cultivation under Cd (100 μM CdCl2; +Cd) or Cd-free (-Cd) conditions. OsABCA3 Overexpression lines ( OE-A3-1 , OE-A3-2 ), knockout strains ( cas-a3- 1 , cas-a3-2 ) and wild type (ZH11) dry weight statistics; the experiment was repeated three times independently; t Test; * stands for P <0.05.

[0029] Figure 10 After being cultured in a Cd solution with a final concentration of 100 μM for 7 days, OsABCA3 Gene overexpression lines ( OE- A3-1 , OE-A3-2 ), knockout strains ( cas-a3-1 , cas-a3-2 ) and wild-type rice (ZH11) test results; (a) is the Cd content determination results in the aboveground part and roots, (b) is the Cd content determination results in the xylem sap; the experiment was repeated three times independently. t Test, * represents P <0.05, ** indicates P <0.01.

[0030] Figure 11 In the experiment of Cd-contaminated soil cultivation OsABCA3 Gene overexpression lines ( OE-A3-1 , OE-A3-2 ), knockout strains ( cas-a3-1 , cas-a3-2 ) and wild type (ZH11) and yield trait statistical results; (a) is the Cd-contaminated soil cultivation experiment OsABCA3 Gene overexpression lines ( OE-A3-1 , OE-A3-2 ), knockout strains ( cas-a3-1 ,cas-a3-2 ) and wild type (ZH11), the scale bar is 20 cm; (b–e) are the phenotypic observation results of the Cd-contaminated soil cultivation experiment OsABCA3 Gene overexpression lines ( OE-A3-1 , OE-A3-2 ), knockout strains ( cas-a3-1 , cas-a3-2 ) and wild type (ZH11) at maturity; 3 independent biological replicates; t Test; * stands for P <0.05, ** indicates P <0.01.

[0031] Figure 12 In the experiment of Cd-contaminated soil cultivation OsABCA3 Gene overexpression lines ( OE-A3-1 , OE-A3-2 ), knockout strains ( cas-a3-1 , cas-a3-2 ) and wild-type rice (ZH11) grains; (a) is the Cd content analysis result, (b) is the essential metal element content analysis result; 3 independent biological replicates; t Test; * stands for P <0.05; ** represents P <0.01. DETAILED DESCRIPTION

[0032] The present invention is further described in detail below in conjunction with embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0033] The experimental methods in the following examples that do not specify specific experimental conditions are usually carried out according to conventional experimental conditions or according to the experimental conditions recommended by the manufacturer. Unless otherwise specified, the construction of the vectors (including gene knockout vectors, overexpression vectors, and subcellular localization vectors) mentioned in the examples is carried out according to the conventional genetic engineering field operation methods. The sequences of the backbone vector pCAMBIA-1300, promoter elements (including 35S, Ubi), reporter genes (including GFP), etc. used are all sequences that have been published on relevant websites or databases in the field of genetic engineering (https: / / cambia.org and https: / / www.ncbi.nlm.nih.gov); pCAMBIA35s-eGFP can be obtained from conventional commercial channels. The materials and reagents used, unless otherwise specified, are reagents and materials obtained from commercial channels. The chemical reagents used in the examples are all imported or domestic analytically pure.

[0034] The pOx vector was provided by Academician Liu Yaoguang from the State Key Laboratory of Conservation and Utilization of Subtropical Agricultural Bioresources, South China Agricultural University. The pOx vector has been used in “Li YH, Yang YQ, Liu Y, Li CX, Zhao YH, Li ZJ, Liu Y, Jiang DG, Li J, Zhou H, Chen JH, Zhuang CX, Liu ZL. Overexpression of OsAGO1b induces adaxially rolled leaves by affecting leaf abaxialsclerenchymatous cell development in rice. Rice (NY), 2019, 12(1): 60. " published in the article.

[0035] pYLCRISPR / Cas9-MH and CRISPR / gRNA vectors were provided by Academician Liu Yaoguang of the State Key Laboratory of Conservation and Utilization of Subtropical Agricultural Bioresources, South China Agricultural University. pYLCRISPR / Cas9-MH and CRISPR / gRNA have been made public in the article “Zeng Dongchang, Ma Xingliang, Xie Xianrong, Zhu Qinlong, Liu Yaoguang. Methods for construction of plant CRISPR / Cas9 multi-gene editing vector and mutation analysis. Science China: Life Sciences. 2018, 48(7): 783-794. doi: 10.1360 / N052018-00069.”

[0036] Unless otherwise specified in the examples, the rice used was wild-type Zhonghua 11 rice, which was commercially available.

[0037] Example 1 (1) Rice ABC transporter family genes OsABCA3 Structure OsABCA3 The retrieval number in the GenBank database (https: / / www.ncbi.nlm.nih.gov) is Os08g0398000. The gene is located on chromosome 8 of rice. Its DNA length is 6144 bp (SEQ ID No: 1), and it contains 17 exons and 16 introns (e.g. Figure 1 The predicted encoded protein amino acid sequence length is 968 amino acids (SEQID No: 2). OsABCA3 The mRNA length of the gene is 3229 bp, and the CDS length is 2907 bp (SEQ ID No: 3).

[0038] (2) Subcellular localization analysis of OsABCA3, a member of the rice ABC transporter family According to the conventional operation method in the field of genetic engineering, green fluorescent protein (GFP) was fused to the C-terminus of OsABCA3 protein. OsABCA3 The gene was inserted into the empty vector (pCAMBIA35s-eGFP) containing the 35S promoter for protein subcellular localization (see the schematic diagram of pCAMBIA35s-eGFP). Figure 2 The transient expression recombinant vector driven by the 35S promoter was obtained between the 35S promoter and eGFP ( p35S::OsABCA3-GFP ), transform rice protoplasts and tobacco. In addition, the GFP empty vector ( p35S::GFP ; i.e. pCAMBIA35s-eGFP), cytoplasmic membrane fluorescent marker protein vector ( p35S::OsRac3-Mcherry ) as a control, and observed the fluorescence localization. The results showed that in both rice and tobacco, OsABCA3 In cells with fusion expression vectors, the green fluorescence of GFP is mainly distributed in the cell membrane and cytoplasm; while the green fluorescence signal emitted by the GFP empty vector control is distributed throughout the cell (results are shown in Figure 3 as shown).

[0039] (3) OsABCA3 qRT-PCR analysis of gene responses to Cd stress, other metal stresses, and hormone treatment The rice seedlings of Zhonghua 11 (ZH11) were hydroponically cultured in an artificial climate chamber. Kimura B nutrient solution was replaced every 3 days. The conditions were set as 12 h light, 28°C, 12 h dark, 25°C, and 60% relative humidity. The rice seedlings cultured for 30 days were treated with Cd (CdCl2 was added to Kimura B nutrient solution to make the final concentration of CdCl2 0, 1, 10, and 100 μM, respectively, and cultured for 1 day; in the same way, the rice seedlings were cultured with CdCl2 solution with a final concentration of 10 μM for 0, 3, 6, 9, 12, 24, 48, 60, and 72 h; in the same way, the rice seedlings were cultured with MnSO4, AlCl3·6H2O, MgSO4, ZnSO4, and FeSO4 solutions with a final concentration of 100 μM for 1 day; The aboveground part and root were selected as materials. Conventional methods in the field of genetic engineering were used. According to the operating manual of the reagent company, Trizol reagent from Genstar (China) was used to extract RNA from rice tissues. StarScript Ⅲ All-in-one kit from Genstar (China) was used to reverse transcribe cDNA. Then Realstar Fast SYBR qPCR Mix quantitative PCR kit from Genstar (China) was used to quantify the expression of cDNA in the aboveground part and root of rice. OsABCA3 The expression of the gene was detected by qRT-PCR. The forward primer of qRT-PCR detection was 5'-AGACGAACTCCACTCCGGTA -3', and the reverse primer was 5'-TGAGCGAACTCCTTGAACCC -3'. The reaction procedure of qRT-PCR was: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 10s, 60℃ annealing for 10s, 72℃ extension for 30s / kb, 35 cycles; 72℃, 5 min. In addition, OsABCA3 Rice Actin1 ( Os10g0510000 ) was used as the internal reference gene, and the primers used were 5′-AGACGAACTCCACTCCGGTA -3′ (forward primer) and 5′-TGAGCGAACTCCTTGAACCC -3′ (reverse primer).

[0040] The results showed that after the rice seedlings were cultured in CdCl2 solutions with different concentrations (0, 1, 10, 100 µM) for 1 day, the roots and aboveground parts of the seedlings were OsABCA3 The relative expression levels of the gene in both the aboveground and root parts of rice showed an upward trend, indicating that OsABCA3 The genes showed obvious responses to Cd stress and had concentration-dependent effects (e.g. Figure 4 The results showed that the Cd (10 µM) treatment time of rice seedlings grown in hydroponics for 30 days was different. The results showed that with the extension of Cd treatment time, the aboveground and root of rice were OsABCA3 The expression levels of α, β and β in rice were generally higher than those in the control (0 h). In addition, in the aboveground part of rice, its expression level reached the highest peak value 24 h after Cd treatment, while in the root, its expression level reached the highest peak value 3 h after Cd treatment (e.g. Figure 5 as shown).

[0041] The results showed that under the stress of Mn and Mg metal elements, the root OsABCA3 The expression levels of the genes in the control group were significantly upregulated, and under the stress of Al, Zn, and Fe, OsABCA3 There was no significant difference in gene expression between the control group and theFigure 6 This result suggests that OsABCA3 Genes may play an important role in the plant's response and detoxification mechanisms to specific metal elements, thus providing a basis for further research. OsABCA3 The functions of genes in the regulation of metal transport and accumulation in rice provide valuable clues.

[0042] (4) OsABCA3 Analysis of spatiotemporal expression patterns of genes in rice The Zhonghua 11 (ZH11) rice seedlings were hydroponically cultured in an artificial climate chamber, and the Kimura B nutrient solution was replaced every 3 days. The conditions were set at 12 h light, 28°C, 12 h dark, 25°C, and 60% relative humidity. Samples were taken at different stages (seedling stage, tillering stage, heading stage, and maturity stage) and different parts (roots, aboveground parts, stems, leaves, etc.) of the wild type rice Zhonghua 11.

[0043] The conventional methods in the field of genetic engineering were used according to the operating manual of the reagent company. The RNA of rice tissues was extracted using Trizol reagent from Genstar (China), and cDNA was obtained by reverse transcription using StarScript III All-in-one kit from Genstar (China). Then, Realstar Fast SYBR qPCRMix quantitative PCR kit from Genstar (China) was used to quantify the RNA in the materials of each part. OsABCA3 The expression level of qRT-PCR was detected. The forward primer of qRT-PCR detection was 5'-AGACGAACTCCACTCCGGTA -3', and the reverse primer was 5'-TGAGCGAACTCCTTGAACCC -3'. The reaction procedure of qRT-PCR was: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 10s, 60℃ annealing for 10s, 72℃ extension for 30s / kb, 35 cycles; 72℃, 5 min. In addition, OsABCA3 Rice Actin1 ( Os10g0510000 ) was used as the internal reference gene, and the primers used were 5′-AGACGAACTCCACTCCGGTA -3′ (forward primer) and 5′-TGAGCGAACTCCTTGAACCC -3′ (reverse primer).

[0044] The results show that OsABCA3 The gene is expressed in all growth stages and multiple tissues of rice; OsABCA3 The gene maintains a high expression level in root and leaf tissues throughout the growth period of rice (e.g. Figure 7 These results suggest that OsABCA3The gene is not only involved in the transport process in rice roots, but may also be involved in the transport or redistribution of Cd in various tissues in the aboveground part.

[0045] (5) OsABCA3 Obtaining gene overexpression strains Conventional methods in the field of genetic engineering were used to extract RNA from rice leaf tissue according to the method in Example 1, and reverse transcribed to obtain single-stranded cDNA. The high-fidelity enzyme Phanta Max Super-Fidelity DNA Polymerase from Vazyme (China) was then used to amplify the cDNA containing OsABCA3 The double-stranded cDNA fragment of the full-length CDS sequence of the gene was amplified by PCR with denaturation at 95°C for 5 min, denaturation at 95°C for 15 s, annealing at 58°C for 15 s, and extension at 72°C for 35 cycles with an extension time of 1 kb / 30 s according to the length of the CDS sequence, and a final extension at 72°C for 5 min.

[0046] OsABCA3 The primers used for PCR were: 5'-ATGGAGCTCCTGAGCGGGG-3' (forward primer) and 5'-TCATCTTGCTGCTGTGACCT -3' (reverse primer). After sequencing verification, the gene containing OsABCA3 The double-stranded cDNA fragment of the full-length CDS sequence of the gene was inserted into the overexpression vector pOx containing the Ubi promoter stored in our laboratory (such as Figure 8 In (a), the Ubi promoter-driven OsABCA3 Gene overexpression vector, i.e. pUbi::OsABCA3 , and then transformed into ZH11 rice. The transformed seedlings and their offspring were planted and screened to obtain OsABCA3 Two independent stable homozygous lines of gene overexpression, namely OE-A3-1 , OE-A3-2 .

[0047] (6) OsABCA3 Obtaining gene knockout strains Using conventional genetic engineering methods, using intermediate vectors (such as Figure 8 (b)) and gene knockout vectors (as shown in Figure 8 As shown in (c) in the figure, construct OsABCA3 Knockout vector for two target sites (T1 and T2) of the gene. OsABCA3 T1 of gRNA vector in gene knockout strain (i.e. U3) The target primers were: 5'-GGCAGCAAGAACGCCACGCTCACC -3' (forward primer) and 5'-AAACGGTGAGCGTGGCGTTCTTGC -3' (reverse primer); T2 (i.e. U6a ) The target amplification primers were: 5'- GCCGCGAACTCCACTCCGGTAGCT -3' (forward primer) and 5'- AAACAGCTACCGGAGTGGAGTTCG -3' (reverse primer). After transformation of Zhonghua 11, the amplification primers were obtained through planting and screening. OsABCA3 Two independent stable homozygous lines of gene knockout, namely cas-a3-1 , cas-a3-2 .

[0048] right OsABCA3 The target sites in the gene knockout strains were sequenced and compared. The results showed that cas-a3-1 In the strain, there is an 11 bp deletion at target site 1 (T1), and a 1 bp insertion at target site 2 (T2); cas-a3-2 In this strain, there is a 1 bp insertion at target site 1 (T1) and a 2 bp deletion at target site 2 (T2). OsABCA3 The coding region sequence (CDS) in the gene knockout strain underwent a frameshift mutation, resulting in premature termination of the amino acid sequence of the encoded protein during translation.

[0049] (7) Statistics of growth characteristics and Cd content analysis of hydroponic seedlings Will OsABCA3 Gene overexpression lines ( OE-A3-1 , OE-A3-2 ), knockout strains ( cas-a3-1 , cas-a3- 2) and ZH11 were used as materials for hydroponic culture. After 30 days of culture, the plants were treated with different concentrations of CdCl2 (0, 10, 100 μM). After 7 days of culture, the plant phenotypes were observed and the physiological traits and Cd concentrations in various parts were determined. The method for determining Cd concentration is as follows: the rice samples were washed with water, dried in a 60°C oven, and the samples were weighed (0.05-1.0 g for the aboveground part, 0.01-0.1 g for the root part, and 1.0 g for the grain. The grains needed to be shelled in advance, and the brown rice was ground into powder before weighing; the overexpression strain, knockout strain, and wild type groups needed to weigh the same amount). Put it in a glass digestion cup, add 10 mL of mixed acid (concentrated nitric acid and perchloric acid were prepared into a mixed acid in a volume ratio of 87:13) in the cup, and digest it in a graphite digestion furnace. The digestion was terminated when the sample volume in the cup was ≤ 0.5 mL. After the sample has cooled, add 2 mL of 1% dilute nitric acid and mix well. Rinse the glass cup with ultrapure water for 3 to 5 times, filter and adjust the volume (Note: the volume of grain samples is adjusted to 15.0 mL, the volume of aboveground samples is adjusted to 15.0 mL, and the volume of root samples is adjusted to 50.0 mL). Use inductively coupled plasma optical emission spectrometry (ICP-OES) to determine the Cd content.

[0050] Under Cd treatment, two overexpression lines ( OE-A3-1 , OE-A3-2 ) were weaker than the wild type, while the two knockout lines ( cas-a3-1 , cas - a3 -2) were stronger than the wild type, and this difference in growth became more obvious as the Cd concentration increased (e.g. Figure 9 ). The plant height, fresh weight and dry weight of rice seedlings under 0 and 100 μM Cd treatments were further measured and statistically analyzed. The results showed that under no Cd treatment, there were no significant differences in the growth traits of the overexpression and knockout lines compared with the wild type; but under Cd treatment, the plant height, fresh weight and dry weight of the overexpression line were significantly reduced compared with the wild type, at least 31.48%, 11.00% and 12.10%, respectively, while these growth traits of the knockout line were significantly increased compared with the wild type, at least 8.34%, 15.36% and 15.27%, respectively (as shown in Figure 2). Figure 9 (b), (c) and (d) in the figure).

[0051] The results of Cd content determination showed that the overexpression strain ( OE-A3-1 , OE-A3-2 ) showed an increasing trend in the aboveground and root Cd contents compared with the wild type, with an increase of 12.76% and 4.13% in the aboveground and 9.86% and 10.96% in the root of the two lines; however, the two knockout lines ( cas-a3-1, cas-a3-2 ) were significantly lower than those of the wild type, with a decrease of 20.12% and 18.82% in the aboveground part and 17.21% and 12.60% in the root (e.g. Figure 10 (a)), which indicates that the knockout OsABCA3 The gene can significantly reduce the absorption of Cd by rice.

[0052] Further testing OsABCA36 The Cd content in the xylem sap of each strain was found to be OsABCA3 There was no significant difference in the Cd content in the xylem sap of the gene overexpression and knockout strains compared with the wild type, which indicated that OsABCA3 The gene may not be directly involved in the redistribution of Cd in the rice shoots through the xylem pathway (e.g. Figure 10 (as shown in (b) in the figure).

[0053] (8) Cultivation experiment in Cd-contaminated soil Select OsABCA3 Gene overexpression lines ( OE-A3-1 , OE-A3-2 ), knockout strains ( cas-a3-1 , cas- a3-2 ) and wild rice ZH11. When the rice seedlings grew to the four-leaf stage, the seedlings with the same growth were selected and planted in Cd-contaminated soil (the Cd content in the soil was 0.33 mg / kg (pH 5.02), slightly higher than the risk screening level (0.3 mg / kg, pH ≤ 5.5); the contents of other heavy metals in the soil, such as As, Hg, Pb and Zn, did not exceed the corresponding risk screening levels; GB15618-2018). Rice cultivation followed the conventional guidelines for field rice production, and trait statistics and metal element determination were performed after the rice was fully mature.

[0054] The results show that OsABCA3 The growth of the gene overexpression strain and knockout strain showed no significant difference compared with the wild type, indicating that OsABCA3 Overexpression or knockout of the gene had no significant effect on the growth of rice grown in Cd-contaminated soil (e.g. Figure 11 (a). Further OsABCA3 The yield traits of the gene overexpression strains, knockout strains and wild-type ZH11 were statistically analyzed, and the results showed that OsABCA3 There were no significant differences in plant height, effective tiller number, fruit setting rate and single plant yield between the overexpression and knockout lines and the wild type (e.g. Figure 11 These results show that OsABCA3 Overexpression or knockout of the gene had no significant negative impact on the agronomic traits of rice.

[0055] right OsABCA3 The Cd content and essential metal element content in the grains (brown rice) of the overexpression and knockout strains of ZH11 and the wild-type rice ZH11 at the mature stage were determined. The results showed that the Cd content in the brown rice of the two overexpression strains did not show significant differences compared with the wild type; however, the Cd content in the brown rice of the two knockout strains was significantly reduced compared with the wild type, by at least 21.59%, indicating that OsABCA3 Overexpression of the gene had limited effect on the Cd content in rice grains, while knockout of the gene may have reduced the accumulation of Cd in rice grains to some extent (e.g. Figure 12 (as shown in (a) in the figure).

[0056] When examining the content of essential metal elements (Fe, Mn, Cu, Zn, Mg) in brown rice, it was found that OsABCA3 The contents of these metal elements in the overexpression and knockout lines of were not significantly different from those in the wild type, indicating that the two genes mainly and specifically affect the Cd content in rice brown rice, but have no adverse effects on the contents of essential metal elements (such as Figure 12 (as shown in (b) in the figure).

[0057] The above results show that OsABCA3 Genes provide important candidate gene resources for low Cd molecular breeding of rice. OsABCA3 Gene knockout is expected to effectively reduce the Cd content in grains, while ensuring the yield and nutritional quality of rice, thereby providing a potential genetic engineering strategy for the prevention and control of Cd pollution in rice.

[0058] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. ABC transporter family genes OsABCA3 Application in plant breeding regulation, characterized in that, ABC transporter family genes OsABCA3 The amino acid sequence of the encoded protein is shown in SEQ ID No:

2.

2. The use according to claim 1, characterized in that: ABC transporter family genes OsABCA3 The nucleotide sequence is shown in SEQ ID No:

1.

3. The use according to claim 1, characterized in that: The plant breeding regulation refers to knocking out ABC transporter family genes in plants OsABCA3 , improve plant tolerance to Cd, increase plant biomass, and reduce the Cd content in plant seeds.

4. The use according to claim 1, characterized in that: The plant is preferably a grass plant.

5. The use according to claim 4, characterized in that: The plant is at least one of wheat, corn and rice.

6. ABC transporter family genes OsABCA3 Use of the method for improving plant tolerance to Cd and / or preparing / cultivating plant varieties with low Cd accumulation in seeds, characterized in that: ABC transporter family genes OsABCA3 The amino acid sequence of the encoded protein is shown in SEQ ID No:

2.

7. ABC transporter family genes OsABCA3 Use of a knockout vector in improving plant tolerance to Cd and / or preparing / cultivating plant varieties with low grain Cd accumulation, characterized in that: ABC transporter family genes OsABCA3 The amino acid sequence of the encoded protein is shown in SEQ ID No:

2.

8. The use according to claim 7, characterized in that: ABC transporter family genes OsABCA3 The nucleotide sequence is shown in SEQ ID No: 1; ABC transporter family genes OsABCA3 Knockout vectors are targeted OsABCA3 Knockout vector for two gene targets; the two targets are U3 and U6a .

9. The use according to claim 8, characterized in that: gRNA vector U3 The target primers are: Forward primer: 5′-GGCAGCAAGAACGCCACGCTCACC -3′; and Reverse primer: 5′- AAACGGTGAGCGTGGCGTTCTTGC -3′; gRNA vector U6a The target amplification primers are: Forward primer: 5′- GCCGCGAACTCCACTCCGGTAGCT -3′; and Reverse primer: 5'-AAACAGCTACCGGAGTGGAGTTCG -3'.

10. A method for enhancing plant tolerance to Cd and / or reducing Cd content in plant seeds, characterized in that: ABC transporter family genes OsABCA3 Knockout steps; ABC transporter family genes OsABCA3 The amino acid sequence of the encoded protein is shown in SEQ ID No: 2.

Images