Application of LECT2 as diagnosis and treatment target of hepatic ischemia reperfusion injury

Abstract

The invention discloses application of LECT2 as a diagnosis and treatment target of hepatic ischemia reperfusion injury. According to the present invention, the Print method operation patient sample is detected to discover that the expression of the LECT2 in the hepatic ischemia reperfusion injury is up-regulated; on the basis, a liver ischemia reperfusion injury model is constructed by knocking out a mouse through the LECT2 gene, and a result shows that the liver ischemia reperfusion injury of the mouse is obviously reduced by knocking out the LECT2 gene and transferring the LECT2-shRNA into the LECT2 gene, and the liver ischemia reperfusion injury of the mouse is aggravated by LECT2 recombinant protein; it is shown that inhibition of expression of LECT2 is beneficial to improvement or treatment of hepatic ischemia injury; furthermore, the invention further finds that liver injury can be relieved by inhibiting the combination of LECT2 and Tie1; the LECT2 / Tie1 signal channel can also be used as a target spot for treating the liver ischemia reperfusion injury.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the application of LECT2 as a diagnostic and therapeutic target for liver ischemia-reperfusion injury. Background Art

[0002] Hepatic ischemia-reperfusion injury (IRI) is a complex cascade of events triggered by an ischemic attack. During ischemia, reactive oxygen species (ROS) are overproduced, oxidative stress occurs, and organelle damage and cell death occur. When blood flow is restored, cell damage and cell death are aggravated after the recovery of oxygen delivery and shear stress, forming an overwhelming inflammatory response, significantly damaging the endothelial and epithelial barriers, leading to IRI. Severe IRI and inflammatory response further lead to acute respiratory distress syndrome (ARDS) or systemic inflammatory response syndrome (SIRS), which is the core of the pathogenesis of multiple organ failure (MOF). To date, ischemia-reperfusion treatment options are only palliative treatments that can relieve patients' discomfort but cannot improve the underlying condition.

[0003] Hepatic ischemia-reperfusion injury (IRI) is a major problem in liver transplantation, trauma, hypovolemic shock, and hepatectomy, and has been a hot topic of research in the past few decades. After the introduction of vascular control technology during liver surgery, intermittent complete vascular occlusion (Pringle method) was used to reduce intraoperative blood loss. Hepatic ischemia-reperfusion is considered to be one of the key factors affecting postoperative morbidity and mortality, leading to liver dysfunction and failure, and affecting distal organs such as kidneys, intestines, lungs, etc. The mechanism of hepatic ischemia-reperfusion injury is very complex and is still not fully understood, and there is a lack of effective intervention methods in clinical practice.

[0004] Leukocyte cell-derived chemotaxin 2 (LECT2) is a secretory protein with a molecular weight of about 16KD, which was originally reported as a neutrophil chemotactic factor. LECT2 plays a role in a variety of physiological activities and diseases, such as sepsis, diabetes, liver cancer, non-alcoholic fatty liver disease, and maintenance of hematopoietic stem cell homeostasis. However, its functional regulation of endothelial cell function and whether it plays an important role in IRI are still unclear. Summary of the invention

[0005] The purpose of the first aspect of the present invention is to provide the use of LECT2 as a target in the preparation of a diagnostic and / or therapeutic product for ischemia-reperfusion injury.

[0006] The second aspect of the present invention aims to provide use of a reagent for detecting LECT2 in preparing a diagnostic product for ischemia-reperfusion injury.

[0007] The second aspect of the present invention aims to provide use of a LECT2 inhibitor in the preparation of a medicament for preventing and / or treating ischemia-reperfusion injury.

[0008] The technical solution adopted by the present invention is:

[0009] In a first aspect, the present invention provides the use of LECT2 as a target in the preparation of a product for diagnosing and / or treating ischemia-reperfusion injury.

[0010] In some embodiments of the present invention, the diagnosis is an early diagnosis; preferably within 0 to 48 hours after reperfusion injury; more preferably within 0 to 24 hours.

[0011] In some embodiments of the present invention, the ischemia-reperfusion injury includes: renal ischemia injury and / or ischemia-reperfusion injury, myocardial ischemia injury and / or post-ischemia-reperfusion injury, liver ischemia injury and / or ischemia-reperfusion injury.

[0012] The second aspect of the present invention is the use of a reagent for detecting LECT2 in the preparation of a diagnostic product for ischemia-reperfusion injury.

[0013] In some embodiments of the present invention, the ischemia-reperfusion injury includes: renal ischemia injury and / or ischemia-reperfusion injury, myocardial ischemia injury and / or post-ischemia-reperfusion injury, liver ischemia injury and / or ischemia-reperfusion injury.

[0014] In some embodiments of the present invention, the reagent for detecting LECT2 includes a reagent for detecting the expression level of LECT2.

[0015] In some embodiments of the present invention, the reagent for detecting the expression level of LECT2 includes a reagent for detecting the expression level of LECT2 gene and / or protein.

[0016] In some embodiments of the present invention, the reagent for detecting the expression level of the LECT2 gene is a reagent for detecting the expression level of the LECT2 gene by at least one method selected from sequencing technology, nucleic acid hybridization technology, nucleic acid amplification technology and immunoassay.

[0017] In some embodiments of the present invention, the reagent for detecting the expression level of LECT2 protein is a reagent for detecting the expression level of LECT2 protein by at least one method selected from the group consisting of Western-Blot, enzyme-linked immunosorbent assay, immunohistochemistry, immunocytochemistry, flow cytometry, ultraviolet spectrophotometry, high performance liquid chromatography, colorimetry, mass spectrometry, protein chip, immunoprecipitation and immunoblotting.

[0018] In some embodiments of the present invention, the reagents include primers, probes or antibodies.

[0019] In some embodiments of the present invention, the sequence of the primer is:

[0020] Forward: GCTGGTCTGATTTCTACCGCA;

[0021] Reverse:CCAGAGAGAGACAAGATC.

[0022] In some embodiments of the present invention, the product is a kit, a chip, a test paper or a reagent.

[0023] The third aspect of the present invention provides use of a LECT2 / Tie1 signaling pathway inhibitor or a pharmaceutically acceptable salt thereof in the preparation of a medicament for preventing and / or treating ischemia-reperfusion injury.

[0024] In some embodiments of the present invention, the ischemia-reperfusion injury includes ischemia injury and / or ischemia-reperfusion injury.

[0025] Preferably, the ischemic injury and / or ischemic reperfusion injury includes renal ischemic injury and / or ischemic reperfusion injury, myocardial ischemic injury and / or post-ischemic reperfusion injury, and liver ischemic injury and / or ischemic reperfusion injury.

[0026] The LECT2 / Tie1 signaling pathway inhibitor includes substances that inhibit LECT2 and / or Tie1 gene expression, silence or knock out LECT2 and / or Tie1 genes, and / or substances that inhibit the content and / or activity of LECT2 and / or Tie1 proteins; and / or substances that inhibit the binding between LECT2 and Tie1.

[0027] In some embodiments of the present invention, the LECT2 / Tie1 signaling pathway inhibitor comprises at least one of shRNA, siRNA, dsRNA, sgRNA, miRNA, cDNA, antisense RNA / DNA, small molecule compounds, peptides, and antibodies.

[0028] In some embodiments of the invention, the antibody comprises an antibody, antibody fusion or antibody fragment targeting LECT2 and / or Tie1.

[0029] In some embodiments of the present invention, the targeting sequence of the shRNA is:

[0030] GCTAACATATGTGCCAGCAAATCTT.

[0031] In some embodiments of the present invention, the shRNA sequence includes a sense strand and an antisense strand, and the sense strand and the antisense strand are respectively:

[0032] Justification strand: GCTAACATATGTGCCAGCAAATCTT;

[0033] Antisense strand: AAGATTTGCTGGCACATATGTTAGC.

[0034] In some embodiments of the present invention, the agent inhibiting the binding of LECT2 and Tiel comprises at least one of a Tie1 extracellular region fragment recombinant protein, a Tie Ig3 segment recombinant protein, a LECT2 fragment or full-length recombinant protein, and a LECT2 blocking antibody.

[0035] In some embodiments of the present invention, the pharmaceutically acceptable salts include, but are not limited to, pharmaceutically acceptable acid addition salts, such as salts of inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, metaphosphoric acid, nitric acid and sulfuric acid, and salts of organic acids such as acetic acid, benzenesulfonic acid, benzoic acid, citric acid, ethanesulfonic acid, fumaric acid, gluconic acid, glycolic acid, isethionic acid, lactic acid, lactobionic acid, maleic acid, malic acid, methanesulfonic acid, succinic acid, p-toluenesulfonic acid and tartaric acid; salts of pharmaceutically acceptable bases are ammonium salts, alkali metal salts (such as sodium salts and potassium salts) and alkaline earth metal salts (such as magnesium salts and calcium salts) and salts of tromethamine (2-amino-2-hydroxymethyl-1,3-propanediol), diethanolamine, lysine or ethylenediamine.

[0036] In some embodiments of the present invention, the medicament contains an effective dose of a LECT2 inhibitor or a pharmaceutically acceptable salt thereof.

[0037] In some embodiments of the present invention, the inhibitor further comprises a mixture of shRNA, siRNA, dsRNA, sgRNA, miRNA, cDNA, antisense RNA / DNA and a transfection reagent, or a viral vector comprising shRNA, siRNA, dsRNA, sgRNA, miRNA, cDNA, antisense RNA / DNA, etc., and the active ingredients of the LECT2 inhibitor are transferred into the subject by transduction.

[0038] Preferably, the virus includes but is not limited to adeno-associated virus (AAV).

[0039] In some embodiments of the present invention, the effective dose of the LECT2 inhibitor is about 0.1×10 8 ~1×10 14 vg / piece.

[0040] In the present invention, the effective dose of the drug can be reasonably adjusted according to the actual situation and the judgment of the clinician. For different species, it can be reasonably adjusted based on the drug dose conversion formula or ratio between different species in the art. The administration time of the drug can be reasonably adjusted according to the actual situation of the patient and the judgment of the clinician; wherein the administration time is preferably within 0 to 48 hours after reperfusion injury; more preferably within 0 to 24 hours.

[0041] In some embodiments of the present invention, the drug further comprises a pharmaceutically acceptable excipient.

[0042] In some embodiments of the present invention, the pharmaceutically acceptable excipients include: at least one of a diluent, a binder, a wetting agent, a lubricant, a disintegrant, a solvent, an emulsifier, a solubilizer, a preservative, a pH regulator, an osmotic pressure regulator, a surfactant, a coating material, an antioxidant, an antibacterial agent or a buffer.

[0043] In some embodiments of the present invention, the dosage form of the drug includes at least one of a suspension, granules, capsules, powders, tablets, emulsions, solutions, pills, injections, suppositories, enemas, aerosols, patches or drops.

[0044] In some embodiments of the present invention, the administration route of the drug includes at least one of intravenous injection, intraperitoneal injection, intramuscular injection, oral administration, sublingual administration, nasal administration, aerosol administration or transdermal administration.

[0045] The beneficial effects of the present invention are:

[0046] The present invention detected samples of patients undergoing Pringle surgery and found that LECT2 was upregulated in liver ischemia-reperfusion injury; on this basis, a liver ischemia-reperfusion injury model was constructed by LECT2 gene knockout mice, and the results showed that LECT2 gene knockout and transfer of AAV-LECT2-shRNA significantly reduced liver ischemia-reperfusion injury in mice, while LECT2 recombinant protein aggravated liver ischemia-reperfusion injury in mice; indicating that inhibiting the expression of LECT2 is helpful to improve or treat liver ischemia injury; LECT2 has been proven to be a good target for diagnosing and treating liver ischemia-reperfusion injury. Moreover, the present invention further found that liver injury can be alleviated by inhibiting the combination of LECT2 and Tie1; it also shows that the LECT2 / Tie1 signaling pathway can also be used as a target for treating liver ischemia-reperfusion injury; it is applied to the research and development and preparation of drugs for treating liver ischemia-reperfusion injury. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 During the Pringle maneuver, LECT2 expression levels in patients were upregulated. Figure 1 Middle A: Schematic diagram of the Pringle maneuver procedure; Figure 1 Middle B: Serum LECT2 concentration in patients undergoing Pringle maneuver; Figure 1 Middle C: LECT2 mRNA levels in the liver of patients undergoing Pringle maneuver surgery;

[0048] Note: Number of patients: 5; Mean±SEM.*p<0.05.

[0049] Figure 2 The expression level of LECT2 was upregulated in liver IRI mice. Figure 2 Middle A: Schematic diagram of the experimental design, specifically the liver of C57BL / 6J mice was clamped in triplicate for 1 hour and then reperfused. Serum and liver tissue samples were collected at different time points to measure LECT2 expression. Figure 2 Middle B: LECT2 concentration in serum; Figure 2 Middle C: LECT2 mRNA levels in liver.

[0050] Note: n=6 / group. Mean±SEM.*p<0.05,***p<0.001,****p<0.0001.

[0051] Figure 3 For Lect2 - / - The liver IRI of mice was reduced. - / - Livers of mice and their littermate controls were clamped on the hepatic pedicle for 1 h and then reperfused. Serum and liver tissue samples were collected at different time points to measure LECT2 expression. Figure 3 Middle A: Mouse body weights were measured at the indicated times; Figure 3 Middle B: Liver HE staining shows necrosis. Scale bar, 100 mm; Figure 3 Middle C: Statistics of liver necrosis area; Figure 3 Middle D- Figure 3 Middle G: Serum alanine aminotransferase (ALT) (D), aspartate aminotransferase (AST) (E), creatinine (Cr) (F), and blood urea nitrogen (BUN) (G) levels were measured respectively;

[0052] Note: n=6 / group. Mean±SEM.*p<0.05,**p<0.01.

[0053] Figure 4 rLECT2 can aggravate hepatic IRI. Figure 4 Middle A: Schematic diagram of the experimental design, specifically the liver of C57BL / 6J mice was clamped for 1 hour, and then perfusion was restored. LECT2 recombinant protein was injected intravenously. Serum and liver tissue samples were collected at different time points to measure the expression of LECT2. Figure 4Middle B: The body weights of mice were measured at the indicated times. Figure 4 Middle C: HE staining of liver shows necrosis. Scale bar, 100 mm. Figure 4 Middle D: Statistics of liver necrosis area. Figure 4 Middle E- Figure 4 Middle H: Serum alanine aminotransferase (ALT) (E), aspartate aminotransferase (AST) (F), creatinine (Cr) (G) and blood urea nitrogen (BUN) (H) levels were measured respectively.

[0054] Note: n=6 / group. Mean±SEM.*p<0.05.

[0055] Figure 5 AAV-Lect2-shRNA reduces liver IRI. The liver of C57BL / 6J mice was clamped for 1 hour and then reperfused. AAV-Lect2-shRNA was injected intravenously. Serum and liver tissue samples were collected at different time points to measure the expression of Lect2. Figure 5 Middle A: The body weights of mice were measured at the indicated times. Figure 5 Middle B: HE staining of liver shows necrosis. Scale bar, 100 mm. Figure 5 Middle C: Statistics of liver necrosis area. Figure 5 Middle D- Figure 5 In the middle, G is the determination of serum alanine aminotransferase (ALT) (D), aspartate aminotransferase (AST) (E), creatinine (Cr) (F) and blood urea nitrogen (BUN) (G) levels. n = 6 / group. Mean ± SEM. *p < 0.05, **p < 0.01.

[0056] Figure 6 Tie1-Ig3 reduces liver injury in the abdominal aorta ligation hepatic IRI model. Figure 6 Middle A: Determination of serum alanine aminotransferase (ALT) level; Figure 6 Middle B: Serum aspartate aminotransferase (AST) level was measured; Note: Mean±SEM. *p<0.05, **p<0.01. DETAILED DESCRIPTION

[0057] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0058] Materials and methods

[0059] Patients and clinical specimens:

[0060] Liver tissue and serum samples were obtained from 5 patients who underwent Pringle's maneuver in the Department of Hepatobiliary and Pancreatic Hernia Surgery, Zhaoqing First People's Hospital. Informed written consent was obtained from all subjects. The study protocol on human subjects conformed to the principles of the Declaration of Helsinki and was approved by the Clinical Research Ethics Committee of Zhaoqing Hospital.

[0061] mouse:

[0062] Lect2 knockout mice (Lect2 - / - ) was generated by CRISPR / Cas9 strategy, and its genotype has been identified previously (see reference LECT2, a Ligand for Tie1, Plays a Crucial Role in Liver Fibrogenesis). Briefly, the extracted genomic DNA was PCR amplified using specific primers (forward: 5'-ATAGCCAGGGGGACTATGTTA-3' (SEQ ID NO.1), reverse: 5'-ATATAGTCATAGGTGCAC AGCA-3' (SEQ ID NO.2)).

[0063] C57BL / 6 mice were obtained from the Guangdong Medical Laboratory Animal Center, Guangzhou, China. All experiments were performed on male mice unless otherwise stated. The mice were housed under specific pathogen-free conditions with a standard 12-h light-dark cycle and had unlimited access to food and water. All mice used in the studies were healthy and immunocompetent. The animal study protocol complied with the U.S. Public Health Service policy on the use of laboratory animals and was approved by the Ethics Committee on the Care and Use of Animals of Southern Medical University.

[0064] Construction of liver ischemia-reperfusion model:

[0065] To establish the liver ischemia-reperfusion model, 6-8 week old male mice were fasted for 12 h and anesthetized with isoflurane. A midline abdominal incision (3-5 cm) was made, and the intestines were gently moved aside to expose the portal vein. The liver hilum was separated from the surrounding tissue, and the portal triad (hepatic artery, portal vein, and bile duct) of the left and middle lobes was occluded using microvascular clamps. Successful clamping was confirmed by the whitening of the valve leaflets. After 60 min of ischemia, reperfusion was initiated by removing the clamps, resulting in an immediate color change in the middle and left lateral lobes. The incision was closed using a double-layer suture technique, and disinfectant was applied to the surgical area to reduce the risk of infection. The mice were then placed in heated, clean cages. Samples were collected at 0.5 h, 12 h, 24 h, and 48 h of reperfusion time. Recombinant human LECT2 (rLECT2) and AAV-LECT2 shRNA were prepared (for details, see references LECT2, a Ligand for Tie1, Plays a Crucial Role in Liver Fibrogenesis). rLECT2 (10 mg / kg, intravenous injection) or AAV9-LECT2 shRNA (Cat. No. 46081404) (1×10 11 Mice were treated with 100 μg / mouse (vg / mouse, intravenous injection; Shanghai Han Biotechnology Co., Ltd., China, two weeks before hepatic ischemia-reperfusion). Serum samples and liver tissues were collected at different time points for subsequent analysis.

[0066] Sequence of control shRNA:

[0067] Sense strand: TTCTCGAACGTGTCCGT (SEQ ID NO. 3);

[0068] Antisense strand: ACGTGACACGTTCGAGAA (SEQ ID NO. 4);

[0069] The sense and antisense sequences of LECT2 shRNA are as follows:

[0070] Sense strand: GCTAACATATGTGCCAGCAAATCTT (SEQ ID NO. 5);

[0071] Antisense strand: AAGATTTGCTGGCACATATGTTAGC (SEQ ID NO. 6).

[0072] Histological analysis of liver necrosis by HE staining:

[0073] Liver tissues were collected at 0.5 h, 12 h, 24 h, and 48 h after reperfusion and then fixed in 10% neutral buffered formalin for 24 h. Tissues were processed, embedded in paraffin, and cut into 2.5 μm thick sections. Sections were stained with hematoxylin and eosin (HE) according to standard protocols. Stained sections were examined under a light microscope to assess liver morphology and determine necrotic areas. Necrosis was quantified using image analysis software, and the percentage of necrotic area relative to the total liver tissue area was calculated based on histological features such as loss of cell structure, eosinophilia, and cell debris.

[0074] Abdominal aorta ligation hepatic ischemia-reperfusion model:

[0075] The abdominal aorta of mice was clamped for 20 minutes and the samples were collected 24 hours after recanalization. The mice in both groups were 8-week-old male C57 mice. Tie1-Ig3 protein (preparation method see LECT2, a Ligand for Tie1, Plays a Crucial Role in Liver Fibrogenesis) 10 mg / kg was intraperitoneally injected, and the control group mice were intraperitoneally injected with an equal amount of GST protein.

[0076] qRT-PCR:

[0077] Total RNA from human patient liver and mouse liver was extracted and reverse transcribed. The resulting cDNA was used for PCR with SYBR Green Master PCR Mix (Precision Biology). All PCR reactions were performed in triplicate using the QuantStudio 3qPCR System (ThermoScientific, QuantStudio 3). The data for each sample were normalized to the endogenous GAPDH control. The relative quantification of each target gene compared to the calibrator was expressed as 2-ΔΔCt.

[0078] The primers for qPCR are as follows:

[0079] Human LECT2:

[0080] Forward: GCTGGTCTGATTTCTACCGCA (SEQ ID NO. 7),

[0081] Reverse: CCAGAGAGAGACAAGATC (SEQ ID NO. 8);

[0082] Mouse LECT2:

[0083] Forward: GGACGTGACAGCTATGGC (SEQ ID NO. 9),

[0084] Reverse: TCCCAGTGAATGGTGCATACA (SEQ ID NO. 10);

[0085] Human GAPDH:

[0086] Forward: ACATGTTCAATAGTAGCATCCACC (SEQ ID NO. 11),

[0087] Reverse: TACTCCTTGGGGGCCATGTG (SEQ ID NO. 12);

[0088] Mouse GAPDH:

[0089] Forward: AGAGGGTGAAGCAGGCATC (SEQ ID NO. 13),

[0090] Reverse: CGAAGGTGAGAGAGGGGAGTG (SEQ ID NO. 14).

[0091] Determination of serum biomarkers:

[0092] The level of LECT2 in serum was determined using ELISA, and the detection kits for human LECT2 (Catalog No.: SEF541Hu) and mouse LECT2 (Catalog No.: SEF541Mu) were purchased from Wuhan Meikang Business Co., Ltd. (Wuhan, China). The serum levels of alanine aminotransferase (ALT), aspartate aminotransferase, serum creatinine (Cr), and blood urea nitrogen (BUN) of mice were measured using an automatic biochemical analyzer.

[0093] Statistical analysis:

[0094] The results were expressed as mean ± standard deviation (SD). The data were analyzed using Student's t test.

[0095] Example 1 Increased expression of LECT2 during hepatic ischemia-reperfusion in clinical patients

[0096] Temporary clamping of the portal triad, i.e. blocking blood flow by Pringle maneuver, is a common strategy to reduce bleeding during liver resection. This method can cause liver ischemia-reperfusion (I / R) injury. The inventors collected serum and liver tissue samples from patients before surgery, after the first ischemia, after reperfusion, and after surgery, and detected the expression of LECT2 ( Figure 1 (A).

[0097] The results showed that serum LECT2 protein levels increased during ischemia and reperfusion ( Figure 1 Middle B). The mRNA level of LECT2 in liver tissue increases during ischemia and reperfusion ( Figure 1 Middle C).

[0098] Example 2 Increased expression of LECT2 in a mouse ischemia-reperfusion injury model

[0099] The inventors prepared a mouse liver ischemia-reperfusion injury model. After clamping the portal triad to cause liver ischemia for 1 hour, perfusion was restored and serum and liver tissue samples were collected at different time points to detect the expression of LECT2 ( Figure 2 (A).

[0100] The results showed that 0.5 hours after the perfusion was restored, the level of LECT2 protein in serum increased ( Figure 2 Middle B). The mRNA level of LECT2 in liver tissue continued to increase from 0.5 hours to 24 hours after the restoration of perfusion, and decreased at 48 hours ( Figure 2 Middle C).

[0101] Example 3 Lect2 - / - Alleviation of liver ischemia-reperfusion injury in mice

[0102] LECT2 knockout mice were used to examine whether Lect2 plays an important role in hepatic ischemia-reperfusion injury.

[0103] The results showed that compared with wild-type control mice in the same cage, Lect2 - / - The mice lost less weight ( Figure 3 Middle A), the area of ​​liver necrosis decreased ( Figure 3 B, C), serum ALT and AST levels decreased ( Figure 3 D, E), indicating Lect2 - / - The liver ischemia-reperfusion injury in mice was milder.

[0104] Hepatic ischemia-reperfusion often leads to damage to distal organs such as the kidneys. Serum creatinine and serum urea nitrogen were tested to assess renal function damage. - / - The mice had lower serum creatinine and serum urea nitrogen levels, indicating milder renal damage ( Figure 3 (F, G).

[0105] Example 4 LECT2 recombinant protein aggravates liver ischemia-reperfusion injury

[0106] To further confirm that LECT2 plays an important role in hepatic ischemia-reperfusion injury, mice were treated with LECT2 recombinant protein ( Figure 4 (A).

[0107] The results showed that LECT2 recombinant protein caused more weight loss in ischemia-reperfusion mice ( Figure 4 Middle B). The area of ​​liver necrosis in mice treated with LECT2 recombinant protein increased ( Figure 4C, D), serum ALT and AST levels decreased ( Figure 4 E, F), indicating Lect2 - / - Lect2 reduces liver ischemia-reperfusion injury in mice - / - The mice had lower serum creatinine and serum urea nitrogen levels, indicating milder renal damage ( Figure 4 (G, H).

[0108] Example 5 AAV-Lect2-shRNA can treat liver ischemia-reperfusion injury

[0109] This example further explores the strategy of targeting LECT2 to treat liver ischemia-reperfusion injury. Adeno-associated virus has been used as a vector for clinical disease treatment. AAV-Lect2-shRNA was constructed to knock down the expression of LECT2 in vivo ( Figure 5 (A).

[0110] The results showed that AAV-Lect2-shRNA could significantly reduce the weight loss of mice ( Figure 5 B), reducing the area of ​​liver tissue necrosis ( Figure 5 C), lower serum ALT and AST levels ( Figure 5 D, E), AAV-Lect2-shRNA treated mice had reduced serum creatinine and serum urea nitrogen levels ( Figure 5 (F, G) This indicates that AAV-Lect2-shRNA significantly reduced liver ischemia-reperfusion injury.

[0111] Example 6 Tie1-Ig3 segment recombinant protein alleviates liver damage

[0112] Previous studies have found that LECT2 directly binds to the Tie1 Ig3 segment, and the Tie1-Ig3 segment recombinant protein (for preparation methods, see LECT2, a Ligand for Tie1, Plays a Crucial Role in Liver Fibrogenesis) can block LECT2 / Tie1 binding and thus block the conduction of its downstream signaling pathway; therefore, a liver ischemia-reperfusion injury model was constructed in which the abdominal aorta was ligated for 20 minutes to restore blood flow. The Tie1-Ig3 segment was used to detect changes in serum ALT and AST levels, which are liver injury indicators, 24 hours after the restoration of blood flow.

[0113] The results showed that compared with the GST protein control group, the serum ALT and AST levels of mice in the GST-Tie1-Ig3 protein treatment group were significantly reduced, indicating that liver damage was alleviated ( Figure 6 (A, B).

[0114] The above specific implementations have been described in detail for the present invention, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. Application of LECT2 as a target in the preparation of diagnostic and / or therapeutic products for ischemia-reperfusion injury.

2. Application of reagents for detecting LECT2 in the preparation of diagnostic products for ischemia-reperfusion injury.

3. The use according to claim 2, characterized in that: The reagent for detecting LECT2 includes a reagent for detecting the expression level of LECT2; Preferably, the reagent for detecting the expression level of LECT2 includes a reagent for detecting the expression level of LECT2 gene and / or protein; Preferably, the reagent for detecting the expression level of the LECT2 gene is a reagent for detecting the expression level of the LECT2 gene by at least one method selected from sequencing technology, nucleic acid hybridization technology, nucleic acid amplification technology and immunoassay; Preferably, the reagent for detecting the expression level of LECT2 protein is a reagent for detecting the expression level of LECT2 protein by at least one method selected from the group consisting of Western-Blot, enzyme-linked immunosorbent assay, immunohistochemistry, immunocytochemistry, flow cytometry, ultraviolet spectrophotometry, high performance liquid chromatography, colorimetry, mass spectrometry, protein chip, immunoprecipitation and immunoblotting.

4. The use according to claim 3, characterized in that: The reagents include primers, probes or antibodies; Preferably, the sequence of the primer is: Forward: GCTGGTCTGATTTCTACCGCA; Reverse: CCAGAGAGAGACAAGATC; Preferably, the product is a kit, a chip, a test paper or a reagent.

5. Use of a LECT2 / Tie1 signaling pathway inhibitor or a pharmaceutically acceptable salt thereof in the preparation of a medicament for preventing and / or treating ischemia-reperfusion injury.

6. The use according to claim 5, characterized in that: The LECT2 / Tie1 signaling pathway inhibitor includes substances that inhibit LECT2 and / or Tie1 gene expression, silence or knock out LECT2 and / or Tie1 genes, and / or substances that inhibit LECT2 and / or Tie1 protein content and / or activity; and / or substances that inhibit the binding of LECT2 and Tie1; Preferably, the LECT2 / Tie1 signaling pathway inhibitor comprises at least one of shRNA, siRNA, dsRNA, sgRNA, miRNA, cDNA, antisense RNA / DNA, small molecule compounds, peptides, and antibodies.

7. The use according to claim 6, characterized in that: The shRNA sequence is as follows: Justification strand: GCTAACATATGTGCCAGCAAATCTT; Antisense strand: AAGATTTGCTGGCATATGTTAGC.

8. The use according to claim 6, characterized in that: The reagent for inhibiting the binding between LECT2 and Tiel comprises at least one of Tie1 extracellular region fragment recombinant protein, Tie Ig3 segment recombinant protein, LECT2 fragment or full-length recombinant protein, and LECT2 blocking antibody.

9. The use according to any one of claims 5 to 8, characterized in that: The drug also includes pharmaceutically acceptable excipients; Preferably, the pharmaceutically acceptable excipients include: at least one of a diluent, a binder, a wetting agent, a lubricant, a disintegrant, a solvent, an emulsifier, a cosolvent, a solubilizer, a preservative, a pH regulator, an osmotic pressure regulator, a surfactant, a coating material, an antioxidant, an antibacterial agent or a buffer; Preferably, the dosage form of the drug includes at least one of suspension, granules, capsules, powders, tablets, emulsions, solutions, pills, injections, suppositories, enemas, aerosols, patches or drops; Preferably, the administration route of the drug includes at least one of intravenous injection, intraperitoneal injection, intramuscular injection, oral administration, sublingual administration, nasal administration, aerosol administration or transdermal administration.

10. The use according to any one of claims 1 to 8, characterized in that: The ischemia-reperfusion injury includes ischemia injury and / or reperfusion injury; Preferably, the ischemic injury and / or reperfusion injury includes renal ischemic injury and / or ischemic reperfusion injury, myocardial ischemic injury and / or post-ischemic reperfusion injury, or liver ischemic injury and / or ischemic reperfusion injury.

Images