Application of Senecavirus A in preparation of medicine for preventing and / or treating oral cancer

Abstract

The invention provides application of Senecavirus A in preparation of a medicine for preventing and / or treating oral cancer, and particularly belongs to the technical field of medicine. The invention provides and verifies application of Senecavirus A in preparation of drugs for preventing and / or treating oral cancer. Specifically, in-vitro and in-vivo test results show that the Seneca virus A disclosed by the invention can realize prevention and / or treatment of oral squamous cell carcinoma.

Description

Technical Field

[0001] The invention belongs to the field of medical technology, and specifically relates to the use of type A Senecavirus in preparing medicines for preventing and / or treating oral cancer. Background Art

[0002] Oral squamous cell carcinoma (OSCC) is one of the most common head and neck malignancies and is prone to metastasis, which poses a great threat to people's health. OSCC causes facial disfigurement and impairment of swallowing, language and taste functions, which has a great impact on the patient's life. Currently, surgical resection and radiotherapy are the main means of treating OSCC. However, the therapy has serious adverse reactions, such as surgical resection is highly traumatic and has high postoperative recurrence rate, while radiation from radiotherapy may cause mucositis and irreversible damage such as pain inside the oral cavity. Therefore, it is urgent to find other treatments for OSCC and provide new options for the clinical treatment of OSCC. In recent years, oncolytic virus therapy has received widespread attention and is considered to be a promising cancer treatment. However, there is currently no report of an oncolytic virus that has a therapeutic effect on oral squamous cell carcinoma. Summary of the invention

[0003] The purpose of the present invention is to provide the use of type A Senecavirus in the preparation of a drug for preventing and / or treating oral cancer. The present invention proves that type A Senecavirus can achieve the prevention and / or treatment of oral squamous cell carcinoma.

[0004] The present invention provides the use of type A Seneca virus in preparing a medicine for preventing and / or treating oral cancer.

[0005] The present invention also provides the use of type A Seneca virus in preparing medicine for preventing and / or treating tongue cancer.

[0006] The present invention also provides the use of type A Seneca virus in preparing a medicine for preventing and / or treating oral squamous cell carcinoma.

[0007] The present invention also provides the use of type A Seneca virus in preparing a medicine for preventing and / or treating tongue squamous cell carcinoma.

[0008] The present invention also provides the use of type A Seneca virus in preparing a medicine for preventing and / or treating human tongue squamous cell carcinoma.

[0009] The present invention also provides the use of type A Seneca virus in preparing a medicine for killing human tongue squamous cell carcinoma cells.

[0010] The present invention also provides the use of type A Seneca virus in preparing a medicine for inhibiting the growth of human tongue squamous cell carcinoma tumors.

[0011] Preferably, the type A Seneca virus includes Seneca virus (Seneca virus) SVA-OV01; the Seneca virus SVA-OV01 is deposited in the General Microbiology Center of China Microorganism Culture Collection Administration, the preservation time is August 9, 2024, and the preservation number is CGMCC No.46099.

[0012] The present invention also provides Seneca virus SVA-OV01, wherein the Seneca virus SVA-OV01 is deposited in the General Microbiology Center of China Microorganism Culture Collection Administration, the deposit time is August 9, 2024, and the deposit number is CGMCC No.46099.

[0013] The present invention also provides a medicine for preventing and / or treating oral cancer, which comprises type A Seneca virus and pharmaceutically acceptable excipients.

[0014] The present invention provides the use of type A Senecavirus in the preparation of a drug for preventing and / or treating oral cancer. The present invention found that type A Senecavirus can efficiently infect human tongue squamous cell carcinoma cells and has a strong cancer cell killing effect; further studies have found that type A Senecavirus also has significant oncolytic properties on human tongue squamous cell carcinoma tumors in animal experiments, which provides a new method for the treatment of OSCC, making it no longer limited to traditional therapies. In vitro killing results show that type A Senecavirus can replicate rapidly in CAL27 cells, has a significant killing effect on tumor cells CAL27, and is dose-dependent. In vivo anti-tumor test results show that type A Senecavirus can significantly inhibit the growth rate of CAL27 tumors, the tumor volume in the treatment group is significantly smaller, and no weight loss is caused during the administration period. The safety evaluation results show that type A Senecavirus has no significant effect on liver and kidney function, body weight, heart, liver, spleen, lung and kidney tissues. It shows that type A Senecavirus can achieve the prevention and / or treatment of human tongue squamous cell carcinoma. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0016] Figure 1 This is a confocal bright field observation result of the morphological changes of CAL27 cells after SVA infection provided by the present invention;

[0017] Figure 2This is a graph showing the results of the SVA virus replication kinetics test provided by the present invention;

[0018] Figure 3 This is a graph showing the infection results of SVA on CAL27 cells at different infection times provided by the present invention;

[0019] Figure 4 This is a graph showing the killing rate of CAL27 cells by different SVA infection doses provided by the present invention;

[0020] Figure 5 A graph showing the trend of mouse tumor size changes provided by the present invention;

[0021] Figure 6 The mouse tumor size result diagram provided by the present invention;

[0022] Figure 7 This is a graph comparing the weights of two groups of mice ex vivo tumors provided by the present invention;

[0023] Figure 8 The weight change trend result graph of mice provided by the present invention;

[0024] Fig. 9 This is a nude mouse tumor HE staining result diagram provided by the present invention;

[0025] Fig.10 The results of the determination of serum alanine aminotransferase activity, aspartate aminotransferase activity and blood urea nitrogen in mice provided by the present invention are shown in FIG.

[0026] Fig.11 The mouse weight trend result graph provided by the present invention;

[0027] Fig.12 This is a graph showing the HE staining results of mouse tissue sections provided by the present invention.

[0028] Biological deposit information

[0029] Seneca virus SVA-OV01 is deposited in the General Microbiology Center of China Microorganism Culture Collection Administration, referred to as CGMCC, and the deposit date is August 9, 2024. The address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, and the deposit number is CGMCC No.46099. DETAILED DESCRIPTION

[0030] The present invention provides the use of type A Senecavirus in the preparation of a drug for preventing and / or treating oral cancer. In a specific embodiment, the type A Senecavirus includes Senecavirus SVA-OV01; the Senecavirus SVA-OV01 is deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration, the deposit time is August 9, 2024, and the deposit number is CGMCC No.46099.

[0031] The present invention also provides the use of type A Senecavirus in the preparation of a drug for preventing and / or treating tongue cancer. In a specific embodiment, the type A Senecavirus includes Senecavirus SVA-OV01; the Senecavirus SVA-OV01 is deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration, the deposit time is August 9, 2024, and the deposit number is CGMCC No.46099.

[0032] The present invention also provides the use of type A Senecavirus in the preparation of a drug for preventing and / or treating oral squamous cell carcinoma. In a specific embodiment, the type A Senecavirus includes Senecavirus (Seneca virus) SVA-OV01; the Senecavirus SVA-OV01 is deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration, the deposit time is August 9, 2024, and the deposit number is CGMCC No.46099.

[0033] The present invention also provides the use of type A Senecavirus in the preparation of a drug for preventing and / or treating tongue squamous cell carcinoma. In a specific embodiment, the type A Senecavirus includes Senecavirus SVA-OV01; the Senecavirus SVA-OV01 is deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration, the deposit time is August 9, 2024, and the deposit number is CGMCC No.46099.

[0034] The present invention also provides the use of type A Senecavirus in the preparation of a drug for preventing and / or treating human tongue squamous cell carcinoma. In a specific embodiment, the type A Senecavirus includes Senecavirus SVA-OV01; the Senecavirus SVA-OV01 is deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration, the deposit time is August 9, 2024, and the deposit number is CGMCC No.46099.

[0035] The present invention also provides the use of type A Senecavirus in the preparation of a drug for killing human tongue squamous cell carcinoma cells. In a specific embodiment, the human tongue squamous cell carcinoma cells include human tongue squamous cell carcinoma cells CAL27. In a specific embodiment, the type A Senecavirus includes Seneca virus (Seneca virus) SVA-OV01; the Seneca virus SVA-OV01 is deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration, the deposit time is August 9, 2024, and the deposit number is CGMCC No.46099.

[0036] The present invention also provides the use of type A Senecavirus in the preparation of a drug for inhibiting the growth of human tongue squamous cell carcinoma tumors. In a specific embodiment, the type A Senecavirus includes Seneca virus (Seneca virus) SVA-OV01; the Seneca virus SVA-OV01 is deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration, the deposit time is August 9, 2024, and the deposit number is CGMCC No.46099.

[0037] The present invention also provides Seneca virus SVA-OV01, which is deposited in the General Microbiological Center of China Microbiological Culture Collection Committee on August 9, 2024, and the deposit number is CGMCC No. 46099. The SVA-OV01 virus of the present invention has a significant killing effect on tumor cells CAL27, can significantly inhibit the growth rate of CAL27 tumors, and has good safety.

[0038] The present invention also provides a drug for preventing and / or treating oral cancer, the drug comprising type A Senecavirus and a pharmaceutically acceptable excipient. In a specific embodiment, the type A Senecavirus comprises Senecavirus SVA-OV01. In a specific embodiment, the type of the drug comprises an oral preparation or an injection. In a specific embodiment, the excipient comprises PBS. The drug of the present invention can achieve the prevention and / or treatment of oral cancer.

[0039] To further illustrate the present invention, the use of the type A Seneca virus provided by the present invention in the preparation of a drug for preventing and / or treating oral cancer is described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0040] Example 1

[0041] Senecavirus type A SVA amplification preparation

[0042] Viruses and cells

[0043] Seneca virus SVA-OV01 (CGMCC, 46099); hamster kidney fibroblasts BHK-21 (ATCC, CCL-10).

[0044] SVA culture and titer detection

[0045] Virus culture

[0046] 2×10 6 BHK-21 cells were inoculated in a T75 culture flask. When the cell density was about 80%, the old culture medium was discarded, the cell surface was washed with PBS, the SVA suspension was diluted with DMEM culture medium at a volume ratio of 1:1000, inoculated into the BHK-21 cells, and incubated in an incubator for 2 hours. The medium was then replaced with a maintenance medium containing 2% FBS.

[0047] When the cells show obvious cytopathic effect (CPE) under the microscope, the cells become round and shrink. When 70% of the cells show CPE and fall off from the bottom, the virus is collected. After repeated freezing and thawing three times, the culture medium containing the virus is collected into a 15 mL centrifuge tube.

[0048] Virus concentration

[0049] In order to obtain a high-titer SVA virus stock solution, the present invention uses a centrifugal ultrafiltration method to concentrate the SVA virus, and the entire process is carried out at 4°C. First, the collected virus-containing supernatant is centrifuged at 1000×g for 10 minutes to remove larger cell precipitates. Subsequently, the supernatant is collected and centrifuged at 3000×g for 10 minutes to further remove cell debris. Next, a Millipore ultrafiltration tube (molecular retention capacity of 100kDa) is used to concentrate the virus particles. After centrifugation at 3000×g for 10 minutes, the liquid in the inner tube of the ultrafiltration tube is the virus concentrate. Finally, the virus concentrate in the inner tube is collected, divided and stored in a -80°C refrigerator. TCID 50 Virus titer determination

[0050] (1) Cell plating in 96-well plates

[0051] Plate 96-well plates, 8 × 10 3 BHK-21 cells were cultured overnight in a 37°C, 5% CO2 incubator.

[0052] (2) Inoculation of SVA virus

[0053] The SVA virus sample to be tested was diluted 10 times continuously. -3 Up to 10 -11Add the virus dilution to the corresponding 96-well plate, and each column represents a dilution. At the same time, add an equal volume of DMEM culture medium as a negative control. The inoculated 96-well plate was placed in a 37°C, 5% CO2 incubator and replaced with maintenance medium (containing 2% FBS) after 2 hours.

[0054] (3) Observation and calculation

[0055] Three days after infection, CPE phenomenon could be observed under the microscope, and the number of cytopathic wells at different dilutions was recorded.

[0056] The Karber method was used to calculate the median lethal dose (TCID 50 / 100μL): lgTCID 50 =Ld(S-0.5)

[0057] L: logarithm of the highest virus dilution, in this example, L = -3;

[0058] d: the difference between the dilution logarithms, 10-fold serial dilution d = 1;

[0059] S: The sum of the proportions of positive wells at different dilutions (number of diseased wells / total number of wells).

[0060] TCID 50 Virus titer determination results

[0061] The SVA-OV01 virus titer calculated by Karber formula was 1×10 11 TCID 50 / mL.

[0062] Example 2

[0063] In vitro killing effect of Seneca virus type A on human oral cancer cells

[0064] An important characteristic of oncolytic viruses is that they can specifically replicate in tumor cells and lyse tumor cells. This example evaluates the replication ability of oncolytic viruses: Seneca virus type A and its killing effect on human tongue squamous cell carcinoma cells (CAL27) at the in vitro level.

[0065] Viruses and cells

[0066] Seneca virus SVA-OV01 (CGMCC, 46099) and human tongue squamous cell carcinoma cell CAL27 (ATCC, CRL-2095) cultured by the method described in Example 1;

[0067] Observation of morphological changes of CAL27 cells after SVA infection

[0068] Count the cells using a cell counting plate and plate 5 × 10 5CAL27 cells were placed in a confocal dish and returned to a cell culture incubator at 37°C and 5% CO2 saturated humidity for 24 hours. After the cells adhered to the wall, they were inoculated with SVA at MOI = 1, and the control group was added with an equal amount of maintenance solution (containing 2% FBS). The cell pathological changes were observed under a 40x microscope at 0h, 12h, 24h, 36h, and 48h.

[0069] Figure 1 This is a confocal bright field observation of the morphological changes of CAL27 cells after SVA infection (40x). Figure 1 As shown in the figure, normal CAL27 cells are flat irregular polygonal, and the cells grow in a tightly connected monolayer. As the infection time increases, the virus SVA continues to replicate and amplify in the cells, resulting in a cytopathic effect (CPE). At 12h, compared with the Control group, the CAL27 cells in the SVA group showed rounded CPE; at 24h, a large number of cells in the SVA group had rounded morphology and detached from the wall; at 36h and 48h, all the cells in the SVA group became round, and most of the cells detached from the wall and were suspended and lysed.

[0070] Virus replication kinetics assay

[0071] In order to further confirm the oncolytic ability of SVA on CAL27, the present invention detected the proliferation of SVA in CAL27 cells. CAL27 cells were cultured in 24-well plates overnight, and 1.5×10 5 The cells were infected with SVA at MOI=1. Total RNA was extracted from the cells at 0h, 6h, 12h, 18h and 24h, and the expression level of SVA in the cells was detected by quantitative reverse transcription polymerase chain reaction (qRT-PCR). The qRT-PCR primers for SVA viral genome were: upstream primer ATGCCCAGTCCTTCCTTTC (SEQ ID NO.1), downstream primer CAGGCAGTATCCAAAGCACG (SEQ ID NO.2). The qRT-PCR primers for GAPDH were: upstream primer GGAGCGAGATCCCTCCAAAAT (SEQ ID NO.3), downstream primer GGCTGTTGTCATACTTCTCATGG (SEQ ID NO.4).

[0072] Figure 2 Figure 2 is the result of SVA virus replication kinetics test. Figure 2As shown, after CAL27 cells were infected with SVA at MOI=1, a significant increase in the expression level of SVA virus was observed within 0 to 12 hours, which strongly demonstrated the rapid replication of SVA virus in CAL27 cells.

[0073] Detection of cell activity of CAL27 cells infected with SVA at different time points

[0074] CAL27 cells were cultured in 24-well plates overnight, with 1.5 × 10 5 / well, infect cells with SVA at MOI = 1, and discard the culture medium and replace it with maintenance medium (containing 2% FBS) after 1 hour. Set up control groups at different times, and replace the control group with an equal amount of maintenance medium (containing 2% FBS). Collect samples at 0h, 6h, 12h, 24h, 36h, and 48h, discard the old culture medium, add 10% CCK8 solution (Solebol) diluted with fresh culture medium, incubate in the incubator for 30min, transfer the supernatant to a 96-well plate, 100μL per well, use 10% CCK8 solution as the blank group, and detect its absorbance at a wavelength of 450nm on an enzyme reader. Calculate the cell survival rate according to the following formula:

[0075] Cell survival rate (%) = [A(experimental group) - A(blank group)] / [A(control group) - A(blank group)] × 100;

[0076] Figure 3 The results of SVA infection on CAL27 cells at different infection times (MOI = 1). Figure 3 As shown in the figure, as the virus SVA infection time increases, the survival rate of CAL27 cells shows a decreasing trend, indicating that SVA has a significant inhibitory effect on human tongue squamous cell carcinoma CAL27, and the inhibitory effect shows a dependence on the time of SVA infection of cells. It is worth noting that compared with the CAL27 cell survival rate at 0h, the cell survival rate at 48h is extremely significantly reduced, indicating that the tumor cell CAL27 is significantly killed.

[0077] Killing rate of CAL27 cells with different SVA infection doses

[0078] The present invention studies the killing effect of different SVA infection doses on CAL27 cells. To detect the survival rate of CAL27 cells infected with SVA at different MOIs after 48 hours. CAL27 cells were cultured at 8×10 3Each well was plated in a 96-well plate, cultured overnight, and SVA or inactivated SVA was added according to the corresponding MOI. After 1 hour, the culture medium was discarded and replaced with maintenance medium (containing 2% FBS), and the control group was replaced with an equal amount of maintenance medium (containing 2% FBS). After 48 hours, the maintenance medium (containing 2% FBS) was discarded, and 10% CCK8 solution was added. The 10% CCK8 solution was used as the blank group, 100 μL per well, incubated in the incubator for 30 minutes, and its absorbance was detected at a wavelength of 450nm on an enzyme reader. The cell survival rate was calculated according to the following formula:

[0079] Cell survival rate (%) = [A(experimental group) - A(blank group)] / [A(control group) - A(blank group)] × 100;

[0080] Figure 4 Figure 2 is the killing rate of CAL27 cells by different SVA infection doses. Figure 4 As shown, the results show that as the amount of virus in SVA-infected cells increases, the survival rate of CAL27 decreases. The present invention explores whether SVA's killing of CAL27 cells depends on viral replication. The present invention uses ultraviolet-inactivated SVA to infect CAL27 cells, and the results show that the inactivated SVA has no killing effect on CAL27 cells. This shows that the killing effect of SVA on CAL27 cells is dose-dependent and depends on the viral replication process.

[0081] Example 3

[0082] Antitumor effects of Senecavirus type A in vivo

[0083] This example evaluates the oncolytic function of Senecavirus type A at the in vivo level. First, a CAL27 subcutaneous transplant tumor model of BALB / cNude nude mice was established; intratumoral injection of Senecavirus type A was used for treatment, and the anti-tumor effect of Senecavirus type A was evaluated by observing the tumor growth curve of mice; histopathological examination of mouse tumors was performed to evaluate the anti-tumor effect of Senecavirus type A.

[0084] Detection of the anti-tumor effect of Senecavirus type A in vivo

[0085] 1. Establishment of tumor-bearing mouse model and experimental grouping

[0086] CAL27 cell suspension was inoculated subcutaneously on the right back of nude mice, and the subcutaneous tumor formation was observed every other day. Seven days after inoculation, the tumor volume grew to about the size of a mung bean (about 50-100mm 3 ), the mice were randomly divided into PBS group and SVA group, with 5 mice in each group. The experimental process is as follows:

[0087] (1) Discard the supernatant in the culture dish, add 2 mL of PBS to wash once, and discard the PBS; add 1 mL of trypsin and return to the 37°C cell culture incubator for 3 min.

[0088] (2) Remove the cells and observe under a microscope. When the cells are properly digested, add 2 mL of complete culture medium to neutralize the trypsin. Gently blow the cells and collect the cells for centrifugation at 1000 rpm for 3 min.

[0089] (3) Discard the supernatant, resuspend the cells with FBS, dilute the cell suspension with ABW high-concentration matrix gel in a 1:1 ratio, mix well and place in an ice box.

[0090] (4) Subcutaneous injection of about 5×10 6 CAL27 cells, and wait until the tumor volume reaches 50-100 mm 3 The mice were randomly divided into two groups, PBS group and SVA group.

[0091] (5) In the SVA experimental group, 75 μL of SVA virus (virus titer was 1×10 11 TCID 50 / mL), the first administration time was recorded as d0, and the injection was performed once every two days for a total of seven times. The PBS group was injected with an equal volume of PBS intratumorally.

[0092] 2. Measurement of mouse tumor volume and tumor weight

[0093] Every two days before administration, the diameter of the mouse tumor was measured and recorded using a vernier caliper, using the formula 0.5×long diameter×short diameter. 2 The tumor volume was calculated and recorded. On day 14 after treatment (d14), the mice were euthanized, and the subcutaneous tumors were obtained and weighed.

[0094] 3. HE staining of mouse tumors

[0095] The tumors of mice in each group were subcutaneously removed, fixed with 4% paraformaldehyde, embedded in paraffin, and stained with HE. The coverslips were placed under a microscope for observation and recording of pathological changes. The blue part is the cell nucleus stained with hematoxylin, and the red part is the protein stained with eosin, mainly referring to the cytoplasm.

[0096] Detection results of anti-tumor effect of Seneca virus type A in vivo

[0097] Figure 5 This is a graph showing the trend of mouse tumor size changes. Figure 5 As shown in the figure, the growth rate of tumors in the Senecavirus type A treatment group was slower than that in the PBS group, indicating that SVA can significantly inhibit the growth rate of CAL27 tumors. After the mice were killed, the tumors of each group of mice were removed, arranged, and photographed. Figure 6As shown in (Results of mouse tumor size), it can be found that the in vitro tumors of the group treated with intratumoral injection of SVA are smaller than those of the PBS group. Figure 7 The weight comparison of the in vitro tumors of the two groups of mice is shown in Figure 2. Figure 5 to Figure 7 As shown, on the 14th day after the first administration, the average tumor volume of mice in the PBS group was (1047.05±231.49) mm 3 The average tumor volume in the SVA treatment group was (324.54±180.26) mm 3 The tumor weight of the Senecavirus type A treatment group was significantly lower than that of the PBS group, and there was a very significant difference between the two groups (P<0.01), which was consistent with the tumor growth curve. The above results show that the administration of Senecavirus type A can effectively inhibit the growth of tumors in the CAL27 tumor-bearing mouse model without causing significant weight loss ( Figure 8 , the weight change trend of mice). High titer SVA inoculation therapy has a significant effect on early oral squamous cell carcinoma CAL27. The survival of the two groups of experimental mice was good during the experiment, and no mice died at the end of the experiment. After CAL27 cells were subcutaneously inoculated into nude mice to form tumors, they were divided into groups and injected with 75μL 1×10 11 TCID 50 / mLA type Seneca virus and 75μL PBS, then measure the tumor size and mouse weight every two days, and record and draw graphs. On the 14th day, the tumors of mice in each group were removed, arranged and photographed. The results between the two groups were compared by independent sample t-test, **P<0.01.

[0098] HE staining results of nude mouse tumor sections

[0099] Fig. 9 The following is the result of HE staining of nude mouse tumor (20x). HE staining was performed on the tumor. The sections of the nude mouse transplanted tumor in the PBS group were observed under a microscope. A large number of tumor cells were densely arranged, and the nuclei were stained darker. In the sections of the SVA group, it was observed that the number of tumor cells was reduced, the cells were arranged more sparsely, and the nuclei were stained lighter. A large number of dead tumor tissues without cell structures were seen in the center of the tumor, with a small number of surviving tumor cells in the middle, and some surviving tumor cell clusters were seen at the edge of the tumor. The results of pathological sections showed that the tumor tissue in the SVA treatment group was severely necrotic, with condensation, dissolution, and fragmentation of the nuclei. The degree of tumor necrosis in the treatment group was much higher than that in the PBS group, proving that SVA can effectively inhibit the growth of tumors in the CAL27 tumor-bearing mouse model.

[0100] Example 4

[0101] In vivo safety evaluation of Seneca virus type A

[0102] In order to evaluate whether Senecavirus type A affects the liver and kidney function of mice, the biosafety of SVA was evaluated. The blood of mice was collected and the biochemical indicators reflecting the liver and kidney function status in the serum were detected to evaluate the safety of SVA to tissues.

[0103] method

[0104] 1. Virus Preparation

[0105] The specific virus preparation method is shown in Example 1. The virus titer used was 1×10 11 TCID 50 / mL of SVA.

[0106] 2. Experimental Animals

[0107] Female SPF BALB / C mice (18-20 g) were purchased from Weitong Lihua Co., Ltd. and raised in the barrier system of the Experimental Animal Center of Ningbo Research Institute of Wenzhou Medical University, Zhejiang Province, and fed with sterile feed and water. The indoor temperature was (25±10)℃ and the relative humidity was (50±10)%.

[0108] 3. Animal Grouping

[0109] The mice were randomly divided into PBS group and SVA group, with 6 mice in each group. The SVA group was subcutaneously injected with 75 μL of virus with a titer of 1×10 11 TCID 50 / mL SVA, the first administration time was recorded as d0, injection was performed every two days for a total of seven times, and body weight was measured and recorded. The PBS group was subcutaneously injected with an equal volume of PBS.

[0110] 4. Biochemical testing

[0111] One month later, blood was collected from the eyeballs, placed at room temperature for 2 hours, and centrifuged at 8000xg, 4°C for 10 minutes. The supernatant was collected and tested using the AU480 fully automatic biochemical analyzer using the alanine aminotransferase assay kit, aspartate aminotransferase assay kit, and blood urea nitrogen assay kit. The independent sample t-test was used to compare the test results between the two groups.

[0112] 1.5 HE staining of mouse tissue

[0113] Tissues (heart, liver, spleen, lung, and kidney) of mice in each group were obtained and fixed with 4% paraformaldehyde, embedded in paraffin, and stained with HE. The sections were sealed and observed under a microscope to record the pathological changes.

[0114] result

[0115] Effects of Senecavirus Type A on Serum Biochemical Parameters in Mice

[0116] To evaluate whether Senecavirus type A has an effect on the liver and kidney function of mice, blood was collected from mice and biochemical indicators in serum reflecting the liver and kidney function status were detected. Fig.10 The following is a graph showing the results of the determination of serum alanine aminotransferase activity, aspartate aminotransferase activity and blood urea nitrogen in mice. Fig.10 It can be seen that there were no significant differences in the activity of alanine aminotransferase, aspartate aminotransferase and blood urea nitrogen content in the serum of each group of mice, indicating that SVA had no significant effect on the liver and kidney functions of mice.

[0117] Effects of Senecavirus Type A on Body Weight of Mice

[0118] Fig.11 The following is the result chart of the weight trend of mice. Fig.11 It can be seen that there was no significant difference in the body weight of mice in the SVA group compared with that in the PBS group, indicating that SVA had no significant effect on the body weight of mice.

[0119] HE staining results of BALB / C mouse tissue sections

[0120] Fig.12 This is the HE staining result of mouse tissue section (20x). Fig.12 By HE staining the heart, liver, spleen, lung and kidney tissue sections of mice, it was observed that the mouse tissues had obvious pathological changes. This further shows that SVA has no obvious effect on the mouse tissues.

[0121] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Use of Senecavirus type A in the preparation of a drug for preventing and / or treating oral cancer.

2. Use of Senecavirus type A in the preparation of drugs for preventing and / or treating tongue cancer.

3. Use of Seneca virus type A in the preparation of a drug for preventing and / or treating oral squamous cell carcinoma.

4. Use of Senecavirus type A in the preparation of drugs for preventing and / or treating tongue squamous cell carcinoma.

5. Use of Seneca virus type A in the preparation of drugs for preventing and / or treating human tongue squamous cell carcinoma.

6. Application of Seneca virus type A in the preparation of drugs for killing human tongue squamous cell carcinoma cells.

7. Use of Seneca virus type A in the preparation of drugs for inhibiting the growth of human tongue squamous cell carcinoma tumors.

8. The use according to any one of claims 1 to 7, characterized in that: The type A Seneca virus includes Seneca virus (Seneca virus) SVA-OV01; the Seneca virus SVA-OV01 is deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration, the preservation time is August 9, 2024, and the preservation number is CGMCC No.46099.

9. Seneca virus SVA-OV01, characterized in that The Seneca virus SVA-OV01 is deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on August 9, 2024, and the deposit number is CGMCC No.46099.

10. A drug for preventing and / or treating oral cancer, characterized in that: The medicine comprises Seneca virus type A and pharmaceutically acceptable excipients.

Images