Compound microbial agent and application thereof in fermentation of high-acidity Hmong's red sour soup

Abstract

The invention belongs to the technical field of microbial fermentation, and particularly relates to a compound microbial agent and application thereof in fermentation of high-acidity Hmong's red sour soup. The red sour soup with high acidity and low nitrite content is produced by fermenting tomatoes, hot peppers and other auxiliary materials by using a compound microbial agent prepared from newly screened lactobacillus plantarum MX14 and pichia membranaefaciens PY33, and mixing and homogenizing the tomatoes, the hot peppers and the other auxiliary materials. Compared with naturally fermented sour soup, the preparation method has the advantages that the fermentation period is short, the prepared red sour soup has higher titratable acid content, lower pH and lower nitrite content, the fermentation period of rapid acidification of the red sour soup is shortened, nitrite in the red sour soup is reduced, and the safety of products is improved.

Description

Technical Field

[0001] The invention belongs to the field of microbial fermentation, and particularly relates to a composite microbial agent and application thereof in the fermentation of high-acid Miaojiahong sour soup. Background Art

[0002] Red sour soup is a traditional fermented food with a long history in southwest China, especially in the Miao ethnic group-inhabited areas of Guizhou. It is widely loved for its unique sour taste, aroma and rich nutritional value. It is not only an important part of the daily diet of local residents, but also a traditional food with health functions.

[0003] The production of red sour soup relies on natural fermentation, which completes complex biochemical transformations in a low pH environment through the synergistic action of multiple microorganisms such as lactic acid bacteria and yeast. However, the traditional natural fermentation method is easily unstable due to the strong influence of environmental conditions, thus affecting the quality and flavor consistency of the sour soup. Uncontrollable microbial sources may lead to fermentation failure, insufficient acidity, and even food safety issues such as microbial contamination and excessive nitrite.

[0004] In recent years, with the development of food industry and fermentation technology, the application of microbial research in sour soup fermentation has gradually deepened. By screening and directional addition of functional microbial agents, the fermentation efficiency can be effectively improved, the fermentation process can be optimized, and key indicators such as acidity, flavor and safety can be accurately controlled, thereby improving the product quality and consistency of red sour soup.

[0005] The application of composite microbial agents can not only preserve the traditional flavor and nutrition of red sour soup, but also greatly shorten the fermentation time, optimize the production process, and provide technical support for the industrialization and large-scale production of sour soup. As a food that integrates tradition and modern technology, red sour soup not only continues the essence of local food culture through scientific and standardized production, but also opens up a new path for the industrialization of traditional fermented foods. It has broad application prospects and important industrial value. Summary of the invention

[0006] In view of the shortcomings of the prior art, the present invention aims to propose a composite microbial agent and its application in the preparation of red sour soup. By screening and adding functional microbial agents in a targeted manner during sour soup fermentation, the problems of long fermentation cycle, insufficient acidity and high nitrite content in traditional sour soup are solved.

[0007] To achieve the above object, the present invention provides a plant lactobacillus, wherein the plant lactobacillus is plant lactobacillus MX14, which is classified and named as plant lactobacillus Lactobacillus plantarum, deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on January 13, 2025, with the deposit number CGMCC NO. 33391, and the deposit address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0008] In a second aspect, the present invention provides a Pichia pastoris, wherein the Pichia pastoris is Pichia pastoris PY33, which is classified as Pichia pastoris Pichia membranifaciens , deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on January 13, 2025, with the deposit number CGMCC NO.33392, and the deposit address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0009] In a third aspect, the present invention provides a probiotic composition, wherein the microbial composition comprises the Lactobacillus plantarum described in the first aspect and the Pichia pastoris described in the second aspect. In addition, the present invention provides a bacterial agent comprising the above-mentioned Pichia pastoris PY33 and Lactobacillus plantarum MX14.

[0010] Furthermore, the probiotic composition also includes a food-acceptable carrier, auxiliary material or additive.

[0011] Furthermore, the number of viable bacteria of Lactobacillus plantarum and Pichia membranaceus in the probiotic composition is not less than 1×10 6 CFU / mL.

[0012] In a fourth aspect, the present invention provides a composite microbial agent, wherein the agent comprises the probiotic composition or a fermentation product thereof as described in the third aspect.

[0013] Furthermore, the preparation method of the composite microbial agent includes: activating and subculturing Lactobacillus plantarum in MRS medium, activating and subculturing Pichia pastoris in PDB medium, and the viable counts of both bacteria reach 1×10 8 When the CFU / mL is above, collect the bacteria by centrifugation, dissolve them in sterile water and mix them in a volume ratio of 1~3:1~3.

[0014] In a fifth aspect, the present invention provides the use of the microbial composition or the bacterial agent described in the fourth aspect in the preparation of red sour soup.

[0015] Furthermore, the application is at least one of the following: (1) Application in increasing the titratable acid content of red sour soup; (2) Application in lowering the pH value of red sour soup; (3) Application in reducing the nitrite content in red sour soup.

[0016] In a sixth aspect, the present invention provides a method for preparing a high-acidity, low-nitrite red sour soup, the preparation method comprising the following steps: S1. Pre-treating the sour soup raw materials to obtain red sour soup puree; the sour soup raw materials include tomatoes, peppers, ginger, garlic, glutinous rice flour, edible salt and / or white wine, and also include shallots, onions, mustard or coriander; S2. The plant lactobacillus described in the first aspect is cultured in MRS medium until the viable count reaches 1×10 8 CFU / mL or more; and culturing the Pichia yeast described in the second aspect in PDA, and the number of viable bacteria reaches 1×10 8 CFU / mL or more; mixing the Lactobacillus plantarum culture and the Pichia pastoris culture to prepare a composite microbial agent; S3. Add the composite microbial agent prepared in step S2 to the red sour soup puree prepared in step S1, ferment, and prepare high-acidity and low-nitrite red sour soup after post-ripening.

[0017] Furthermore, the pretreatment in step S1 is to mix and pulp the sour soup ingredients including tomatoes and / or peppers. Preferably, the sour soup ingredients also include ginger, garlic glutinous rice flour, edible salt and white wine.

[0018] Furthermore, the pretreatment in step S1 specifically includes: selecting tomatoes, peppers, ginger and garlic with uniform texture, free of insect pests and harmful microorganisms; removing the stems and cleaning them, and then mixing and beating the materials to achieve the purpose of rapid maturation of the materials in the subsequent steps. Continue to add glutinous rice flour, edible salt and white wine to be beaten, boil for 15-20 seconds, and then cool for use to obtain the red sour soup puree.

[0019] In a specific embodiment of the present invention, the proportions of the materials are as follows: 500-2000 g of tomatoes, 100-300 g of peppers, 100-300 g of ginger, 20-150 g of garlic, 5-50 g of glutinous rice flour, 5-50 g of edible salt, and 5-50 g of liquor. Preferably, 2000 g of tomatoes, 200 g of peppers, 100 g of ginger, 50 g of garlic, 20 g of glutinous rice flour, 30 g of edible salt, and 50 g of liquor.

[0020] Furthermore, in step 2, the volume ratio of the Lactobacillus plantarum culture to the Pichia pastoris culture is 1-3:1-3.

[0021] Furthermore, in step S3, the inoculation amount of the composite microbial agent is 4-8% by volume.

[0022] Furthermore, in step S3, the fermentation and post-ripening steps specifically include: in a sterile environment, aseptically filling the red sour soup puree into a sterile fermentation tank, adding a composite microbial agent at 5% (by volume), placing it in a 25-35°C incubator, and fermenting it for 96-216 hours. After the fermentation is completed, placing it in a 0-10°C low-temperature refrigerator and post-ripening it for 12-72 hours.

[0023] In a specific embodiment of the present invention, the culture temperature is 28-32°C, the fermentation is 120-168 h, the low-temperature ripening temperature is 2-6°C, and the ripening is 24-48 h.

[0024] In a seventh aspect, the present invention provides red sour soup prepared by the preparation method described in the sixth aspect, wherein the acidity of the red sour soup is higher than 20 mg / g and the nitrite content is lower than 10 mg / kg by weight.

[0025] Compared with the prior art, the present invention has the following advantages: (1) The present invention screened and obtained two probiotic strains capable of increasing the titratable acid content of Miaojiahong sour soup. The two strains were identified as Lactobacillus plantarum (named MX14) and Pichia pastoris (named PY33).

[0026] (2) The present invention provides a method for preparing high-acid Miao red sour soup using a composite microbial agent made from MX14 and PY33. The composite microbial agent has excellent fermentation performance, which not only shortens the fermentation period of rapid acidification of red sour soup, but also improves the consistency and quality stability of the product.

[0027] (3) Compared with naturally fermented sour soup, the red sour soup prepared by the preparation method of the present invention has a higher titratable acid content (increased by 32.95%), a lower pH and a lower nitrite content (reduced by 87.21%), which not only reduces the nitrite in the red sour soup, but also improves the safety of the product. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1-2 To screen 26 lactic acid bacteria strains for the superior fermentation of Miaojiahongsuantang; Figure 3 To screen 13 yeast strains for the superior fermentation of Miaojiahongsuantang; Figure 4 To screen the advantageous combination of different lactic acid bacteria and yeast for co-fermentation of red sour soup; Figure 5 The colony morphology of Lactobacillus plantarum MX14 and Pichia pastoris PY33 is shown in Figure 1, where A is Lactobacillus plantarum MX14 and B is Pichia pastoris PY33; Figure 6It is the molecular evolutionary tree of the strains, where A is the molecular evolutionary tree of Lactobacillus plantarum MX14, and B is the molecular evolutionary tree of Pichia pastoris PY33; Figure 7 This is a comparison of the physical and chemical properties of Miaojiahongsuantang fermented with composite microbial agents (INK) and naturally fermented (CK), where A is titratable acid, B is pH, C is reducing sugar content, D is total sugar content, and E is nitrite content during the fermentation process. DETAILED DESCRIPTION

[0029] The following is a further description of the concept of the present invention and the technical effects produced in conjunction with specific embodiments, so as to fully understand the purpose, features and effects of the present invention. The methods are conventional methods unless otherwise specified. The materials can be obtained from public commercial channels unless otherwise specified. The illustrative embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations of the present invention. It should be noted that the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

[0030] In the following examples, Lactobacillus plantarum and Pichia pastoris were derived from naturally fermented Miaojia sour soup, and the isolated strains were deposited in the General Microbiological Center of China National Committee for the Preservation and Administration of Microbiological Cultures. The chemical reagents used were purchased from regular chemical reagent suppliers and were analytically pure.

[0031] Example 1 Bacterial separation and purification The collected naturally fermented Miaojia sour soup products were diluted 10 times in a clean bench with sterile saline, and 0.1 mL of the bacterial solution with appropriate dilution multiples was evenly coated on MRS solid culture medium and PDA culture medium, and placed in a 30°C incubator for constant temperature culture for 12-48 h. Then, the culture base was taken out and a single colony with a diameter of 1-2 mm and a smooth surface was picked under a sterile environment, and inoculated onto a new MRS solid culture medium and PDA culture medium by streaking method, and repeated many times until pure colonies were isolated and purified. The screened microorganisms were diluted in a gradient with sterile saline and cultured at 30°C for 24 hours using MRS solid culture medium and PDA culture medium. Then, according to the size, color, gloss, and transparency of the colony, a single colony with a smooth surface and milky white color was picked, and the strain was purified by streaking on MRS solid plates and PDA plates for 2-3 times, and then stored in a refrigerator at 4°C.

[0032] Example 2 Screening of dominant strains for fermentation of high-acid Miaojiahong sour soup Select 1000g of tomatoes, 200g of peppers, 100g of ginger, and 50g of garlic, wash with running water, add 20g of glutinous rice flour, 30g of edible salt, and 50g of white wine, homogenize, boil (about 10-20 seconds), take 300g and pack into 500mL fermentation tanks, cool and set aside. Sterilize 250mL conical flasks at 105℃ for 20 minutes.

[0033] The activated 26 lactic acid bacteria were inoculated into the sterilized MRS liquid medium in the clean bench for 3-4 subcultures. When the number of viable bacteria reached 1×10 8 When the CFU / mL is above, prepare seed solution for later use.

[0034] The activated 13 yeast strains were inoculated into the sterilized PDB liquid medium in the clean bench for 3-4 subcultures. When the number of viable bacteria reached 1×10 8 When the CFU / mL is above, prepare seed solution for later use.

[0035] The seed liquid of 26 lactic acid bacteria and 13 yeast strains were inoculated into glutinous rice homogenate at an inoculation rate of 5% for fermentation. The fermentation conditions were: 30℃ constant temperature static culture for 120 h, and then transferred to a 4℃ low-temperature refrigerator for post-ripening for 48 h. During the fermentation and post-ripening period, the pH value and titratable acid content were measured every 24 h, for a total of 7 sample time points, namely 0, 24, 48, 72, 96, 120, 144, and 168 h. The suitable fermentation strains were selected by comparing the results of multiple index determinations.

[0036] Basic measurement indicators include: Determination of titratable acid content: Determined by titration with sodium hydroxide standard titration solution; pH value determination: using pH meter; The data were processed, analyzed and plotted using OrginPro 21.0 drawing software.

[0037] Analysis of the test results: The titratable acid content of the fermentation broth of different lactic acid bacteria strains is as follows: Figure 1 Among them, 0-120 h is the change trend of titratable acid content in 30℃ fermentation, and 120-168 h is the change trend of titratable acid content in 4℃ post-ripening. Figure 1 It can be seen that during the entire fermentation and ripening process, the titratable acid content increased rapidly in the first 72 hours, and the titratable acid content increased slowly or even stabilized from 72 hours to 120 hours. The titratable acid content tended to be stable or slightly decreased during the ripening process, while the pH value showed a downward trend and stabilized after 72 hours. The change in the content of reducing sugar can reflect the metabolism of microorganisms, which generally showed a downward trend. The titratable acid content tended to be stable or slightly decreased during the ripening process.

[0038] Among the lactic acid bacteria strains, 12 strains including MX14 had good comprehensive performance, high acidity, low pH and high metabolic level, and were preliminarily screened out for subsequent screening.

[0039] like Figure 2 As shown, the lactic acid content, free amino acid content and volatile organic compound composition of the above 12 lactic acid bacteria were compared. The results showed that MX12 and MX14 had high lactic acid production and high flavor free amino acid content and rich flavor compounds.

[0040] like Figure 3 As shown in A, the titratable acid content of red sour soup fermented by fungal strains did not change significantly, so the ethanol content was used as the screening index ( Figure 3 B), where PY33 and PX11 have higher ethanol contents.

[0041] From the above four strains, one lactic acid bacterium and one yeast were selected for combination, with a total of four combinations: A (MX12, PX11), B (MX14, PX11), C (MX12, PY33), and D (MX14, PY33). Physical and chemical indicators, flavor indicators, and safety indicators were measured to screen for advantageous combinations. Figure 4 As shown, combination C (MX12, PY33) has the highest acidity value, the most active sugar metabolism and the lowest nitrite content.

[0042] Therefore, according to the above experimental results, Lactobacillus plantarum MX14 and Pichia pastoris PY33 have strong adaptability in the Miaojiahongsuantang system, and the prepared Miaojiahongsuantang is better than other strains. The above two strains were selected and deposited in the General Microbiology Center (CGMCC) of the China Microbiological Culture Collection Administration on January 13, 2025, and subsequent research was carried out.

[0043] The strain deposit information is as follows: Lactobacillus plantarum is classified as Lactobacillus plantarum MX14 and named as Lactobacillus plantarum Lactobacillus plantarum , deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on January 13, 2025, with the deposit number CGMCC NO. 33391, and the deposit address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0044] Pichia pastoris PY33 was classified as Pichia pastoris membranaceus Pichia membranifaciens , deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on January 13, 2025, with the deposit number CGMCC NO.33392, and the deposit address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0045] Example 3 Bacterial species identification The isolated strains were systematically identified by phenotypic characteristics, 16SrDNA and ITS.

[0046] (1) The colony morphology of the isolated strains is as follows Figure 5 As shown, the colony morphology of strain MX14 on MRS plates was milky white, with regular round edges and a smooth surface; the colony morphology of strain PY33 on PDA plates was milky white, with serrated edges and a wrinkled surface.

[0047] (2) The isolated MX14 was inoculated into MRS liquid medium for activation for 24 h, and 1 mL of bacterial liquid was taken into a 1.5 mL sterile centrifuge tube. The genome was extracted using Plant Zol (TransGen kit). The extracted genomic DNA was amplified using bacterial universal primers 27F (SEQ ID NO: 1 5′-AGAGT TTGAT CCTGG CTCAG-3′) and 1492R (SEQ ID NO: 2 5′-CTACG GCTAC CTTGT TACGA -3′). The PCR conditions were as follows: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 s, 57°C annealing for 30 s, 72°C extension for 1.5 min, 25 cycles; 72°C extension for 7 min; 3% agarose gel electrophoresis detection, and then the amplified sample was sent to Beijing Ruibo Xingke Biotechnology Co., Ltd. for sequencing.

[0048] Log in to the NCBI website, perform BLAST homology analysis and comparison between the MX14 16S (SEQ ID NO: 3) rDNA sequencing results and the PY33 ITS sequencing results and the relevant information in the website database, identify the bacterial species and construct a phylogenetic tree. The results are as follows: Figure 6 A and Figure 6 As shown in B; MX14 is Lactobacillus plantarum; PY33 is Pichia membranaceus.

[0049] MX14 16S serial information: Sequence information of PY33 16S: AGGCATCTGTGATAACCACACCACACTGTGTGGGCGCACAAAACACCTAAACCTGGAGTATACACACGTCAACAAAAGATCTAAAAGAATAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAGCAGCGAAATGCGATACCTAGTGTGAATTGCAGCCATCGTGAATCATCGAGTTCTTGAACGCACATTGCGCCCGTCGGTATTCCGGCGGG CATGCCTGTCTGAGCGTCGTTTCCTTCTTGTGCACCGGGGTCTTTGCAGATCCTCTGTGCGCAGAGCTGGCCGTGCCACTGGCCCGGCCGAAAAGAAACGTTGCGGACGAAGCGAACTACATCGGGACGCTTTGGCCGCCGAGCGAAAAAAAAAACACCATTGAGCTCGACCTCAAATCAGGTAGGAGTACCCGCTGAACTTAAGCATATCATTAGGCGGAGG(SEQ ID NO:4).

[0050] Example 4 Quality comparison of Miaojia sour soup fermented with composite microbial inoculants Preparation of Miao sour soup: Step 1. Select 1000g tomatoes, 200g peppers, 100g ginger, and 50g garlic with uniform texture and no insect pests or harmful microorganisms; after cleaning, make pulp with 20g glutinous rice flour, 30g edible salt, and 50g white wine. Boil for 15-20 seconds, cool and set aside to obtain the red sour soup pulp.

[0051] Step 2. Prepare three groups of sour soup products, namely, the natural fermentation group (CK) and the compound microbial fermentation group (INK), respectively, as follows: Fermentation process of natural fermentation group (CK): select 1000g tomatoes, 200g peppers, 100g ginger, and 50g garlic with uniform texture, no insect pests, and no harmful microbial contamination; after washing, mix and beat with 20g glutinous rice flour, 30g edible salt, and 50g white wine, place in a 30℃ incubator, and ferment for 5 days.

[0052] Fermentation process of compound microbial agent fermentation group (INK): Plant Lactobacillus MX14 was cultured in MRS medium until the number of viable bacteria reached 1×10 8CFU / mL or more; and culture Pichia pastoris PY33 in PDA, with the number of viable bacteria reaching 1×10 8 CFU / mL or more; mix the Lactobacillus plantarum culture and the Pichia pastoris culture to prepare a composite microbial agent. Add the prepared composite microbial agent to the red sour soup puree prepared in step 1 at 5% (by volume), place it in a 30°C incubator, and ferment for 5 days.

[0053] like Figure 7 As shown in A, during the fermentation cycle, the titratable acid value of the composite microbial fermentation group (INK) was always higher than that of the natural fermentation group (CK). The titratable acid content of the inoculated fermentation group increased rapidly 2 days after inoculation, and then continued to increase but the growth rate slowed down. At the end of fermentation, the titratable acid content was 21±0.19. In the natural fermentation group, the titratable acid content increased slowly in the first 3 days of fermentation, and then the growth rate increased. At the end of fermentation, the titratable acid content was 15.8±0.06. Figure 7 The initial pH values ​​of both fermentation methods were higher than 4.0, but the initial acidity of the CK group was higher than that of the INK group, which may be related to the changes in the material composition of the sour soup during the sterilization process. During the 5-day fermentation period, the pH value of the INK group was always lower than that of the natural fermentation group. On the first day of fermentation, the pH value of the INK group dropped sharply from 4.01±0.01 to 3.31±0.02. As the fermentation time prolonged, the pH value continued to decrease, but the rate of decrease gradually slowed down, and finally reached 3.06±0.02 at the end of fermentation. In contrast, the pH change of the CK group was not obvious in the first 3 days of fermentation, but the rate of decrease was significantly accelerated on the 4th day, from 4.01±0.01 to 3.54, and the pH was 3.33±0.01 at the end of fermentation. The above results can be attributed to the rapid growth of MX14 and PY33 within five days after inoculation and fermentation, which led to the accumulation of lactic acid and other organic acids and reduced the pH value. The above results indicate that microbial inoculation plays an important role in enhancing the fermentation characteristics and overall quality of Miaojiahong sour soup.

[0054] like Figure 7 As shown in C, although the reducing sugar content of the INK group was slightly higher than that of the CK group at the beginning of fermentation, the reducing sugar content of the INK group was much lower than that of the CK group during the fermentation process (p<0.05). Figure 7 The results of the experiment showed that the content of starch in the INK group was significantly lower than that in the CK group (p<0.05). The reason for this result may be that the microbial growth and metabolism in the INK group was more vigorous. In addition, the starch and other polysaccharides in the Miaojiahong sour soup were not directly utilized by microorganisms, but through complex microbial interactions, oligosaccharides and polysaccharides were decomposed into reducing sugars, and some reducing sugars were further metabolized. In general, total sugars were converted into reducing sugars during the fermentation process, which shows that microbial activity plays an important role in changing the carbohydrate composition of Miaojiahong sour soup.

[0055] like Figure 7 As shown in Figure E, the nitrite content of INK decreased from 0.76±0.03 to 0.3±0.01 on days 0-5. The nitrite content of the CK group showed a trend of first increasing and then decreasing, with a peak of 1.21±0.07 mg / kg on the second day. It then gradually decreased to 0.56±0.04 mg / kg. The above results show that compared with natural fermentation, the composite microbial agent composed of MX14 and PY33 can effectively control the nitrite content in red sour soup.

[0056] The embodiments described above are only some embodiments of the present invention, rather than all embodiments. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work shall all fall within the scope of protection of the present invention.

Claims

1. A plant lactobacillus, characterized in that The plant lactobacillus is plant lactobacillus MX14, which is classified and named as plant lactobacillus Lactobacillus plantarum , and was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on January 13, 2025, with the deposit number CGMCC NO. 33391.

2. A Pichia pastoris, characterized in that The Pichia pastoris is Pichia pastoris PY33, which is classified and named as Pichia pastoris Pichia membranifaciens , and was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on January 13, 2025, with the deposit number CGMCC NO.33392.

3. A probiotic composition, characterized in that: The microbial composition comprises the Lactobacillus plantarum according to claim 1 and the Pichia pastoris according to claim 2.

4. A composite microbial agent, characterized in that: The bacterial agent comprises the probiotic composition according to claim 3 or a fermentation product thereof.

5. Use of the microbial composition according to claim 3 or the bacterial agent according to claim 4 in preparing red sour soup.

6. The use according to claim 5, characterized in that: The application is at least one of the following: (1) Application in increasing the titratable acid content of red sour soup; (2) Application in lowering the pH value of red sour soup; (3) Application in reducing the nitrite content in red sour soup.

7. A method for preparing high-acidity, low-nitrite red sour soup, characterized in that: The preparation method comprises the following steps: S1. Pre-treating tomatoes, peppers, ginger, garlic, glutinous rice flour, salt and liquor to prepare red sour soup puree; S2. The plant lactobacillus according to claim 1 is cultured in MRS medium until the viable count reaches 1×10 8 CFU / mL or more; and culturing the membrane-forming Pichia yeast according to claim 2 in PDA, and the number of viable bacteria reaches 1×10 8 CFU / mL or more; mixing the Lactobacillus plantarum culture and the Pichia pastoris culture to prepare a composite microbial agent; S3. adding the composite microbial agent obtained in step S2 to the red sour soup puree obtained in step S1, fermenting, and preparing high-acidity and low-nitrite red sour soup after post-ripening.

8. The preparation method according to claim 7, characterized in that: The pretreatment in step S1 is to wash tomatoes, peppers, ginger and garlic and mix them with glutinous rice flour, edible salt and white wine to make pulp.

9. The preparation method according to claim 7, characterized in that: The volume ratio of the Lactobacillus plantarum culture to the Pichia pastoris culture in step 2 is 1-3:1-3.

10. The red sour soup prepared by the preparation method according to any one of claims 7 to 9, characterized in that: The acidity of the red sour soup is higher than 20 mg / g, and the nitrite content is lower than 10 mg / kg by weight.

Images