Patient-derived gastrointestinal stromal tumor organoid culture medium based on SCF functional nucleic acid simulant and application of patient-derived gastrointestinal stromal tumor organoid culture medium

Abstract

The invention discloses a patient-derived gastrointestinal stromal tumor organoid culture medium based on an SCF functional nucleic acid simulant and application of the patient-derived gastrointestinal stromal tumor organoid culture medium, and belongs to the technical field of tumor organoid culture. The patient-derived gastrointestinal stromal tumor organ culture medium based on the SCF functional nucleic acid simulant can effectively improve the nutrient composition proportion of the gastrointestinal stromal tumor organ culture medium, supports rapid growth and self-assembly of gastrointestinal stromal tumor organs, promotes tissue fibroblasts to be converted into tumor-related fibroblasts, and improves the survival rate of the tumor-related fibroblasts. The tumor microenvironment can be highly simulated, the gastrointestinal stromal tumor organ with the diameter of more than 300 microns and vigorous growth vigor can be obtained within 8-12 days, and long-term subculture can be carried out; cultured gastrointestinal stromal tumor organs are highly consistent with tumor tissue pathological phenotypes and histochemical characteristics of patients from the organs, and the method can be used for clinical drug sensitivity assessment and basic scientific research of gastrointestinal stromal tumors; and the culture medium is better in stability and lower in cost.

Description

Technical Field

[0001] The present invention relates to the technical field of tumor organoid culture, and in particular to a patient-derived gastrointestinal stromal tumor organoid culture medium based on SCF functional nucleic acid mimics and an application thereof. Background Art

[0002] Gastrointestinal stromal tumor (GIST) is the most common mesenchymal tumor of the gastrointestinal tract. It originates from the pacemaking interstitial cells of Cajal (ICC) and homologous multipotent mesenchymal stem cells in the gastrointestinal muscular layer. More than 85% of GISTs are driven by KIT / PDGFRA gene mutations and have relatively malignant clinical manifestations. There are no obvious symptoms in the early stage of the disease, and the clinical stage is often late when diagnosed, with a poor prognosis.

[0003] According to retrospective analysis of large amounts of data, the five-year overall survival rate of patients who undergo complete resection surgery is only 32% to 63%, and 60% to 85% of patients will have liver and peritoneal metastases. Although the small molecule inhibitor imatinib mesylate of KIT and PDGFR-α can control the condition of most patients with gastrointestinal stromal tumors, imatinib is difficult to completely cure, and more than 50% of patients will gradually become resistant to drugs under 2 to 3 years of drug intervention (median progression-free survival PFS 20.4 months). The response rates of second-line and third-line treatment drugs sunitinib, regorafenib, and ripretinib are only 7.0%, 4.5%, and 9.4%, respectively. The individual heterogeneity of patients is strong, and the average drug inefficiency is high. Therefore, it is necessary to find a suitable drug screening model to meet the needs of personalized treatment for patients with gastrointestinal stromal tumors.

[0004] Patient-derived tumor organoids (PDTOs) are multicellular miniature tumors formed by in vitro three-dimensional culture of human tumor cells obtained from surgery, biopsy, and CTC sorting on an extracellular matrix. Their spatial organizational structure is similar to that of the original tumor tissue, and they have the ability to self-renew and self-organize. They can highly restore the drug sensitivity heterogeneity and molecular genetic characteristics of the patient's tumor, and can maintain genomic stability through long-term passage.

[0005] PDTOs have been validated as drug screening models and disease research models in the culture systems of multiple epithelial cancer subtypes. However, there are currently few culture media and culture methods for gastrointestinal stromal tumor organoids derived from mesenchymal cells. The cultured organoids grow slowly and are small in size, which requires increased time investment costs and is not suitable for rapid large-scale clinical drug screening. Therefore, it is necessary to develop a new culture medium for gastrointestinal stromal tumor organoid culture to address the shortcomings of existing technologies. Summary of the invention

[0006] The purpose of the present invention is to provide a patient-derived gastrointestinal stromal tumor organoid culture medium based on SCF functional nucleic acid mimics and its application. The provided culture medium has low cost, the cultured gastrointestinal stromal tumor organoids grow rapidly, and the cultured gastrointestinal stromal tumor organoids are highly consistent with the patient's tumor tissue pathological phenotype and histochemical characteristics, and are suitable for rapid large-scale clinical drug screening.

[0007] To achieve the above-mentioned purpose, the present invention provides a patient-derived gastrointestinal stromal tumor organoid culture medium based on SCF functional nucleic acid mimics, the components of which include: Advanced DMEM / F12 culture medium, TheraPEAKMSCGM culture medium, Wnt3a, HEPES buffer, GlutaMAX, N-acetylcysteine, disodium succinate, nicotinamide, MEM-NEAA solution, B27 additive, primary antibiotic Primocin, Antibiotic-Antimycotic antibiotic, vascular epidermal growth factor VEGF, fibroblast growth factor FGF4, transforming growth factor TGF-β1, platelet-derived growth factor PDGF-CC, insulin-like growth factor IGF-1, R-spondin1, ML-099, Y-27632 and SCF functional nucleic acid.

[0008] Preferably, Advanced DMEM / F12 medium accounts for 60-87.5% of the volume of the medium, TheraPEAKMSCGM medium accounts for 10-30% of the volume of the medium, GlutaMAX additive accounts for 0.5-2% of the volume of the medium, B27 additive accounts for 1-4% of the volume of the medium, MEN-NEAA solution accounts for 0.5-2.5% of the volume of the medium, Antibiotic-Antimycotic antibiotics account for 0.5-2% of the volume of the medium, disodium succinate content is 1-2mM, N-acetylcysteine ​​content is 1-2mM, nicotinamide content is 1-2mM, HEPES buffer is 1-2mM, The content of the flushing solution is 5-10mM, the content of the primary antibiotic Primocin is 50-100μg / mL, the content of the vascular epidermal growth factor VEGF is 10-25ng / mL, the content of the fibroblast growth factor FGF4 is 10-50ng / mL, the content of the transforming growth factor TGF-β1 is 10-25ng / mL, the content of the platelet-derived growth factor PDGF is 25-50ng / mL, the content of the hepatocyte growth factor HGF is 25-50ng / mL, the content of the insulin-like growth factor IGF-1 is 25-50ng / mL, the content of Wnt3a is 100-250ng / mL, the content of R-spondin 1 is 100-250ng / mL, the content of ML-099 is 50-250nM, the content of Y-27632 is 5-10μM, and the content of the SCF functional nucleic acid mimetic is 2.5-25nM.

[0009] Preferably, Advanced DMEM / F12 medium accounts for 66% of the volume of the medium, TheraPEAK MSCGM medium accounts for 25% of the volume of the medium, GlutaMAX additive accounts for 1% of the volume of the medium, B27 additive accounts for 2% of the volume of the medium, MEN-NEAA solution accounts for 1% of the volume of the medium, Antibiotic-Antimycotic antibiotics account for 1% of the volume of the medium, the content of disodium succinate is 1mM, the content of N-acetylcysteine ​​is 1mM, the content of nicotinamide is 1.25mM, the content of HEPES buffer is 10mM, the content of primary antibiotic Primocin is 100μg / mL, the content of vascular epidermal growth factor VEGF is The content of hepatocyte growth factor HGF was 25ng / mL, the content of fibroblast growth factor FGF4 was 50ng / mL, the content of transforming growth factor TGF-β1 was 25ng / mL, the content of platelet-derived growth factor PDGF-CC was 50ng / mL, the content of insulin-like growth factor IGF-1 was 50ng / mL, the content of Wnt3a was 200ng / mL, the content of R-spondin1 was 200ng / mL, the content of ML-099 was 100nM, the content of Y-27632 was 10μM, and the content of SCF functional nucleic acid mimetic was 25nM.

[0010] Preferably, the platelet-derived growth factor PDGF is a platelet-derived growth factor PDGF-CC that can specifically bind to PDGFR-α and PDGFR-β and induce PDGF-α / α and PDGF-α / β homo- and hetero-dimers.

[0011] Preferably, the SCF functional nucleic acid is a stem cell growth factor mimetic, including Ap-Kit1 and Ap-Kit2, the sequence of Ap-Kit1 is shown in SEQ ID NO.1, and the sequence of Ap-Kit2 is shown in SEQ ID NO.2.

[0012] The preparation method of the SCF functional nucleic acid as described above comprises the following steps:

[0013] S1. Dissolve monovalent nucleic acid aptamer Ap-Kit-1 and Ap-Kit-2 dry powders in Merck Milli-Q ultrapure water in a sterile operating table. After complete dissolution, adjust to appropriate concentrations with 1× PBS buffer, heat at 95°C for 5 minutes, and then quickly transfer to ice for half an hour. Mix equal volumes of PBS solutions of Ap-Kit-1 and Ap-Kit-2 and shake at room temperature to obtain a solution of divalent nucleic acid aptamer Ap-Kit-1+2.

[0014] S2, connecting the obtained bivalent nucleic acid aptamer Ap-Kit-1+2 solution with T4 ligase, and digesting the ligation product with exonuclease I and exonuclease III to obtain the SCF functional nucleic acid primary product;

[0015] S3. Purify the obtained SCF functional nucleic acid primary product to obtain a divalent cyclized nucleic acid aptamer, namely, SCF functional nucleic acid.

[0016] Preferably, the 1×PBS buffer in step S1 contains 3 mM MgCl2, has a pH of 7.4, and a suitable concentration of 40 μM.

[0017] Preferably, the T4 ligase system in step S2 is prepared according to the instructions of T4 ligase, and the ligation conditions are: reaction at 16°C for 12 hours, and reaction at 75°C for 10 minutes after the ligation to inactivate the T4 ligase; the enzyme digestion conditions are: reaction at 37°C for 1 hour, and then reaction at 90°C for 10 minutes to inactivate the enzyme; the purification in step S3 is performed using EasyPure PCR Purification Kit.

[0018] A method for culturing gastrointestinal stromal tumor organoids using the above-mentioned patient-derived gastrointestinal stromal tumor organoid culture medium based on SCF functional nucleic acid mimics, comprising the following steps:

[0019] (1) Prepare gastrointestinal stromal tumor tissue digestion solution I and gastrointestinal stromal tumor tissue digestion solution II at the following concentrations:

[0020] Tissue digestion solution I: Advanced DMEM / F12 medium supplemented with complex digestive enzyme Liberase TH 1 mg / mL, Dispase 5 mg / mL, heparin sodium 0.5 mM, 1×Primocin 100 μg / mL, Y-27632 10 μM, 1×Antibiotic-Antimycotic;

[0021] Tissue digestion solution II: Advanced DMEM / F12 medium supplemented with Liberase TH 1 mg / mL, Hyaluronidase 20 μg / mL, Heparin sodium 0.5 mM, 0.05% Trypsin, 1× Antibiotic-Antimyc otic, Primocin 100 μg / mL, Y-27632 10 μM;

[0022] (2) Remove fresh gastrointestinal stromal tumor tissue from 4°C tissue preservation solution, rinse with pre-cooled DPBS buffer and transfer into a 5 mL centrifuge tube. Add 3 times the volume of red blood cell lysis buffer to the tube. Place on ice for 15 min and vortex evenly. Centrifuge at 300 g for 5 min and discard the supernatant.

[0023] (3) Use a surgical blade and forceps to remove as much fat and black necrotic tissue as possible, add 2 mL of tissue digestion solution I to infiltrate the tissue, and cut the tumor tissue into 1-2 mm pieces on a sterile culture dish. 3 Transfer the tissue pieces and digestion solution to a 5 mL centrifuge tube.

[0024] (4) Add another 2 mL of tissue digestion solution I and shake the digestion in a constant temperature shaker at 37°C and 100 rpm. Aspirate 1 mL of the turbid digestion solution supernatant every 20-30 min and place on ice. Add an equal volume of tissue digestion solution I and continue digestion until the granular tissue pieces disappear.

[0025] (5) filtering the tissue suspension and the digestion supernatant aspirated in advance through an 80-mesh cell sieve, collecting the cell suspension and terminating the digestion with an equal volume of a patient-derived gastrointestinal stromal tumor organoid culture medium based on SCF functional nucleic acid mimics containing 5% serum;

[0026] (6) Rinse with tissue digestion solution II and recover the cell clumps that failed to pass through the cell sieve, continue digestion at 37°C and 100 rpm on a shaker for 10 min, filter the cell suspension again through the cell sieve, add an equal volume of patient-derived gastrointestinal stromal tumor organoid culture medium based on SCF functional nucleic acid mimics containing 5% serum to terminate digestion, and combine the cell suspensions obtained from the two digestions;

[0027] (7) Use a T20 automatic cell counter to count the total number of live cells in the sieved tissue suspension, and concentrate by centrifugation to ensure that each 1 μL of the suspension contains more than 20,000 cells;

[0028] (8) Mix the liquid matrix gel and the concentrated gastrointestinal stromal tumor suspension evenly on an ice box to ensure that the matrix gel ratio is >75%, and spread the gel droplets into a preheated 24-well cell culture plate at an inoculation volume of 50 μL per well, and place it in a 37°C cell culture incubator to wait for the matrix gel to solidify;

[0029] (9) After the gel drop solidifies, add 500 μL of preheated SCF functional nucleic acid mimic-based patient-derived gastrointestinal stromal tumor organoid culture medium to each well to cover the matrix gel and return to the 37°C, 5% CO2 incubator for continued culture;

[0030] (10) The culture medium was replaced every 3 days, and the organoid culture status was monitored in real time for timely subculturing.

[0031] A use of the patient-derived gastrointestinal stromal tumor organoid culture medium based on the SCF functional nucleic acid mimetic as described above in tumor organoid culture.

[0032] TheraPEAK MSCGM Medium (Lonza, Cat#BEBP18-936) is a chemically defined serum-free human mesenchymal stem cell culture medium that can support multiple passages of human tumor mesenchymal stem cells and maintain their differentiation potential.

[0033] Stem cell factor (SCF) is a cytokine with a wide range of biological activities. As a ligand, it can bind to the receptor tyrosine kinase C-KIT and induce homodimerization of the C-KIT receptor, thereby activating multiple downstream cell pathways such as RTK-Ras-Erk, PI3K-Akt-mTOR, and JAK-STATs, and promoting the survival and proliferation of gastrointestinal stromal tumor cells. The activation of SCF / C-KIT plays a vital role in the development, differentiation, phenotype, and functional maintenance of gastrointestinal stromal tumors and their precursors, gastrointestinal Cajal interstitial cells. In addition, stem cell growth factor SCF also upregulates the expression and transcription of hypoxia-inducible factor H1F-α in gastrointestinal stromal tumor cells, activates the hypoxia response pathway, and further induces the secretion and release of tumor-related cytokines VEGF and FGF, promoting the growth and self-assembly of gastrointestinal stromal tumor organoids.

[0034] SCF functional nucleic acid is a new type of SCF mimetic, composed of nucleic acid aptamers Ap-Kit-1 and Ap-Kit-2, and is cyclized by T4 ligase. It can simulate SCF activity and activate the KIT signaling pathway. This self-developed SCF functional nucleic acid can replace the expensive recombinant protein SCF, promote the proliferation of gastrointestinal stromal tumor cells, and save costs.

[0035] TGF-β1 is a type of pleiotropic cytokine in the TGF-β superfamily, which plays an important role in cell proliferation, differentiation, and immune regulation. In the synergistic condition with growth factors such as FGF, the addition of TGF-β1 can further promote the proliferation and growth of mesenchymal stem cells. Studies have reported that TGF-β1 can transform gastric fibroblasts around gastrointestinal stromal tumors into cancer-associated fibroblasts (CAFs), upregulate the expression of cytokines such as PDGF-CC and FGF, and significantly enhance the FAK-PI3K-AKT, JAT-STAT-JUN and other pathway signals in gastrointestinal stromal tumor cells, promoting the proliferation, migration and growth of gastrointestinal stromal tumor organoid cells.

[0036] Vascular endothelial growth factor (VEGF) is a highly specific mitogen for vascular endothelial cells. It plays an important role in angiogenesis and vascular permeability in solid tumors. The VEGF concentration in gastrointestinal stromal tumor tissue is highly positively correlated with tumor metastasis ability, cell proliferation activity, microvessel density, and tumor size. In addition, VEGF can also activate the PI3K-AKT pathway by binding to the VEGFR2 receptor, thereby improving the survival ability of gastrointestinal stromal tumor cells.

[0037] PDGF-CC is a ligand of type III receptor tyrosine kinase PDGFR. It can specifically bind to PDGFR-α subunit to trigger receptor dimerization, activate PDGFRA signaling pathway, and then activate multiple downstream intracellular signaling cascades, promote mitosis and directional migration of mesenchymal stem cells, induce angiogenesis, and epithelial-mesenchymal transition. In gastrointestinal stromal tumor tissue, PDGF-CC over-secreting by tumor-associated fibroblasts can easily cause overexpression of EMT transcription factor SLUG, accelerate the proliferation, erosion, and migration of gastrointestinal stromal tumor cells, and enhance tumor drug resistance.

[0038] ML-099 is a GTPase activator of pan-Ras-related proteins. It can enhance the activated RTK-RAS-Raf signal by increasing the affinity of GTPases in tumor cells for guanine nucleotides, thereby improving the cell viability of gastrointestinal stromal tumor organoids and promoting the self-renewal of organoids.

[0039] GlutaMax, N-acetylcysteine, nicotinamide, B27, MEM-NEAA, and disodium succinate are all nutritional additives for culture media. GlutaMax is a dipeptide amino acid of L-alanyl-L-glutamine. As a nitrogen source with stable properties and high water solubility, it is an essential precursor for the synthesis of nucleic acids and plays an important role in the body's immune function and wound repair. Nicotinamide is vitamin B3, which participates in a variety of enzymatic redox reactions. It can promote the self-renewal of tumor organoids by inhibiting sirtuins, and has anti-inflammatory effects. N-acetylcysteine, as an antioxidant, can remove ROS in cells, inhibit cell aging and apoptosis, and improve the cell viability of long-term passage and expansion of organoids. MEM-NEAA solution contains a variety of non-essential amino acids and vitamins such as serine, proline, and L-aspartic acid, which can be used as Nutritional additives can effectively improve the proportion of cell culture medium, reduce the metabolic burden of cell synthesis in vitro, prolong the vitality of cultured cells, and stimulate cell proliferation and growth; B27 additives contain biotin, human transferrin, insulin, progesterone, sodium selenite, putrescine and other antioxidant ingredients and serum-free culture factors, which support the long-term survival and high-density growth of organoids under serum-free conditions; succinic acid is an intermediate metabolite of the tricarboxylic acid cycle. The accumulation of succinic acid in cells will inhibit the activity of dioxygenases and the occurrence of their enzymatic reactions, causing epigenetic changes in cells, thereby activating the HIF and FGFR pathways of the hypoxia response pathways of gastrointestinal stromal tumor cells, and promoting the survival, proliferation, invasion and metastasis of tumor cells. Succinic acid in the tumor microenvironment can also mediate SUCNR1 and GPR91 signals to cause the activation of downstream STAT3 and ERK1 / 2 signaling pathways, and increase the content of intracellular calcium ions and prostaglandin E2.

[0040] Therefore, the present invention provides a patient-derived gastrointestinal stromal tumor organoid culture medium based on SCF functional nucleic acid mimics and its application, and its specific technical effects are as follows:

[0041] (1) The gastrointestinal stromal tumor organoid culture medium of the present invention uses GlutaMAX, N-acetylcysteine, nicotinamide, B27, MEM-NEAA, and disodium succinate as nutrient additives of the culture medium, VEGF, PDGF-CC, FGF4, IGF-1, TGF-β1, and SCF functional nucleic acids as gastrointestinal stromal tumor-specific growth factors, and ML-099 as a component combination of RAS-related pathway agonists, which can effectively improve the nutrient composition ratio of the gastrointestinal stromal tumor organoid culture medium, support the rapid growth and self-assembly of gastrointestinal stromal tumor organoids, promote the transformation of tissue's own fibroblasts into tumor-associated fibroblasts, and highly simulate the tumor microenvironment; using the gastrointestinal stromal tumor organoid culture medium of the present invention, gastrointestinal stromal tumor organoids with a diameter of more than 300 μm and vigorous growth can be obtained within 8 to 12 days, and can be subcultured for a long time;

[0042] (2) The gastrointestinal stromal tumor organoid culture medium and organoid construction method of the present invention can obtain gastrointestinal stromal tumor organoids that are highly consistent with the pathological phenotype and histochemical characteristics of the tumor tissue of the patient from which they originated, and can be used for clinical drug sensitivity evaluation and basic scientific research of gastrointestinal stromal tumors;

[0043] (3) The present invention adopts a novel SCF nucleic acid mimetic to replace expensive recombinant proteins. The novel nucleic acid mimetic is composed of nucleic acid aptamers Ap-Kit-1 and Ap-Kit-2, and is formed by cyclization by T4 ligase. It can simulate SCF activity, activate C-KIT receptor, activate RTK-RAS-MAPK pathway, and has resistance to exonuclease degradation. It has higher stability, can better simulate the function of C-KIT ligand, promote the growth of gastrointestinal stromal tumor cells and save costs.

[0044] The technical solution of the present invention is further described in detail below through the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for use in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying creative labor.

[0046] Figure 1 These are inverted microscope photos of gastrointestinal stromal tumor organoids cultured on the 4th, 8th, and 16th days in Example 1, where 10× means 10 times magnification and 20× means 20 times magnification;

[0047] Figure 2 These are inverted microscope photos of gastrointestinal stromal tumor organoids cultured on the 4th, 8th, and 16th days in Example 2, where 10× means 10 times magnification and 20× means 20 times magnification;

[0048] Figure 3 These are inverted microscope photos of gastrointestinal stromal tumor organoids cultured on the 4th, 8th, and 16th days in Comparative Example 1, where 10× means 10 times magnification and 20× means 20 times magnification;

[0049] Figure 4 These are inverted microscope photos of gastrointestinal stromal tumor organoids cultured on the 4th, 8th, and 16th days in Comparative Example 2, where 10× means 10 times magnification and 20× means 20 times magnification;

[0050] Figure 5The results of the gastrointestinal stromal tumor organoid proliferation activity detection of Example 1 (SCF functional nucleic acid group), Example 2 (SCF recombinant protein group), and Comparative Example 1 (blank control group) in Experiment Test 1;

[0051] Figure 6 This is an identification diagram of HE and IHC staining of CD117 and DOG-1 of gastrointestinal stromal tumor organoids cultured in Examples 1 and 2 in Experimental Test 2. DETAILED DESCRIPTION

[0052] The technical solution of the present invention is further described below through the accompanying drawings and embodiments.

[0053] In order to make the purpose, technical scheme and advantages of the present application clearer, more thorough and more complete, the technical scheme of the present invention is clearly and completely described below through the accompanying drawings and examples. The following detailed descriptions are all descriptions of the embodiments, and are intended to provide further detailed descriptions of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meaning as those generally understood by those skilled in the art to which the present application belongs.

[0054] The instruments, equipment, reagents and materials used in the examples were all obtained through commercial channels.

[0055] Example 1

[0056] A gastrointestinal stromal tumor organoid culture medium is prepared and an in vitro organoid culture is performed, and the specific steps are as follows:

[0057] S1.1. Preparation of SCF functional nucleic acid:

[0058] (1) In a sterile operating table, monovalent nucleic acid aptamer Ap-Kit-1 (sequence as shown in SEQ ID NO.1) and Ap-Kit-2 (sequence as shown in SEQ ID NO.2) dry powders were prepared into 100 μM solutions respectively using Merck Milli-Q ultrapure water. After complete dissolution, 12 μL of Ap-Kit-1 and Ap-Kit-2 solutions were respectively drawn into new sterile centrifuge tubes, and 18 μL of 1× PBS buffer (PH=7.4) containing 3 mM MgCl2 was added respectively. The mixtures were fully mixed to obtain 40 μM Ap-Kit-1 solution and 40 μM Ap-Kit-2 solution. The mixtures were then heated in a 95°C metal bath for 5 min, and then quickly transferred to ice for half an hour. The PBS solutions of Ap-Kit-1 and Ap-Kit-2 were mixed and shaken at room temperature for 15 min to obtain a solution of bivalent nucleic acid aptamer Ap-Kit-1+2.

[0059] (2) The obtained solution of bivalent nucleic acid aptamer Ap-Kit-1+2 was connected with T4 ligase. The connection system was prepared according to the instructions attached to T4 ligase, and the reaction was carried out at 16°C for 12 hours. After the connection was completed, the reaction was carried out at 75°C for 10 minutes to inactivate T4 ligase. The connection product was added with 20 μL of exonuclease I (5U / μL) and 1 μL of exonuclease III (200U / μL) and mixed evenly, and placed in a PCR instrument for reaction. The reaction conditions were: 37°C for 1 hour, followed by 90°C for 10 minutes to inactivate exonuclease I, and the SCF functional nucleic acid initial product was obtained.

[0060] (3) The obtained SCF functional nucleic acid initial product was purified using EasyPure PCR Purification Kit. All operations were performed according to the manufacturer's instructions to remove impurities such as enzymes and inorganic salt ions, namely, SCF functional nucleic acid.

[0061] SEQ ID NO.1:

[0062] CTGTAGAACGTTAGGGGCCGGGGCAAGGGGGGGGTACCGTGGTAGGAC

[0063] SEQ ID NO.2:

[0064] TAACGTTCTACAGGGGCCGGGGCAAGGGGGGGGTACCGTGGTAGGAC

[0065] S1.2. Prepare the culture medium component stock and prepare a gastrointestinal stromal tumor organoid culture medium.

[0066] Use ultrapure water and DMSO solvent to prepare the stock solutions of each culture medium component in a strictly sterile environment. The concentrations of the stock solutions of each component are as follows:

[0067] Disodium succinate 100mM, HEPES buffer 1M, N-acetylcysteine ​​100mM, nicotinamide 125mM, VEGF 25μg / mL, FGF450μg / mL, HGF 25μg / mL, IGF-150μg / mL, PDGF-CC 50μg / mL, TGF-β125μg / mL, Wnt3a 200μg / mL, R-spondin 1

[0068] 200μg / mL, Y-2763210mM, primary antibiotic Primocin 50mg / mL, ML-099100μM, SCF functional nucleic acid 25μM.

[0069] Prepare 650 mL Advanced DMEM / F12 medium, add 250 mL TheraPEAK MSCGM medium, 10 mL GlutaMAX supplement, 20 mL B27 supplement, 10 mL MEM-NEAA solution, 10 mL Antibiotic-Antimycotic antibiotic (100×), 10 mL N-acetylcysteine ​​stock solution, 10 mL nicotinamide stock solution, 10 mL disodium succinate stock solution, 10 mL HEPES stock solution, 1 mL VEGF stock solution, 1 mL FGF4 stock solution, 1 mL HGF stock solution, 1 mL Wnt3a stock solution, 1 mL R-spondin stock solution, 1 mL IGF-1 stock solution, 1 mL PDGF-CC stock solution, 1 mL TGF-β1 stock solution, 2 mL primary antibiotic primocin stock solution, 1 mL ML-099 stock solution, 1 mL y-27632 stock solution, 1 mL SCF functional nucleic acid stock solution, mix well and use Advanced The volume of DMEM / F12 medium was adjusted to 1 L, filtered through a 0.22 μM filter membrane for sterilization, and stored at 4°C in the dark.

[0070] S1.3, using the gastrointestinal stromal tumor organoid culture medium prepared in step S1.2 to culture the patient-derived gastrointestinal stromal tumor tissue in vitro, the specific steps are as follows:

[0071] (1) Prepare gastrointestinal stromal tumor tissue digestion solution I and gastrointestinal stromal tumor tissue digestion solution II at the following concentrations.

[0072] Tissue digestion solution I: Add 100 mg Liberase TH, 50 mg Dispase, 7.7 mg DL-dithiothreitol, 1 mL Penicillin-Streptomycin, 10 mg Primocin, and 0.28 mg Y-27632 to 90 mL Advanced DMEM / F12 medium. Stir to dissolve the components, then make up to 100 mL with Advanced DMEM / F12 medium, filter and sterilize with 0.22 μM filter membrane, and store at 4°C in the dark.

[0073] Tissue digestion solution II: Add 100 mg Liberase TH, 2 mg Hyaluronidase, 7.7 mg DL-dithi othreitol, 0.25 mL Trypsin, 1 mL Penicillin-Streptomycin dual antibody, 10 mg Primocin, and 0.28 mg Y-27632 to 90 mL Advanced DMEM / F12 medium. Stir to dissolve the components, then make up to 100 mL with Advanced DMEM / F12 medium. Filter and sterilize with a 0.22 μM filter membrane and store at 4°C away from light.

[0074] (2) Take out 2 soybean-sized pieces (about 0.5-1 g) of fresh gastrointestinal stromal tumor tissue from the 4°C tissue preservation solution, rinse with pre-cooled DPBS buffer and transfer into a 5 mL centrifuge tube. Add 2.5 mL of red blood cell lysis buffer, place on ice for 15 min, vortex evenly, centrifuge at 300 g for 5 min, and discard the supernatant.

[0075] (3) Use a surgical blade and forceps to remove as much fat and black necrotic tissue as possible, add 2 mL of tissue digestion solution I to infiltrate the tissue, and cut the tumor tissue into 1-2 mm pieces on a sterile culture dish. 3 Transfer the tissue pieces and digestion solution into a 5 mL centrifuge tube.

[0076] (4) Add another 2 mL of tissue digestion solution I and shake the digestion in a constant temperature shaker at 37°C and 100 rpm. Aspirate 1 mL of the turbid digestion solution supernatant every 20-30 min and place on ice. Add an equal volume of tissue digestion solution I and continue digestion until the granular tissue pieces disappear.

[0077] (5) Filter the tissue suspension and the digestion supernatant aspirated in advance through an 80-mesh stainless steel cell sieve (pore size 0.2 mm), collect the cell suspension and terminate the digestion with an equal volume of gastrointestinal stromal tumor organoid culture medium prepared in step S1.1 containing 5% fetal bovine serum.

[0078] (6) Rinse with tissue digestion solution II and recover the cell clumps that failed to pass through the cell sieve, continue digestion at 37°C, 100 rpm in a shaking incubator for 10 min, filter again with an 80-mesh cell sieve, collect the cell suspension, add an equal volume of gastrointestinal stromal tumor organoid culture medium prepared in step S1.2 containing 5% fetal bovine serum to terminate digestion, and combine the cell suspensions obtained from the two digestions.

[0079] (7) Use a T20 automated cell counter to count the total number of live cells in the sieved tissue suspension and concentrate by centrifugation to ensure that each 1 μL of the suspension contains more than 20,000 cells.

[0080] (8) Mix the liquid matrix gel and concentrated gastrointestinal stromal tumor suspension evenly on an ice box to ensure that the matrix gel ratio is >75%. Spread the gel droplets into a 24-well cell culture plate preheated at 37°C at a volume of 50 μL per well and place the plate in a 37°C cell culture incubator to wait for the matrix gel to solidify.

[0081] (9) After the gel drop solidifies, add 500 μL of preheated gastrointestinal stromal tumor organoid culture medium to each well to cover the matrix gel and return to the incubator at 37°C and 5% CO2 for continued culture.

[0082] (10) The culture medium was replaced every 3 days, and the organoid culture status was monitored in real time for timely subculturing.

[0083] The cultured gastrointestinal stromal tumor organoids were observed using an inverted microscope on the 4th, 8th, and 16th days of culture. Figure 1 As shown, the culture medium and culture method of this embodiment can be used to quickly construct gastrointestinal stromal tumor organoids. After only 4 days of culture, the organoid size reached 265-285 μm. With continued culture, the organoid size increased further. On the 8th day of culture, the size reached 340-410 μm, and on the 16th day, the diameter could reach 480-510 μm. The cultured organoid cells had good cohesion, and were dense solid spheres or ellipsoids with clear boundaries and good growth activity.

[0084] Example 2

[0085] A gastrointestinal stromal tumor organoid culture medium is prepared and an in vitro organoid culture is performed, and the specific steps are as follows:

[0086] S2.1. Prepare a gastrointestinal stromal tumor organoid culture medium, the components of which are exactly the same as those of the gastrointestinal stromal tumor organoid culture medium prepared in step S1.2 of Example 1, except that the SCF functional nucleic acid is replaced with a commercial 25 nM SCF recombinant protein.

[0087] S2.2. Using the gastrointestinal stromal tumor organoid culture medium prepared in step S2.1, perform in vitro organoid culture on the gastrointestinal stromal tumor tissue derived from the patient. The culture method is exactly the same as step S1.3 of Example 1.

[0088] The cultured gastrointestinal stromal tumor organoids were observed using an inverted microscope on the 4th, 8th, and 16th days of culture. Figure 2As shown, using the culture medium and culture method of this embodiment, the size of the obtained organoids is not significantly different from that of Example 1. On the 4th day of culture, the size of the organoids reaches 265-285 μm. With continued culture, the size of the organoids further increases. On the 8th day, the size reaches 355-385 μm, and on the 16th day, it can reach 400-465 μm. The organoid cells have good cohesion, appearing as dense solid spheres or ellipsoids, with clear boundaries and good growth activity. It shows that the use of the SCF functional nucleic acid provided by the present invention can achieve the same effect as the commercial SCF recombinant protein.

[0089] Example 3

[0090] A gastrointestinal stromal tumor organoid culture medium was prepared, wherein the components were the same as those of the gastrointestinal stromal tumor organoid culture medium prepared in step S1.2 of Example 1, except that the SCF functional nucleic acid was not added.

[0091] Comparative Example 1

[0092] A gastrointestinal stromal tumor organoid culture medium is prepared and an in vitro organoid culture is performed, and the specific steps are as follows:

[0093] (1) A gastrointestinal stromal tumor organoid culture medium was prepared, wherein the components were identical to those of the gastrointestinal stromal tumor organoid culture medium prepared in step S1.2 of Example 1, except that the SCF functional nucleic acid was not added.

[0094] (2) Using the gastrointestinal stromal tumor organoid culture medium prepared in step (1), the patient-derived gastrointestinal stromal tumor tissue is cultured in vitro, and the culture method is exactly the same as step S1.2 of Example 1.

[0095] The gastrointestinal stromal tumor organoids cultured in Examples 1 and 2 and Comparative Example 1 were observed using an inverted microscope on the 4th, 8th and 16th days of culture, respectively. Figure 3 As shown, the organoids cultured in Comparative Example 1 grew slower than those in Example 1, and the size of the organoids was significantly smaller than those in Example 1 and Example 2. On the 4th day of culture, the size of the organoids was 150-180 μm, on the 8th day of culture, the size of the organoids was 230-295 μm, and on the 16th day, the size of the organoids was 315-395 μm.

[0096] Comparative Example 2

[0097] A gastrointestinal stromal tumor organoid culture medium is prepared and an in vitro organoid culture is performed, and the specific steps are as follows:

[0098] (1) A gastrointestinal stromal tumor organoid culture medium was prepared, wherein the components were the same as those of the gastrointestinal stromal tumor organoid culture medium prepared in step S1.2 of Example 1, except that SCF functional nucleic acid, TGF-β1, and VEGF were not added.

[0099] (2) Using the gastrointestinal stromal tumor organoid culture medium prepared in step (1), the patient-derived gastrointestinal stromal tumor tissue is cultured in vitro, and the culture method is exactly the same as step S1.2 of Example 1.

[0100] The cultured gastrointestinal stromal tumor organoids were observed using an inverted microscope on the 4th, 8th, and 16th days of culture. Figure 4 As shown, the organoids cultured in this comparative example grew slowly and had poor activity. The size of the organoids was significantly smaller than that of Example 1, Example 2, and Comparative Example 1. On the 4th day of culture, the size of the organoids was 90-95 μm, on the 8th day of culture, the size of the organoids was 145-155 μm, and on the 16th day, it was 214-240 μm.

[0101] Experimental Test 1

[0102] The effects of the gastrointestinal stromal tumor organoid culture medium prepared in Example 1 (SCF functional nucleic acid), Example 2 (SCF recombinant protein) and Comparative Example 1 (blank control without SCF addition) on the viability of gastrointestinal stromal tumor organoid cells were investigated. The specific steps are as follows:

[0103] (1) A sufficient amount of gastrointestinal stromal tumor organoids were constructed according to the method of step S1.3 of Example 1. After 12 days of primary culture, 15 wells of organoids with good growth (organoid morphology was good, and the total number of organoids was ≥ 1350) were selected, and the matrix gel was removed using the organoid recovery solution Cell recovery solution.

[0104] (2) Centrifuge at 300 g for 5 minutes to remove the supernatant, add 1 mL of tissue digestion solution II to the centrifuge tube, pipette up and down 10-15 times with a wide-mouth pipette tip, and incubate in a 37°C incubator for 3 minutes to ensure that the organoids are lysed into numerous dispersed and evenly distributed small cell clusters. Add Advanced DMEM / F12 medium containing 5% fetal bovine serum to terminate the digestion.

[0105] (3) Mix the organoid suspension evenly, divide it equally into 3 centrifuge tubes, and centrifuge at 300g for 5 minutes to remove the supernatant.

[0106] (4) Add 1.2 mL of the gastrointestinal stromal tumor organoid culture medium prepared in Example 1, Example 2 and Comparative Example 1 to each centrifuge tube, mix well by pipetting, and then inoculate into an ultra-low adsorption 96-well plate. Each test group is inoculated with 12 wells, with 100 μL in each well.

[0107] (5) The inoculated ultra-low adsorption 96-well plate was placed in a 37° C., 5% CO 2 incubator and incubated for different days (0 days, 4 days, 8 days, and 16 days). Three parallel wells were set up for each day, and the culture medium was replaced every 2 days.

[0108] (6) When the incubation time is up, transfer the organoid suspension in the ultra-low attachment 96-well plate to a black 96-well plate, add the activity detection reagent according to the instructions of the Cell-tiler glo kit, and measure the cell viability reading using a Tecon microplate reader.

[0109] (7) Taking the organoid cell viability on day 0 as 100%, calculate and plot the organoid cell viability. Figure 5 As shown, compared with the gastrointestinal stromal tumor organoid culture medium without SCF in Comparative Example 1, the culture medium containing SCF functional nucleic acid mimics prepared in Example 1 has a significant effect of promoting the proliferation of gastrointestinal stromal tumor cells. As the incubation time of the organoids increases, the promoting effect on cell proliferation becomes more obvious, and there is no significant difference in the cell proliferation effect of the SCF functional nucleic acid mimic culture medium (Example 1) compared with the commercial SCF recombinant protein culture medium (Example 2).

[0110] Experimental Test 2

[0111] The immunohistochemical characteristics of the gastrointestinal stromal tumor organoids cultured in Examples 1 and 2 were investigated. The organoids obtained in Example 1 (SCF functional nucleic acid) and Example 2 (SCF recombinant protein) were embedded and sectioned, and then H&E staining and IHC staining of CD117 and DOG-1 were performed. The specific steps were as follows:

[0112] (1) Collection and fixation of organoids: The gastrointestinal stromal tumor organoids cultured in Example 1 and Example 2 were recovered from the matrix gel using an organoid recovery solution, fixed with 4% paraformaldehyde at room temperature for 4 h, and centrifuged at 4°C and 250 g to remove the fixative. PBS buffer was added again to rinse the organoid precipitate three times, and the precipitate was centrifuged again to retain the precipitate.

[0113] (2) Agarose embedding of organoids: Heat 3% agarose gel in a microwave oven until it is completely melted. When the agarose solution cools to 60°C, add 100 μL of agar solution to a 1.5 mL centrifuge tube to resuspend the organoid pellet, transfer it to a 200 μL mold, and place it on ice for 0.5 h to solidify.

[0114] (3) Dehydration and permeabilization: Remove the solidified agarose block containing the organoids and dehydrate it in graded ethanol: dehydrate in 70%, 80%, 90%, and 95% ethanol for 1 h, and dehydrate in 100% ethanol for 30 min. Transfer the dehydrated agarose block to a tissue embedding box, treat it with anhydrous ethanol and xylene mixture for 10 min, and then move it to xylene for treatment twice, each time for 10 min.

[0115] (4) Paraffin embedding: The permeabilized organoids were transferred to 60°C paraffin and immersed in wax for 3 h. They were then transferred to an embedding mold and embedded in wax. The wax blocks were prepared and trimmed.

[0116] (5) Dewaxing of sections: Fix the embedded wax block on a microtome, cut it into 5 μm thick slices, flatten it in a water bath and place it on a glass slide.

[0117] The sections were placed in fresh xylene in turn and soaked twice, each time for 12 minutes.

[0118] After removing excess liquid, soak in anhydrous ethanol twice, 3 min each time.

[0119] After removing excess liquid, place in 95% alcohol and soak for 6 minutes.

[0120] After removing excess liquid, place in 85% alcohol and soak for 6 minutes.

[0121] After rinsing with tap water for 1 min, the sections were washed three times in PBS buffer to complete dewaxing.

[0122] (6) H&E staining: stain with hematoxylin for 6 min, wash with distilled water for 1 min, then place in 1% hydrochloric acid alcohol for 2 s, then rinse with distilled water for 30 min, and then stain with 1% eosin for 2 min. After staining, rinse with running water, dehydrate and seal the slide.

[0123] (7) Antigen repair: Place the tissue sections in a repair box filled with citrate buffer (pH 6.0), heat at medium for 8 minutes, then stop for 8 minutes and heat at medium-low for 7 minutes. During this process, prevent the buffer from evaporating excessively and do not allow the slides to dry out. After cooling naturally, place the slides in PBS (pH 7.4) and wash them three times on a decolorizing shaker, each time for 5 minutes.

[0124] (8) Block endogenous peroxidase: Wipe off the PBS buffer, add 100 μL of endogenous peroxidase blocker, and incubate at room temperature for 20 min. After incubation, rinse the sections 3 times with PBS buffer.

[0125] (9) Serum blocking: Wipe the slides clean and add PBS buffer containing 5% serum from the same species as the secondary antibody to evenly cover the tissue and block at room temperature for 1 h.

[0126] (10) Antibody incubation: Remove the blocking solution with absorbent paper, add enough primary antibody to cover the tissue, and incubate at room temperature for 2 h. After incubation, wash the slides in PBS buffer for 3 times, 5 min each time. After removing the blocking solution with absorbent paper, add HRP ultrasensitive goat anti-rabbit and mouse universal secondary antibody to cover the tissue, and incubate at room temperature for 1 h.

[0127] (11) DAB color development: Place the slide in PBS buffer and shake on a decolorizing shaker for 3 times, 5 min each time. After absorbing the water with absorbent paper, add 100-200 μL of freshly prepared DAB color development solution and incubate at room temperature in a dark environment for 3-5 min. Monitor and control the color development time in real time under a microscope. When a brown-yellow positive reaction is observed, rinse the slide with pure water to stop the color development.

[0128] (12) Re-staining of cell nuclei: Stain with hematoxylin for about 2-3 min, rinse with pure water, differentiate with differentiation solution for 2 s, rinse with tap water, blue with bluing solution for 15-30 s, rinse with running water, dehydrate and seal the slide.

[0129] The antibody and dilution information are as follows:

[0130] Primary Antibody:

[0131] Rabbit anti-human CD117 antibody (MXB Cat#kit-0029) ready to use;

[0132] Rabbit anti-human DOG-1antibody (Imgenex Cat#IMG-80498) ready to use;

[0133] Secondary Antibody:

[0134] HRP ultrasensitive goat anti-rabbit and mouse universal secondary antibody (Haoke, HKI0029), ready to use;

[0135] The results are as follows Figure 6 As shown, the gastrointestinal stromal tumor organoids cultured in the SCF functional nucleic acid group culture medium prepared in Example 1 and the organoids cultured in the SCF recombinant protein group culture medium prepared in Example 2 were both spindle-shaped or mixed-type, and both CD117 and DOG-1 markers were positively expressed, which was consistent with the immunohistochemical characteristics of gastrointestinal stromal tumors.

[0136] Therefore, the patient-derived gastrointestinal stromal tumor organoid culture medium based on SCF functional nucleic acid mimics provided by the present invention can effectively improve the nutrient composition ratio of the gastrointestinal stromal tumor organoid culture medium, support the rapid growth and self-assembly of gastrointestinal stromal tumor organoids, promote the transformation of tissue's own fibroblasts into tumor-associated fibroblasts, and can highly simulate the tumor microenvironment. Gastrointestinal stromal tumor organoids with a diameter of more than 300 μm and vigorous growth can be obtained within 8 to 12 days, and can be subcultured for a long time; the cultured gastrointestinal stromal tumor organoids are highly consistent with the pathological phenotype and histochemical characteristics of the tumor tissues of the patients from which they are derived, and can be used for clinical drug sensitivity evaluation and basic scientific research of gastrointestinal stromal tumors; and the provided culture medium has better stability and lower cost.

[0137] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solution of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solution to deviate from the spirit and scope of the technical solution of the present invention.

Claims

1. A patient-derived gastrointestinal stromal tumor organoid culture medium based on SCF functional nucleic acid mimics, characterized in that: The components include: Advanced DMEM / F12 medium, TheraPEAKMSCGM medium, Wnt3a, HEPES buffer, GlutaMAX, N-acetylcysteine, disodium succinate, nicotinamide, MEM-NEAA solution, B27 additive, primary antibiotic Primocin, Antibiotic-Antimycotic antibiotic, vascular epidermal growth factor VEGF, fibroblast growth factor FGF4, transforming growth factor TGF-β1, hepatocyte growth factor HGF, platelet-derived growth factor PDGF, insulin-like growth factor IGF-1, R-spondin 1, ML-099, Y-27632 and functional nucleic acid mimic - SCF functional nucleic acid.

2. The patient-derived gastrointestinal stromal tumor organoid culture medium based on SCF functional nucleic acid mimics according to claim 1, characterized in that: Advanced DMEM / F12 medium accounts for 60-87.5% of the volume of the medium, TheraPEAK MSCGM medium accounts for 10-30% of the volume of the medium, GlutaMAX additive accounts for 0.5-2% of the volume of the medium, B27 additive accounts for 1-4% of the volume of the medium, MEN-NEAA solution accounts for 0.5-2.5% of the volume of the medium, Antibiotic-Antimycotic antibiotics account for 0.5-2% of the volume of the medium, disodium succinate content is 1-2mM, N-acetylcysteine ​​content is 1-2mM, nicotinamide content is 1-2mM, HEPES buffer content is 5-10mM, primary antibiotic Pr The content of imocin is 50-100 μg / mL, the content of vascular epidermal growth factor VEGF is 10-25 ng / mL, the content of fibroblast growth factor FGF4 is 10-50 ng / mL, the content of transforming growth factor TGF-β1 is 10-25 ng / mL, the content of platelet-derived growth factor PDGF is 25-50 ng / mL, the content of hepatocyte growth factor HGF is 25-50 ng / mL, the content of insulin-like growth factor IGF-1 is 25-50 ng / mL, the content of Wnt3a is 100-250 ng / mL, the content of R-spondin 1 is 100-250 ng / mL, the content of ML-099 is 50-250 nM, the content of Y-27632 is 5-10 μM, and the content of SCF functional nucleic acid mimetic is 2.5-25 nM.

3. The patient-derived gastrointestinal stromal tumor organoid culture medium based on SCF functional nucleic acid mimics according to claim 2, characterized in that: Advanced DMEM / F12 medium accounts for 66% of the volume of the medium, TheraPEAKMSCGM medium accounts for 25% of the volume of the medium, GlutaMAX additive accounts for 1% of the volume of the medium, B27 additive accounts for 2% of the volume of the medium, MEN-NEAA solution accounts for 1% of the volume of the medium, Antibiotic-Antimycotic antibiotics account for 1% of the volume of the medium, disodium succinate content is 1mM, N-acetylcysteine ​​content is 1mM, nicotinamide content is 1.25mM, HEPES buffer The content of the liquid was 10mM, the content of the primary antibiotic Primocin was 100μg / mL, the content of the vascular epidermal growth factor VEGF was 25ng / mL, the content of the hepatocyte growth factor HGF was 25ng / mL, the content of the fibroblast growth factor FGF4 was 50ng / mL, the content of the transforming growth factor TGF-β1 was 25ng / mL, the content of the platelet-derived growth factor PDGF-CC was 50ng / mL, the content of the insulin-like growth factor IGF-1 was 50ng / mL, the content of Wnt3a was 200ng / mL, the content of R-spondin 1 was 200ng / mL, the content of ML-099 was 100nM, the content of Y-27632 was 10μM, and the content of the SCF functional nucleic acid mimetic was 25nM.

4. A patient-derived gastrointestinal stromal tumor organoid culture medium based on SCF functional nucleic acid mimics according to any one of claims 1 to 3, characterized in that: Platelet-derived growth factor (PDGF) is a platelet-derived growth factor (PDGF-CC) that can specifically bind to PDGFR-α and PDGFR-β, and induce PDGF-α / α and PDGF-α / β homo- and heterodimers.

5. The patient-derived gastrointestinal stromal tumor organoid culture medium based on SCF functional nucleic acid mimics according to claim 1, characterized in that: The SCF functional nucleic acid mimic is a stem cell growth factor mimic, including Ap-Kit1 and Ap-Kit2, the sequence of Ap-Kit1 is shown in SEQ ID NO.1, and the sequence of Ap-Kit2 is shown in SEQ ID NO.

2.

6. The method for preparing the SCF functional nucleic acid according to claim 1 or 5, characterized in that: Here are the steps: S1. Dissolve monovalent nucleic acid aptamer Ap-Kit-1 and Ap-Kit-2 dry powders in Merck Milli-Q ultrapure water in a sterile operating table. After complete dissolution, adjust to appropriate concentrations with 1× PBS buffer, heat at 95°C for 5 minutes, and then quickly transfer to ice for half an hour. Mix equal volumes of PBS solutions of Ap-Kit-1 and Ap-Kit-2 and shake at room temperature to obtain a solution of divalent nucleic acid aptamer Ap-Kit-1+2. S2, connecting the obtained bivalent nucleic acid aptamer Ap-Kit-1+2 solution with T4 ligase, and digesting the ligation product with exonuclease I and exonuclease III to obtain the SCF functional nucleic acid primary product; S3. Purify the obtained SCF functional nucleic acid primary product to obtain a divalent cyclized nucleic acid aptamer, namely, SCF functional nucleic acid.

7. The method for preparing SCF functional nucleic acid according to claim 6, characterized in that: In step S1, the 1×PBS buffer contains 3 mM MgCl2, has a pH of 7.4, and a suitable concentration of 40 μM.

8. The method for preparing SCF functional nucleic acid according to claim 6, characterized in that: The T4 ligase system in step S2 is prepared according to the instructions of T4 ligase, and the ligation conditions are: 16° ​​C. for 12 h, and then 75° C. for 10 min to inactivate the T4 ligase; the enzyme cleavage conditions are: 37° C. for 1 h, and then 90° C. for 10 min to inactivate the enzyme; the purification in step S3 is performed using EasyPure PCR Purification Kit.

9. A method for culturing gastrointestinal stromal tumor organoids using the patient-derived gastrointestinal stromal tumor organoid culture medium based on SCF functional nucleic acid mimics according to any one of claims 1 to 5, characterized in that: Here are the steps: (1) Prepare gastrointestinal stromal tumor tissue digestion solution I and gastrointestinal stromal tumor tissue digestion solution II at the following concentrations: Tissue digestion solution I: Advanced DMEM / F12 medium supplemented with complex digestive enzyme Liberase TH 1 mg / mL, Dispase 5 mg / mL, heparin sodium 0.5 mM, 1×Primocin 100 μg / mL, Y-27632 10 μM, 1×Antibiotic-Antimycotic; Tissue digestion solution II: Advanced DMEM / F12 medium supplemented with Liberase TH 1 mg / mL, Hyaluronidase 20 μg / mL, Heparin sodium 0.5 mM, 0.05% Trypsin, 1× Antibiotic-Antimyc otic, Primocin 100 μg / mL, Y-27632 10 μM; (2) Remove fresh gastrointestinal stromal tumor tissue from 4°C tissue preservation solution, rinse with pre-cooled DPBS buffer and transfer into a 5 mL centrifuge tube. Add 3 times the volume of red blood cell lysis buffer to the tube. Place on ice for 15 min and vortex evenly. Centrifuge at 300 g for 5 min and discard the supernatant. (3) Use a surgical blade and forceps to remove as much fat and black necrotic tissue as possible, add 2 mL of tissue digestion solution I to infiltrate the tissue, and cut the tumor tissue into 1-2 mm pieces on a sterile culture dish. 3 Transfer the tissue pieces and digestion solution to a 5 mL centrifuge tube. (4) Add another 2 mL of tissue digestion solution I and shake the digestion in a constant temperature shaker at 37°C and 100 rpm. Aspirate 1 mL of the turbid digestion solution supernatant every 20-30 min and place on ice. Add an equal volume of tissue digestion solution I and continue digestion until the granular tissue pieces disappear. (5) filtering the tissue suspension and the digestion supernatant aspirated in advance through an 80-mesh cell sieve, collecting the cell suspension and terminating the digestion with an equal volume of a patient-derived gastrointestinal stromal tumor organoid culture medium based on SCF functional nucleic acid mimics containing 5% serum; (6) Rinse with tissue digestion solution II and recover the cell clumps that failed to pass through the cell sieve, continue digestion at 37°C and 100 rpm on a shaker for 10 min, filter the cell suspension again through the cell sieve, add an equal volume of patient-derived gastrointestinal stromal tumor organoid culture medium based on SCF functional nucleic acid mimics containing 5% serum to terminate digestion, and combine the cell suspensions obtained from the two digestions; (7) Use a T20 automatic cell counter to count the total number of live cells in the sieved tissue suspension, and concentrate by centrifugation to ensure that each 1 μL of the suspension contains more than 20,000 cells; (8) Mix the liquid matrix gel and the concentrated gastrointestinal stromal tumor suspension evenly on an ice box to ensure that the matrix gel ratio is >75%, and spread the gel droplets into a preheated 24-well cell culture plate at an inoculation volume of 50 μL per well, and place it in a 37°C cell culture incubator to wait for the matrix gel to solidify; (9) After the gel drop solidifies, add 500 μL of preheated SCF functional nucleic acid mimic-based patient-derived gastrointestinal stromal tumor organoid culture medium to each well to cover the matrix gel and return to the 37°C, 5% CO2 incubator for continued culture; (10) The culture medium was replaced every 3 days, and the organoid culture status was monitored in real time for timely subculturing.

10. Use of the patient-derived gastrointestinal stromal tumor organoid culture medium based on the SCF functional nucleic acid mimetic according to any one of claims 1 to 5 in tumor organoid culture.

Images