Method for preparing locust crz gene mutant and application in locust prevention and control

By knocking out the Crz gene in locusts using CRISPR/Cas9 technology to construct homozygous mutants, the shortcomings of existing technologies have been overcome, resulting in locusts being more susceptible to predation and having poor adaptability to low temperatures. This provides a basis for research on pest control and regulation mechanisms.

CN119592572BActive Publication Date: 2026-04-28HENAN UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411264713.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-10
Publication Date
2026-04-28
Estimated Expiration
2044-09-10

AI Technical Summary

Technical Problem

Current technologies have failed to effectively utilize CRISPR/Cas9 technology to knock out the Crz gene in locusts, affecting research on locust control strategies and regulatory mechanisms.

Method used

Using the CRISPR/Cas9 system, the RNP complex was microinjected into locust zygotes, and sgRNA was designed to target the second exon region of the Crz gene, successfully constructing a homozygous Crz mutant of locust.

Benefits of technology

The absence of Crz makes locusts more vulnerable to predation by natural enemies, reduces the content of the aggregation pheromone 4VA, and weakens their adaptability to low temperatures. This study provides a new strategy for locust control and elucidates the regulatory mechanism of Crz in insects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119592572B_ABST
    Figure CN119592572B_ABST
Patent Text Reader

Abstract

This invention belongs to the fields of locust biotechnology and gene editing technology, specifically relating to a method for preparing locusts. Crz Methods using gene mutants and their application in locust control. This invention discovers that inhibiting gene mutants in locusts... Crz Gene expression can be used to control locusts. Crz The gene sequence is shown in SEQ ID NO:3. This invention successfully established a homozygous Crz mutant strain of the migratory locust using gene editing technology. It was found that the albino migratory locusts obtained after Crz deletion were more easily preyed upon by natural enemies than the wild-type locusts, exhibited significantly lower levels of the aggregation pheromone 4VA, and showed weaker adaptability to low temperatures compared to the wild type. This provides a new strategy for the biological control of migratory locusts and can also serve as a reference for the biological control of other pests.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of locust biotechnology and gene editing technology, specifically relating to a method for preparing a locust Crz gene mutant and its application in locust control. Background Technology

[0002] The migratory locust (Locus tamigratoria) is a serious global pest. During locust outbreaks, migratory locusts change from a solitary to a gregarious lifestyle, and their body color changes from green to black. This melanization helps reduce their vulnerability to predation by birds and other natural enemies. Migratory locusts are widely distributed across Africa, most of Eurasia south of the taiga, the East Indies, tropical parts of Oceania, and New Zealand. With increasing latitude, the locusts exhibit an increasingly darker body color, suggesting that this melanization may be a strategy for adapting to lower temperatures.

[0003] Corazonin (Crz) is a neuropeptide composed of 11 amino acids, found in Diptera, Hymenoptera, and Mantis. Widely found in insects of the orders Lepidoptera, Blattodea, and Orthoptera, it has multiple subtypes and plays a role in regulating metabolism, lifespan, and reproduction; modulating stress responses; influencing pupation, initiating molting, reducing silk spinning, prolonging the pupal stage, and regulating the status of social insects within a population. The Crz of the migratory locust is [His 7 The Crz subtype has the function of inducing melanization and regulating body shape. Some foreign scholars have captured albino locusts with Crz gene mutations in the wild for scientific research. However, whether this albinoness caused by the Crz gene mutation affects their defense against natural enemies, and the effects of Crz deficiency on other aspects of locusts, are still unclear. Considering the pest nature of locusts, further clarification is needed to elucidate the impact of Crz gene mutations on them, providing more evidence for pest control and laying the foundation for understanding the regulatory mechanism of Crz in insects.

[0004] The CRISPR / Cas system, an RNA-dependent acquired defense mechanism found in bacteria and archaea, has been adapted into a highly efficient gene-editing tool. The CRISPR / Cas9 gene-editing system requires only a guide RNA (sgRNA) matching the target gene site and the Cas9 protein, which has the function of cutting DNA double strands, to form a ribosomal protein complex (RNP complex). This complex introduces double-strand breaks (DSBs) at specific sites in the genome, which are then repaired by endogenous cellular repair mechanisms, thus achieving genome-level manipulation such as knockout of the target gene. It has been widely applied in animals, plants, and microorganisms, greatly advancing research in medicine and biology. CRISPR / Cas9 technology has also been used in locust gene editing research, but the knockout of the Crz gene and the generation of homozygous mutants using this technology has not yet been reported. Summary of the Invention

[0005] This invention utilizes gene editing technology to inject an RNP complex into the fertilized eggs of locusts to obtain the Crz mutant. Microinjection is just one presentation method within this approach; other presentation methods may achieve the same effect and fall within the scope of this method. Using the method and RNP complex provided by this invention, a homozygous Crz mutant of locust was successfully obtained. Furthermore, it was found that albino locusts obtained after Crz deletion were more susceptible to predation by natural enemies than wild-type locusts, exhibited significantly lower levels of the aggregation pheromone 4VA, and showed weaker adaptability to low temperatures compared to the wild type.

[0006] This invention is achieved using the following technical solution:

[0007] This invention provides the application of the Crz gene in locust control. Specifically, it involves inhibiting the expression of the Crz gene in locusts to achieve locust control. The coding sequence of the Crz gene is shown in SEQ ID NO:3. Compared with the coding sequence of locust prepro-corazonin in the GenBank database (GenBank: LC031861.1), the sequence shown in SEQ ID NO:3 does not contain the 5'UTR and 3'UTR sequences.

[0008] The above-mentioned inhibition of Crz gene expression in locusts is achieved by knocking out the Crz gene in locusts.

[0009] The steps for knocking out the Crz gene in locusts are as follows:

[0010] (1) Based on the coding sequence of the Crz gene, its gene structure and genome sequence were determined in the locust genome, and sgRNA target sites were designed; the sgRNA target sites are located in the second exon region of the Crz gene;

[0011] The sgRNA target site is located in the second exon region of the Crz gene;

[0012] The sgRNA target sites are shown in SEQ ID NO:1 and SEQ ID NO:2;

[0013] The sgRNA template primer sequence is as follows:

[0014] T7-Crz T1-F: 5'-TAATACGACTCACTATAGGAGCGTGGCGCTGCTG-3',

[0015] Crz T1-R: 5'-TTCTAGCTCTAAAACCCGCCAGCAGCGCCACGCT-3';

[0016] and

[0017] T7-Crz T2-F: 5'-TAATACGACTCACTATAGCAGCCTGAGGCAGCGC-3',

[0018] Crz T2-R: 5'-TTCTAGCTCTAAAACCGTGCGCTGCCTCAGGCTG-3'.

[0019] (2) Construction of CRISPR / Cas9 knockout system: sgRNA was prepared by in vitro transcription and co-incubated with Cas9 protein to obtain a mixture of ribonucleoproteins (RNPs) for injection;

[0020] (3) The RNP mixture was injected into locust eggs through a microinjector, and the locust Crz gene mutant was obtained by screening.

[0021] This invention also provides the application of the Crz gene in regulating the low-temperature adaptability of locusts. Knocking out the Crz gene in locusts reduces their ability to adapt to low temperatures.

[0022] The beneficial effects of this invention are as follows:

[0023] This invention is the first to utilize CRISPR / Cas9 technology to knock out the Crz gene in locusts, successfully constructing a homozygous mutant locust with this gene in China and providing a stable and effective Crz gene homozygous mutant strain. This mutation makes the locust more susceptible to predation by natural enemies, significantly reduces the content of the aggregation pheromone 4VA, and makes it less adaptable to low-temperature environments. This can provide a new strategy for the biological control of locusts and offer a reference for the biological control of other pests. Attached Figure Description

[0024] Figure 1 Schematic diagram of the structure and target site location of the locust Crz gene.

[0025] Figure 2 Results of in vitro cleavage detection of locust Crz gene amplification products.

[0026] Figure 3 : Sequencing results of the homozygous mutant locust Crz gene. M1 and M2 represent the two homozygous mutants obtained, and the red part represents the missing gene sequence.

[0027] Figure 4 Phenotypic analysis of homozygous mutants of the Crz gene in locusts. A. The mutants show significant albinoization. B. The homozygous mutants have a lower survival rate in predation experiments by predatory birds. C. The mutants show a significant decrease in 4VA content. D. The locusts' body color significantly darkens at low temperatures. E. The mutants are shorter in body length at low temperatures. F. The mutants have lower body weight at low temperatures. Detailed Implementation

[0028] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of the embodiments of this invention will be clearly described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0029] The locusts used in this invention are gregarious strains that have been stably raised for a long time in the insect room of the Key Laboratory of Plant Stress Biology at Henan University. They are raised in gregarious conditions in metal cages (40cm long, wide, and high) with good light and air permeability. The population density is maintained at about 250 adults per cage. The room temperature is 30±2℃, the daily light duration is 14h (14L:10D), and the relative humidity is 15% to 25%. They are fed wheat bran and fresh wheat seedlings, and locust droppings and other garbage are cleaned up in a timely manner.

[0030] Main reagent: GeneArt TM Precision gRNA Synthesis Kit (Invitrogen), TrueCut TM Cas9 Protein v2 (Invitrogen), Animal Genomic DNA Rapid Extraction Kit (Sangon Biotech), etc.

[0031] Through extensive research and repeated experiments, including the selection of gene mutation sites, design of sgRNA and in vitro transcription, and preparation of RNP complexes, the inventors successfully introduced RNP into locust embryos via microinjection. Combined with molecular biology techniques such as target gene fragment amplification and sequencing, this invention, for the first time, successfully knocked out the Crz gene in locusts using the CRISPR / Cas9 system and obtained a homozygous mutant locust strain. Compared to wild-type locusts, the Crz gene mutant is more easily preyed upon by birds, and its aggregation pheromone 4VA content is significantly reduced, making it suitable for locust control. Furthermore, the Crz gene mutant exhibits significantly lower body length and weight at low temperatures compared to the wild type, laying the foundation for elucidating the regulatory mechanism of Crz in insects.

[0032] The specific implementation method is as follows:

[0033] 1. Constructing an RNP complex for knocking out the Crz gene in locusts:

[0034] (1) Referring to the coding sequence of prepro-corazonin in the migratory locust (GenBank: LC031861.1), the structure of the Crz gene and its genomic location (GenBank: GCA_026315105.1) were preliminarily determined after alignment in the migratory locust genome. It is speculated that the migratory locust Crz gene is located on chromosome 3, consists of 3 exons, and the Crz coding sequence is located in exon 2. Figure 1 As shown in Table 1, primers were designed based on the coding sequence of prepro-corazonin from the reference locust. After amplification and sequencing verification of the genomic sequence near the Crz coding sequence, a potential target site for the CRISPR / Cas9 system was selected on both sides of the Crz coding sequence for subsequent research. These sites were named Target1 (SEQ ID NO:1, GAGCGTGGCGCTGCTGGCGGTGG) and Target2 (SEQ ID NO:2, GCAGCCTGAGGCAGCGCACGCGG).

[0035] Table 1. Primers for Crz gene amplification

[0036] Primer name Sequence (5' to 3') Crz-F ACTGGAGCCCCTTAGTCTCC Crz-R ATTGGCCGGTAAATGTGCAG

[0037] (2) In vitro synthesis of sgRNA

[0038] a. Design sgRNA template primers based on the target site sequence (Table 2), and assemble the DNA template for in vitro transcription of sgRNA by PCR reaction (Table 3).

[0039] Table 2. sgRNA template primer sequences

[0040] Primer name Sequence (5' to 3') T7-Crz T1-F TAATACGACTCACTATAGGAGCGTGGCGCTGCTG Crz T1-R TTCTAGCTCTAAAACCCGCCAGCAGCGCCACGCT T7-Crz T2-F TAATACGACTCACTATAGCAGCCTGAGGCAGCGC Crz T2-R TTCTAGCTCTAAAACCGTGCGCTGCCTCAGGCTG

[0041] The PCR reaction system for in vitro transcription template of sgRNA is as follows:

[0042] Table 3. PCR reaction system for sgRNA template

[0043] Element Volume (μL) <![CDATA[Phusion TM High-Fidelity PCR Master Mix(2×)]]> 12.5 Tracr Fragment+T7 Primer Mix 1 0.3μM Target F1 / R1 Oligonucleotide Mix 1 Nuclease-free Water 10.5 Total Volume 25

[0044] Mix the above system thoroughly and centrifuge briefly. Then assemble the template for in vitro transcription of sgRNA by PCR according to the following procedure: 98℃, 10s; 98℃, 5s, 55℃, 15s, for a total of 32 cycles; 72℃, 1min; 4℃, forever.

[0045] b. In vitro transcription of sgRNA

[0046] Prepare the in vitro transcription reaction system according to Table 4 (add the components in the order shown in the table):

[0047] Table 4. sgRNA in vitro transcription reaction system

[0048]

[0049]

[0050] Mix all components thoroughly and centrifuge briefly. React at 37°C for 2–4 hours. After transcription is complete, add 1 μL of deoxyribonuclease I to the reaction mixture and continue incubation at 37°C for 15 minutes to remove the template.

[0051] Purification of c.sgRNA

[0052] Dilute the above reaction mixture to 200 μL with nuclease-free water, add 100 μL of binding buffer, and mix thoroughly; add 300 μL of anhydrous ethanol (>96%), and mix thoroughly; transfer the mixture to GeneJet. TM Centrifuge at 14000g for 60s in an RNA purification microcolumn; add 700μL Wash Buffer 1, centrifuge at 14000g for 30s, and discard the filtrate; add 700μL Wash Buffer 2, centrifuge at 14000g for 30s, and discard the filtrate; centrifuge at 14000g for 60s to completely remove residual wash buffer, and transfer the purification microcolumn to a clean 1.5mL collection tube; add 20μL nuclease-free water to the center of the purification column filter, centrifuge at 14000g for 60s, and elute the sgRNA.

[0053] Take 1 μL of sgRNA, dilute it 100 times with nuclease-free water, and measure the concentration using NanoDrop 2000. Store the sgRNA stock solution at -80℃ for later use.

[0054] (3) In vitro cleavage reaction to verify sgRNA activity

[0055] Two sgRNAs were reacted with Cas9 protein and reaction buffer with the substrate at 37°C for 1 hour, respectively. The digestion results were then examined using 1.5% agarose gel electrophoresis to determine the ability of the sgRNAs to guide the Cas9 protein to cleave target sites. In addition to the two experimental groups, four control groups were set up: substrate only, substrate and sgRNA T1, substrate and sgRNA T2, and substrate and Cas9 protein. The activity of the sgRNAs was assessed based on the amount of substrate consumed in each group.

[0056] The Crz gene fragment amplified by PCR using Crz-F and Crz-R primers was 684 bp in size. Figure 2As shown, sgRNAT1 successfully cleaved the Crz gene fragment into two fragments of 188bp and 496bp, and sgRNA T2 successfully cleaved the Crz gene fragment into two fragments of 366bp and 318bp, both consistent with the expected results, proving that sgRNAT1 and sgRNA T2 have biological activity.

[0057] (4) Preparation of RNP injection solution

[0058] Two sgRNAs and Cas9 protein, prepared according to the target sites, were premixed and incubated at 37°C for 30–60 min to obtain the RNP complex for injection. In the RNP complex, the final concentrations of sgRNA and Cas9 protein were 150 ng / μL and 400 ng / μL, respectively (the concentrations of the two components can be adjusted according to actual usage effects), with the ratio of the two sgRNAs in the sgRNA mixture being 1:1. In this embodiment, two different sites of the Crz gene were targeted to improve the knockout efficiency of the Crz gene.

[0059] 2. Knocking out the endogenous Crz gene in locusts using the CRISPR / Cas9 system

[0060] (1) Collection of eggs used for microinjection

[0061] To collect fresh eggs for the injection experiment, the locusts in their oviposition period had their oviposition sand trays changed 2 hours before collection. During the experiment, the collected fresh egg sacs were separated with tweezers, and the fertilized eggs were removed individually. They were washed with sterile distilled water until no sand or residual egg sacs remained, then disinfected by soaking in 75% alcohol for 1 minute, and then washed 3 times with sterile distilled water. The washed eggs were placed in a clean petri dish with sterile water for later use.

[0062] (2) Microinjection

[0063] Using a sterilized brush, arrange the cleaned and disinfected locust fertilized eggs onto an injection plate. Place the injection plate on the stage of a stereomicroscope and use a micromanipulator to inject the RNP complex into the collected locust eggs. After injecting one plate of fertilized eggs, transfer the injected fertilized eggs to a prepared culture dish with the brush, seal it with plastic wrap, and then place it in a constant temperature incubator at 30°C and 15% humidity. Nymphs will hatch in approximately 10-12 days.

[0064] 3. Screening and establishment of Crz gene mutant locust strains

[0065] (1) Screening and passage of G0 generation chimeras

[0066] The larvae hatched in the previous step grow to the adult stage (day 1 after emergence). Male and female larvae are separated, cultured, and labeled. Using dissecting scissors, 3–5 mm lengths of the locust's antennae are cut and placed in 1.5 mL centrifuge tubes. The genome is obtained using an alkaline lysis method: 45 μL of 50 mM NaOH is added, and lysis is performed at 95°C for 30 min; then 5 μL of 1 M Tris-HCl (pH = 8.0) is added. 1 μL of the lysis product is used as a template, and the target gene fragment is amplified by PCR. The PCR product is then sequenced. Based on the sequencing results, positive mutant G0 generation individuals with heterogeneous peaks at the target site are selected and crossbred with wild-type individuals for propagation.

[0067] (2) Screening and establishment of homozygous strains

[0068] The G1 generation individuals were screened using the above detection method. Heterozygous individuals from the G1 generation were selected, paired, and propagated. The same method was used to identify the G2 generation individuals. Homozygous mutants were screened based on the sequencing results. Figure 3 By pairing and passing the gene, a locust strain with a homozygous mutation of the Crz gene can be established.

[0069] The two homozygous mutants M1 and M2 selected in this embodiment have deletions of 15bp and 188bp, respectively, compared with the wild type. Figure 3 As shown. The mutant's body color is significantly whiter compared to the wild type, such as... Figure 4 As shown in Figure A.

[0070] 4. Effects of homozygous mutations in the Crz gene on locusts

[0071] (1) Avoiding attacks from natural enemies

[0072] Predator birds were first starved for 4 hours (provided only with water, no food). Then, one albino and one wild-type locust were simultaneously placed in a cage. Once one locust was preyed upon, the other locust was removed from the cage and fed to the next group, until the predator birds ceased predation. Each predation experiment was performed six times independently. The species and number of locusts preyed upon in each experiment were recorded. Statistical analysis using the signed-rank test was used to compare the differences and their significance between groups (*, P<0.05). The results showed that locusts with homozygous mutations in the Crz gene were more susceptible to predation. Figure 4 B).

[0073] (2) Determination of 4VA content

[0074] 4VA is widely present in migratory locusts. To verify the effect of homozygous mutation of the Crz gene on 4VA content in migratory locusts, we dissected 2-day-old female locusts of the 4th instar and collected approximately 50–100 mg of fresh tissue into 1.5 mL centrifuge tubes. 200 μL of sterile water was added to the centrifuge tubes, and the mixture was homogenized using an electric grinder for 1–1.5 min. After homogenization, 200 μL of n-hexane was added. The homogenized sample was then stirred at 4 °C for 10 min and centrifuged at 13000 rpm for 10 min. 150 μL of the supernatant was transferred to specific glass sample tubes, and the 4VA content in different samples was detected and compared by GC-MS. The results showed that the 4VA content in migratory locusts with homozygous mutation of the Crz gene was significantly reduced. Figure 4 C).

[0075] (3) Determination of duration and growth indicators under low temperature conditions

[0076] Newly hatched first-instar locusts were placed in an incubator (housed in wire mesh cages (40cm*40cm*40cm) at a daytime temperature of 25℃ and a nighttime temperature of 20℃, with 14 hours of light per day (14L:10D), and a relative humidity of 15%–25%. They were fed wheat bran and fresh wheat seedlings, and their droppings and other debris were promptly removed). Locusts entering the next instar were recorded every half day, and their body length and weight were recorded daily. A t-test was used for statistical analysis to compare the differences between groups and their significance (*, P<0.05). The results showed that the locusts' body color significantly darkened at low temperatures (…). Figure 4 D), locusts with homozygous mutations in the Crz gene are less adapted to low temperatures. Figure 4 E, 4F).

[0077] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. The application of the Crz gene in regulating body length and weight in locusts under low temperature conditions, characterized by: Knocking out the Crz gene in locusts reduced their body length and weight under low temperatures. The sequence of the Crz gene is shown in SEQ ID NO:

3. The low temperature refers to 25°C during the day and 20°C at night.

2. The application according to claim 1, characterized in that, The steps to knock out the Crz gene in locusts are as follows: (1) Based on the coding sequence of the Crz gene, its gene structure and genome sequence were determined in the locust genome, and sgRNA target sites were designed; the sgRNA target sites are located in the second exon region of the Crz gene; the sgRNA target sites are shown in SEQ ID NO:1 and SEQ ID NO:2; (2) Construction of CRISPR / Cas9 knockout system: sgRNA was prepared by in vitro transcription and co-incubated with Cas9 protein to obtain a mixture of ribonucleoproteins for injection; (3) The mixture of ribonucleoprotein was injected into locust eggs through a microinjector, and the locust Crz gene mutant was obtained by screening.

3. The application according to claim 2, characterized in that, The sgRNA template primer sequence is as follows: T7-Crz T1-F: 5'-TAATACGACTCACTATAGGAGCGTGGCGCTGCTG-3', Crz T1-R: 5'-TTCTAGCTCTAAAACCCGCCAGCAGCGCCACGCT-3'; or T7-Crz T2-F: 5'-TAATACGACTCACTATAGCAGCCTGAGGCAGCGC-3', Crz T2-R: 5'-TTCTAGCTCTAAAACCGTGCGCTGCCTCAGGCTG-3'.