Gene DobHLH14 for regulating DoSUS2 expression under drought stress to increase polysaccharide content of dendrobium officinale and application of gene DobHLH14

Abstract

The invention discloses a gene DobHLH14 for regulating and controlling DoSUS2 expression under drought stress to increase the content of dendrobium officinale polysaccharides and application of the gene DobHLH14, and belongs to the technical field of plant genetic engineering breeding, the nucleotide sequence of the gene DobHLH14 is shown as SEQ ID No: 4, and the coded amino acid sequence is shown as SEQ ID No: 5. The DobHLH14 is applied to the improvement of the polysaccharide content of the plant or the breeding of the drought-tolerant transgenic plant. The homologous and heterologous overexpression results of the dendrobium officinale show that the polysaccharide content and drought resistance of the transgenic plant are obviously improved by regulating the expression of the DoSUS2 gene through the DobHLH14 transcription factor of the dendrobium officinale under drought stress, and the method is an excellent method for breeding perennial herbaceous plants with high polysaccharide and drought resistance.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering breeding, and in particular relates to a method for increasing the polysaccharide content of Dendrobium officinale by regulating DoSUS2 expression by DobHLH14 under drought stress. Background Art

[0002] The content of polysaccharides in Dendrobium officinale is the core active ingredient to measure the medicinal value of Dendrobium officinale. However, the molecular regulatory mechanism of polysaccharide synthesis and metabolism in Dendrobium plants is still unclear. The natural reproduction rate of wild Dendrobium officinale is extremely low and the growth is slow. Coupled with the influence of factors such as climate change, deterioration of the living environment and excessive human excavation, the germplasm resources of Dendrobium officinale have been severely damaged and are on the verge of extinction. At present, the cultivation and medicinal production of Dendrobium officinale mainly rely on artificial breeding. However, there are problems such as blind introduction and mixed germplasm in the cultivation industry of Dendrobium officinale, which leads to poor quality and yield of Dendrobium officinale, affecting its excellent variety selection, standardized production and clinical safe use. Therefore, it is an effective way to achieve the healthy and sustainable development of the Dendrobium officinale industry by genetically improving breeding technology specifications, innovating Dendrobium officinale germplasm resources, and cultivating varieties with excellent traits such as high yield, high quality and strong stress resistance.

[0003] Polysaccharides are important active ingredients in medicinal plants. Most of them are composed of various monosaccharides such as glucose, mannose, fructose, and xylose, all of which are produced and derived from the hydrolysis of sucrose. There is a close connection between sucrose metabolism-related enzymes and sugar accumulation in plants. Sucrose synthase (SUS) is one of the key enzymes regulating sucrose metabolism, catalyzing sucrose into various metabolic pathways and providing precursors for polysaccharide synthesis. Therefore, the activity of SUS directly affects the content and biological yield of polysaccharides. In plant tissues, SUS mainly exists in the form of more than two isozymes and is one of the enzymes closely related to sucrose metabolism in plants. After continuous research, it was found that the main function of SUS is to decompose sucrose and provide precursors and substrates for the synthesis of polysaccharides, cell walls, and starch. It plays a catalytic role in the bidirectional reversible reaction process of sucrose and uridine diphosphate (UDP) to produce uridine diphosphate glucose (UDPG) and fructose, which can affect the formation of the entire plant biomass and sugar accumulation. Although the biochemical process of plant sucrose metabolism has been basically understood, little is known about the molecular expression mechanism of the SUS gene.

[0004] So far, SUS genes in dozens of plants such as potato, beet, carrot, sugarcane, Malus domestica, and Dendrobium officinale have been cloned, and they have high homology. With the completion of genome sequencing of many plants and the development of bioinformatics, evolutionary analysis results show that SUS genes in higher plants are divided into three types (Group): SUSⅠ, SUSⅡ and SUSⅢ. For example, there are 5 or more different types of SUS genes in different plants such as poplar, rubber tree, tobacco, sugarcane, and tetraploid upland cotton (G.hirsutum L.). Studies have shown that the expression of different members of the SUS gene family in different plants or different developmental stages and different tissues and organs of the same plant has spatiotemporal specificity. Taking the 11 SUS genes in apple (Malus domestica) as an example, different MdSUS genes are expressed in different tissues such as fruit and stem apex. Chao Maoni et al. (2018) identified a total of 12 sucrose synthase genes (GmSUS1-GmSUS12) in the soybean genome, and different GmSUS genes have different tissue expression patterns. In the Mid-Autumn Crisp Jujube, the ZjSS6 gene generally showed a downward trend during the development of the jujube fruit, and there were differences in the expression levels in various tissues and organs, which was similar to the expression pattern of the CuSus1 gene in citrus. These limited studies have shown that the SUS gene plays an important role in a series of life processes such as plant growth and development, stress resistance, and signal transduction.

[0005] At present, functional SUS genes have been discovered and identified in many plants. They have an important influence on the transport and accumulation of photosynthetic products and play an important role in the formation of crop yield. For example, inhibiting the expression of cotton SUS gene can inhibit the initiation, elongation and seed development of cotton fiber cells, while overexpressing potato SUS gene in cotton can significantly increase cotton yield (, indicating that SUS gene has great potential in increasing crop yield. In beans, the expression of SUS gene is inhibited, which will delay the development of embryos, cause abnormal development of embryos and pedicels, and ultimately lead to abnormal seed development. In sweet sorghum, the relative expression of the same SUS gene in different varieties is different. The variety with the highest relative expression of SUS gene at maturity is LTR108. Deng Shuya et al. (2017) found that the expression of Cg-SUS2 is similar to that of wood. There is a very significant positive correlation between sugar and arabinose content, indicating that Cg-SUS2 may be involved in the biosynthesis of arabinose and xylose; and there is a significant positive correlation between the expression of Cg-SUS3 and the content of glucose, fructose, and sucrose, indicating that Cg-SUS3 may be involved in the degradation pathway of sucrose, thereby promoting the transported sucrose to generate UDP-glucose and fructose. Liu Suwei et al. (2019) showed that the DoSUS1 gene of Tiegun Yam was abnormally expressed in the rhizomes of starch and polysaccharide storage organs. Jiang Suhua et al. (2020) found in their latest study that the SUS gene is induced by growth and development and is a key gene for regulating the growth and development of Bletilla striata.

[0006] In addition, various modern biological experiments have confirmed that the SUS gene not only affects plant yield, sucrose composition and starch content, is related to plant quality, but also participates in processes such as plant abiotic stress. For example, lack of water increases the activity of sucrose synthase and starch synthesis-related enzymes in poplar and wheat. Drought stress can cause the up-regulation of the Sus2 gene in Nostoc, thereby increasing the sucrose content and maintaining the osmotic balance of the cells. Under hypoxic stress conditions caused by flooding, the expression and enzyme activity of the cucumber CsSUS3 gene in the roots were significantly increased. Antisense CsSUS3 transgenic plants are more sensitive to flooding conditions, grow slower, and have more yellow necrotic spots on the leaves, indicating that the CsSUS3 gene is involved in resisting hypoxic stress. Low temperature and drought induce increased expression of the HbSus5 gene in roots and leaves of rubber trees, indicating that the HbSus5 gene plays an important role in responding to stress. Chen Na et al. (2013) found that the peanut AhSUS gene was involved in the adaptive regulation of peanut to high salt and drought stress, and the gene was significantly induced by ABA in peanut roots, suggesting that AhSUS may regulate peanut abiotic stress in an ABA-dependent manner. Wang et al. (2017) also verified this conclusion in their study on wild grape pulp. These studies all indicate that SUS plays an important role in regulating abiotic stress in plants. Therefore, it is necessary to conduct in-depth research on the SUS gene to further uncover the molecular genetic mechanism of plant polysaccharide anabolism, and then select superior varieties by regulating SUS gene expression.

[0007] Transcription factors (TFs) are important DNA binding proteins in the transcriptional regulation process of plants, including DNA binding domain, transcription regulation domain, oligomerization site and nuclear localization signal domain. TFs can specifically interact with cis-acting elements in the promoter region of plant genes and play a key role in stress-related regulatory networks and signal transduction pathways.

[0008] The bHLH (basic Helix-Loop-Helix) gene family is the second largest type of transcription factor in plants. Its protein structure was first discovered and identified in mouse muscle in 1989. It consists of about 60 amino acids and two highly conserved domains: the basic basic region composed of 13 to 17 hydrophilic basic amino acids at the N-terminus and the helix-loop-helix (HLH) region composed of hydrophobic basic amino acids at the C-terminus. The basic region can bind to the E-box (5'-CANNTC-3') element and is a DNA protein domain; the HLH region forms a homologous / heterodimer through the interaction of two α-helices, thereby binding to different cis-acting elements of the target gene promoter to regulate the transcription of functional genes. So far, a variety of bHLHTFs have been discovered and identified in plants. The number of bHLH TFs identified in the PlantTFDB database (https: / / opendata.pku.edu.cn / ) in Arabidopsis, tobacco, and tomato is 181, 435, and 159, respectively. A total of 98 bHLH gene family members have been identified in the genome of Dendrobium officinale. They can regulate plant reproductive organs, growth and development, and play an important role in the regulation and induction of the biosynthesis of various secondary metabolites in plants, the formation of growth regulators, and abiotic stress in plants. Therefore, it is necessary to conduct in-depth research on bHLH transcription factors, further reveal the molecular genetic mechanism and expression regulation mechanism of plant bHLH transcription factors, and then systematically understand their biological functions.

[0009] Dendrobium officianle is an endangered medicinal plant of the genus Dendrobium (Orchidaceae) of the perennial epiphytic herb Dendrobium Sw. It has the effects of nourishing the stomach and promoting fluid, nourishing yin and clearing away heat. It is a precious traditional Chinese medicine with a wide range of medicinal uses and is known as the "life-saving fairy grass" among the people. Modern pharmacological and chemical component analysis shows that the main active ingredients in Dendrobium officianle are polysaccharide compounds, which have the effects of improving immunity, lowering blood sugar, anti-tumor, anti-oxidation, protecting the liver and stomach, and anti-cataract. Its physical, chemical and structural characteristics are closely related to its medicinal activity. At the same time, because wild Dendrobium officianle is an epiphytic plant, it grows on thick bark or trunks with high looseness and strong air permeability, and is also often found on cliffs or cracks in semi-shaded and semi-sunny areas. It has excellent stress resistance, making it an ideal material for studying plant polysaccharide synthesis and metabolism and stress resistance gene cloning. At present, little is known about the drought tolerance function of bHLH transcription factors in Dendrobium officinale. Some studies have only shown that the expression of bHLH genes is induced by drought stress and may be involved in the regulation of drought tolerance in plants, but their drought tolerance mechanism has not been fully understood, and it is impossible to use bHLH transcription factors in Dendrobium officinale to regulate SUS genes to cultivate medicinal plants with excellent drought tolerance. Therefore, finding a method to use DobHLH14 to regulate DoSUS2 expression under drought stress to increase the polysaccharide content in Dendrobium officinale is of great significance for the genetic breeding research of Dendrobium officinale gene improvement.

[0010] Liu Yujia et al. published a paper titled "Cloning and Expression Analysis of Sucrose Synthase DoSUS2 Gene in Dendrobium officinale" in the Journal of Agricultural Biotechnology. The paper disclosed that in order to explore the regulatory mechanism of sucrose synthase 2 (DoSUS2) in polysaccharide anabolism and abiotic stress response in Dendrobium officinale, DoSUS2 was cloned from the leaf tissue of Dendrobium officinale. The expression levels of the gene in different tissues were significantly different, with relatively high expression levels in roots and flower organs and low expression levels in leaves and stems. The promoter sequence of the DoSUS2 gene contains multiple abiotic stress response-related elements, and low temperature, drought and abscisic acid (ABA) can induce DoSUS2 gene expression. After 6 hours of low temperature and ABA treatment, the expression of DoSUS2 gene was significantly upregulated (P<0.01), reaching 267 times and 233 times before treatment respectively; after 9 hours of drought treatment, the expression of DoSUS2 gene also reached the highest value, 18.6 times before treatment (P<0.01), suggesting that DoSUS2 gene may participate in the response process of low temperature and drought stress through ABA signaling pathway. DoSUS2 protein interacts with multiple enzymes closely related to sugar metabolism. It is speculated that this gene may play a role in the response process of abiotic stress by regulating the expression of related enzyme genes and sugar metabolic pathways, thereby improving the tolerance of Dendrobium officinale to adverse stress. This article does not involve reports on DobHLH14 or similar family members. Summary of the invention

[0011] In order to solve the above-mentioned deficiencies of the prior art, the present invention provides a method for increasing the polysaccharide content of Dendrobium officinale by regulating the expression of DoSUS2 using DobHLH14 under drought stress.

[0012] The invention discloses a gene DobHLH14 for regulating the expression of DoSUS2 under drought stress to increase the polysaccharide content of Dendrobium officinale. The nucleotide sequence of DobHLH14 is shown in SEQ ID No:4.

[0013] The amino acid sequence encoded by the gene DobHLH14 for regulating the expression of DoSUS2 under drought stress to increase the polysaccharide content of Dendrobium officinale is shown in SEQ ID NO:5.

[0014] The invention discloses a gene DobHLH14 for regulating the expression of DoSUS2 under drought stress to increase the polysaccharide content of Dendrobium officinale, and application of the DobHLH14 in increasing the polysaccharide content of plants or breeding drought-resistant transgenic plants.

[0015] Furthermore, a plant overexpression vector containing DobHLH14 is constructed and used in increasing the polysaccharide content of plants or breeding drought-resistant transgenic plants.

[0016] Furthermore, the plant is a woody plant.

[0017] Furthermore, the woody plant is Dendrobium officinale or Dendrobium nobile.

[0018] Furthermore, the plant overexpression vector containing DobHLH14 is pROKII-DobHLH14.

[0019] Furthermore, the plant overexpression vector pROKII-DobHLH14 is constructed as follows:

[0020] Using wild-type Dendrobium officinale leaf tissue cDNA as a template, using pROKⅡ-DobHLH14-F and pROKⅡ-DobHLH14-R primers, RT-PCR cloning of DobHLH14 gene was performed, a gel recovery kit was used to recover the amplified target fragment, the pROKII vector plasmid was digested with SamHI, and after the fragment was recovered, it was connected using a kit, and the connection product was transformed into Escherichia coli DH5α competent cells, and a single clone was picked for verification. After the verification was correct, the plant overexpression vector was pROKII-DobHLH14; the pROKⅡ-DobHLH14-F sequence is as follows: CTCTAGAGGATCCCCATGGCTGATCACAGAACCTTG; the pROKⅡ-DobHLH14-R sequence is as follows:

[0021] TCGAGCTCGGTACCCTTAATCATGGTGCAAAGGAAC.

[0022] Furthermore, the reaction system of the RT-PCR cloning is 2.00 μL of template, 1.00 μL of 10 μmol / L pROKⅡ-DobHLH14-F, 1.00 μL of 10 μmol / L pROKⅡ-DobHLH14-R, 1.00 μL of 10 mmol / L dNTPMix, 2.00 μL of 10×Ex TaqPCRbuffer, and 0.20 μL of 5U / μL Ex Taq; the reaction procedure is pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 90 s, 30 cycles; extension at 72°C for 7 min.

[0023] Furthermore, the ligation system is 3.00 μL of 0.03 pmol / L pROKⅡ digested vector, 5.00 μL of 0.03 pmol / L DobHLH14 gene amplification recovery product, and 2.00 μL of 5×In-Fusion HD Enzyme Premix.

[0024] Beneficial effects of the present invention:

[0025] The method provided by the present invention for regulating DoSUS2 expression and increasing polysaccharide content by using Dendrobium officinale DobHLH14 under drought stress can be used to improve plant drought tolerance or breed drought-tolerant transgenic plants. Overexpression and inhibition expression vectors of the Dendrobium officinale DoSUS2 gene are respectively constructed, and the Dendrobium officinale DoSUS2 gene is transferred into the model plant Arabidopsis thaliana. The average germination rate, fresh weight, phenotype, cell damage degree and polysaccharide content of the transgenic T3 generation Arabidopsis seeds after drought stress are better than those of the wild type, and have excellent drought resistance. The upstream transcriptional regulatory factor of the DoSUS2 gene, Dendrobium officinale DobHLH14, was identified by transcriptome analysis and yeast single hybrid analysis. Overexpression and suppression expression vectors of DobHLH14 gene of Dendrobium officinale were constructed respectively, and DobHLH14 transgenic Dendrobium officinale was obtained by transient infection. Fluorescence quantitative RT-PCR and polysaccharide content determination tests confirmed that the strains overexpressing DobHLH14 gene of Dendrobium officinale had obvious drought tolerance and higher polysaccharide content, which was 6.13% and 3.57% higher than that of the control strains, respectively. The results of homologous and heterologous overexpression of Dendrobium officinale showed that the transcription factor DobHLH14 of Dendrobium officinale regulated the expression of DoSUS2 gene under drought stress, which significantly increased the polysaccharide content and drought resistance of transgenic plants, and was an excellent method for breeding perennial herbaceous plants with high polysaccharide content and drought resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is the result of the prediction analysis of the protein domain encoded by DoSUS2;

[0027] Figure 2 The hydrophilicity (A), secondary structure prediction (B), tertiary structure prediction (C) and transmembrane region prediction (D) of the DoSUS2 encoded protein;

[0028] Figure 3 This is the result of multiple sequence alignment analysis of DoSUS2 encoded protein and SUS proteins of other species; the solid line represents the sucrose synthase domain; the dotted line represents the glycosyltransferase domain;

[0029] Figure 4The results of real-time quantitative RT-PCR of DoSUS2 gene under drought stress (A) and ABA treatment (B); *** and **** indicate significant differences at 0.001 and 0.0001 levels, respectively;

[0030] Figure 5 To transform the DoSUS2 gene into Arabidopsis thaliana 3 Genome PCR identification (A), real-time quantitative RT-PCR detection (B) and semi-quantitative RT-PCR detection (C) of homozygous strains of the first generation; uppercase letters and lowercase letters indicate significant differences at the 0.01 and 0.05 levels, respectively;

[0031] Figure 6 This is a comparison of seed germination phenotypes and germination rates of transgenic Arabidopsis thaliana and wild-type Arabidopsis thaliana after simulated drought stress; the scale bar represents 1 cm, and uppercase and lowercase letters represent significant differences at the 0.01 and 0.05 levels, respectively;

[0032] Figure 7 This is a comparison of the developmental phenotype and fresh weight of Arabidopsis thaliana transgenic with DoSUS2 gene and wild-type Arabidopsis thaliana after simulated drought stress; the scale bar represents 1 cm, and uppercase and lowercase letters represent significant differences at the 0.01 and 0.05 levels, respectively;

[0033] Figure 8 Comparison of plant development phenotype (A), DAB staining (B) and NBT staining (C) of transgenic Arabidopsis thaliana and wild-type Arabidopsis thaliana after simulated drought stress; scale bar represents 1 cm;

[0034] Fig. 9 Figure 2 shows the physiological and biochemical analysis of transgenic Arabidopsis thaliana with DoSUS2 gene and wild-type Arabidopsis thaliana after simulated drought stress; (A) Determination of malondialdehyde (MDA), ascorbic acid (ASA) and glutathione (GSH) contents; (B) Analysis of superoxide dismutase (SOD), peroxidase (POD) and sucrose synthase (SUS) activities; (C) Determination of glucose, fructose and soluble sugar contents;

[0035] Fig.10 This is a diagram of the spatiotemporal expression analysis of the promoter of the DoSUS2 gene of Dendrobium officinale in different growth stages and different organs or tissues of transgenic Arabidopsis thaliana with the DoSUS2 gene;

[0036] Fig.11 This is an analysis of differentially expressed genes in Dendrobium officinale at different time points after drought stress; red arrows indicate the number of genes that are differentially expressed after 1, 3, 6, 9, 12 and 24 hours of drought stress;

[0037] Fig.12The expression level diagram of drought stress response transcription factors and DoSUS2 gene at different stress time points; blue and yellow represent low and high levels of expression, respectively, and the values ​​are expressed in log 2 (FPKM value) indicates;

[0038] Fig.13 This is the result of the prediction analysis of the protein domain encoded by DobHLH14;

[0039] Fig.14 The hydrophilicity analysis (A), secondary structure prediction (B) and tertiary structure prediction (C) of the DobHLH14 encoded protein are shown;

[0040] Fig.15 This is the result of multiple sequence alignment analysis between the protein encoded by DobHLH14 and bHLH proteins of other species; the solid line represents the bHLH-MYC-N domain; the dotted line represents the HLH domain;

[0041] Fig.16 The analysis diagram of DobHLH14 and E-box / ME-box yeast one-hybridization; (A) Screening results of DobHLH14 and E-box co-transformed yeast Y187; (B) Screening results of DobHLH14 and ME-box co-transformed yeast Y187; (C) Results of DobHLH14 and E-box / ME-box yeast one-hybridization;

[0042] Fig.17 This is the expression analysis diagram of DobHLH14 gene in transiently transformed Dendrobium officinale; three biological replicates were taken for each sample, and the experimental data were analyzed and processed by WPS and GraphPad Prism 8 software; ** indicates that the relative expression level is significantly different at the 0.01 level compared with the control;

[0043] Fig.18 This is an analysis diagram of the expression pattern of DobHLH14 gene in transiently transformed Dendrobium officinale after drought stress; three biological replicates were taken for each sample, and the experimental data were analyzed and processed by WPS and GraphPad Prism 8 software; * and ** indicate significant differences at the 0.05 and 0.01 levels, respectively;

[0044] Fig.19 This is an analysis diagram of the expression pattern of DoSUS2 gene in transiently transformed Dendrobium officinale after drought stress; three biological replicates were taken for each sample, and the experimental data were analyzed and processed by WPS and GraphPad Prism 8 software; * and ** indicate significant differences at the 0.05 and 0.01 levels, respectively;

[0045] Fig. 20This is the result of the analysis of polysaccharide content in transiently transformed Dendrobium officinale after drought stress; * and ** indicate significant differences at the 0.05 and 0.01 levels, respectively. DETAILED DESCRIPTION

[0046] In order to make the objectives, technical solutions and advantages of the embodiments of the present invention more clearly understood, the spirit of the contents disclosed by the present invention will be described in detail below. After understanding the embodiments of the contents of the present invention, any technician in the relevant technical field can change and modify them according to the techniques taught by the contents of the present invention without departing from the spirit and scope of the contents of the present invention.

[0047] The exemplary embodiments of the present invention and the description thereof are used to explain the present invention but are not intended to limit the present invention.

[0048] Example 1

[0049] Cloning, bioinformatics analysis and domain verification of DoSUS2 gene from Dendrobium officinale

[0050] 1. Cloning of the DoSUS2 gene from Dendrobium officinale

[0051] 1. Extraction of total RNA from Dendrobium officinale

[0052] After surface disinfection, the capsules of Dendrobium officinale were sown on the culture medium at room temperature (25±2)℃ and light intensity of 16h·d. -1 After about 6 months of sterile culture, tissue culture seedlings (plant height of about 5 cm) with good growth and consistent growth were selected and irrigated with 20% polyethylene glycol (PEG)-6000 for stress treatment. Leaf tissue samples were collected and quickly frozen in liquid nitrogen for RNA extraction at 0, 1, 3, 6, 9, 12 and 24 hours after treatment. RNA at each treatment period was extracted by CTAB method, and the extracted RNA samples were sent to Shenzhen BGI Genomics Technology Co., Ltd. for transcriptome library construction and sequencing.

[0053] 2. Cloning of the DoSUS2 gene from Dendrobium officinale

[0054] Using the known Yunnan Dendrobium officinale SUS2 (gene ID: LOC110110417) in the GenBank database as a reference sequence, Primer 5.0 software was used to design DoSUS2-specific upstream and downstream amplification primers (DoSUS2-F, DoSUS2-R) as shown in SEQ ID NO: 6 and SEQ ID NO: 7. RT-PCR amplification of the DoSUS2 gene was performed using Dendrobium officinale cDNA as a template.

[0055] The RT-PCR amplification system was 20.0 μL, including: 10×Ex Taq PCR buffer 2.0 μL, DoSUS2-F and DoSUS2-R primers (10.0 μmol·L -1 ) 1.0 μL each, dNTP Mixture (2.5 mmol·L -1 )1μL, cDNA template (40ng·μL -1 )2.0μL, Ex Taq DNA polymerase (5U·μmol -1 )0.25μL.

[0056] RT-PCR amplification procedure: 94℃ pre-denaturation for 3min; 94℃ denaturation for 30s, 58℃ annealing for 30s, 72℃ extension for 60s, 30 cycles; 72℃ extension for 7min. After the RT-PCR product was detected by agarose gel electrophoresis, the amplified target fragment was recovered using a gel recovery kit.

[0057] 3. Sequencing verification of the DoSUS2 gene in Dendrobium officinale

[0058] The target gene recovered from the gel was connected to the pMD18-T linear vector, the connection product was transformed into Escherichia coli DH5α competent cells, and the Escherichia coli competent single clone was picked out for PCR using gene primers DoSUS2-F and DoSUS2-R and vector primers pMD18-TF and pMD18-TR as shown in SEQ ID NO: 8 and SEQ ID NO: 9, respectively. The obtained specific fragment was sequenced and verified, and finally the full-length cDNA sequence of the Dendrobium officinale DoSUS2 gene as shown in SEQ ID No: 3 was obtained.

[0059] 2. Sequence analysis and domain verification of DoSUS2 gene in Dendrobium officinale

[0060] The cDNA sequence of the DoSUS2 gene of Dendrobium officinale obtained in this embodiment is 2424 bp in length and encodes 807 amino acids as shown in SEQ ID NO: 2. The molecular formula, theoretical molecular weight and theoretical isoelectric point of the protein encoded by the DoSUS2 gene of Dendrobium officinale were calculated and deduced using the ExPASyProtParam online analysis tool at the website (https: / / web.expasy.org / protparam / ). The results showed that the molecular formula of the protein encoded by the gene was C 4166 H 6480 N 1104 O 1203 S 24 , the theoretical molecular weight is 92.05 kDa, and the theoretical isoelectric point is 5.97.

[0061] The structural domain of the protein encoded by the DoSUS2 gene of Dendrobium officinale was analyzed by the NCBI-CDD online analysis tool at the website (https: / / www.ncbi.nlm.nih.gov / Structure / cdd / wrpsb.cgi). The analysis results are as follows: Figure 1 As shown, the protein encoded by the DoSUS2 gene of Dendrobium officinale obtained in this embodiment contains the conserved sucrose synthase (PF00862) and glycosyltransferase (PF00534) domains of SUS and belongs to the PLN00142 family member.

[0062] The hydrophilicity of the protein encoded by the DoSUS2 gene of Dendrobium officinale was analyzed using the SPLIT 4.0 SERVER online analysis tool at the website (http: / / split.pmfst.hr / split / 4 / ); the secondary structure and tertiary structure of the protein encoded by the DoSUS2 gene of Dendrobium officinale were predicted and analyzed using the SOPMA online analysis tool at the website (https: / / npsa-prabi.ibcp.fr / cgi-bin / npsa_automat.plpage=npsa_sopma.html) and the SWISS-MODEL online analysis tool at the website (https: / / swissmodel.expasy.org / ); the transmembrane region of the protein encoded by the DoSUS2 gene of Dendrobium officinale was predicted using the TMHMM2.0 SERVER online analysis tool at the website (https: / / services.healthtech.dtu.dk / services / TMHMM-2.0 / ). The analysis results are as follows: Figure 2 As shown, the instability index of the protein encoded by the DoSUS2 gene is 33.48, which is a hydrophobic stable protein. Its secondary structure is mainly α-helix, accounting for 54.15%, followed by random coils, accounting for 26.27%, and β-folded structure accounting for 19.58%. Its tertiary structure is as similar as 73.82% to that of Arabidopsis AtSUS1, and the protein has no transmembrane region.

[0063] The protein sequence encoded by the DoSUS2 gene of Dendrobium officinale obtained in this embodiment was used as the reference sequence, and the BLASTP online program at the website (https: / / blast.ncbi.nlm.nih.gov / Blast.cgiPROGRAM=blastp&PAGE_TYPE=BlastSearch&LIN K_LOC=blasthome) was used for sequence homology search, and the amino acid sequences of the SUS genes of three DoSUS family members with high similarity and four other different plants were selected, and multiple sequence alignment was performed using DNAMAN9.0 software.

[0064] The three selected DoSUS family members and four other SUS genes from different plants are:

[0065] DoSUS1 (Dendrobium officinale,XM_020832908.2), DoSUS3 (Dendrobium officinale, thaliana, At5g20830.1), OsSUS1 (Oryza sativa, Os03t0401300-01), ZmSUS1 (Zea mays, AQL01408.1), StSUS1 (Solanum tuberosum, M18745).

[0066] The Clustal software was used to further compare the sequence homology of the protein sequence encoded by this gene with that of the SUS genes of three DoSUS family members and four other different plants. Figure 3 As shown, the DoSUS2 protein of Dendrobium officinale has a high homology with three DoSUS family members and SUS proteins of four other different plants, all of which have conserved sucrose synthase domain and glycosyltransferase domain.

[0067] Example 2

[0068] Application of Dendrobium officinale DoSUS2 in increasing plant polysaccharide content and breeding drought-tolerant transgenic plants

[0069] Real-time fluorescence quantitative RT-PCR was used to study the expression of DoSUS2 gene in Dendrobium officinale after drought and ABA treatment. The constructed pROKⅡ-DoSUS2 plant expression vector was transformed into Arabidopsis thaliana, and the adversity stress experiment was carried out on DoSUS2 transgenic Arabidopsis thaliana to verify the function of DoSUS2 gene.

[0070] 1. Analysis of DoSUS2 gene expression pattern in Dendrobium officinale after stress

[0071] After surface disinfection, mature capsules of Dendrobium candidum were inoculated in a culture medium set at a culture temperature of 25±2°C. The culture conditions were set to 16 hours of light during the day and 8 hours of light at night. After about 6 months of culture in a sterile environment, tissue culture seedlings with good growth status and a plant height of about 5 to 6 cm were selected and treated with 20% PEG-6000 solution and 100 μmol·L -1The seedlings were irrigated with ABA solution, and the plants irrigated with water were used as controls. Leaf tissue samples were collected at 0h and 3, 6, 9, 12 and 24h after treatment for gene expression detection under stress. The total RNA of the above samples was extracted by Trizol method, and its concentration was accurately measured by Nanodrop micro-spectrophotometer. Reverse transcription was performed according to the instructions of All-in-One First-StrandSynthesis MasterMix kit to synthesize the first-strand cDNA. The synthesized single-strand cDNA was diluted 4 times and used as a template for real-time quantitative RT-PCR.

[0072] According to sequence specificity analysis, Primer Premier 5.0 software was used to design real-time quantitative RT-PCR specific primers for the cloned coding sequence of the Dendrobium officinale DoSUS2 gene, as shown in SEQ ID NO: 12 and SEQ ID NO: 13. The Dendrobium officinale actin gene was used as an internal reference gene for real-time quantitative RT-PCR, and the internal reference gene primers were shown in SEQ ID NO: 14 and SEQ ID NO: 15.

[0073] Using BIO-RAD CFX Connect TM Fluorescence quantitative PCR instrument and Taq Green qPCR Premix Kit was used to detect the expression of DoSUS2 gene under the stress of Dendrobium officinale, and three biological replicates were set for each sample. The reaction system included: 10.0 μL of 1× Taq Green qPCR Premix, 0.4 μL of 10.0 μmol·L -1 Upstream and downstream primers, 1.0 μL of 20 ng μL -1 cDNA, and ddHO to make up to 20.0 μL 2 O. The qPCR reaction program was: 95°C pre-denaturation for 3 minutes; followed by 40 cycles, each cycle including 95°C denaturation for 15 seconds, 60°C annealing for 30 seconds; and finally melting curve analysis: 95°C melting for 5 seconds, 60°C for 1 minute, 95°C for 0 seconds, and 50°C for 30 seconds. Each sample was repeated 3 times and 2 -△△Ct The relative expression of DoSUS2 gene was calculated by real-time fluorescence quantitative RT-PCR. Figure 4As shown in the data, 9 hours after PEG stress treatment, the expression level of DoSUS2 reached the highest level, which was 18.6 times that before treatment, and the difference was significant; 6 hours after ABA treatment, the expression level of DoSUS2 increased by 233 times and reached a peak value, indicating that the DoSUS2 gene may be involved in the response process of drought stress in Dendrobium officinale through the ABA signaling pathway.

[0074] II. Obtaining DoSUS2 transgenic Arabidopsis and identifying its drought tolerance

[0075] 1. Construction of the overexpression vector pROKII-DoSUS2 of the Dendrobium officinale DoSUS2 gene

[0076] According to the multiple cloning site of the plant overexpression vector pROKII and the fusion characteristics of the DoSUS2 gene, homologous sequences at both ends of the SmaI restriction endonuclease site were introduced into the 5' and 3' ends of the DoSUS2 gene when designing primers.

[0077] Using wild-type Dendrobium officinale leaf tissue cDNA as a template, RT-PCR cloning of DoSUS2 gene was performed. The RT-PCR reaction system was 20.00 μL, including 2.00 μL template, 1.00 μL of gene-specific upstream and downstream primers (pROKⅡ-DoSUS2-F and pROKⅡ-DoSUS2-R) (10 μmol / L), 1.00 μL dNTPMix (10 mmol / L), 2.00 μL 10×ExTaqPCRbuffer, and 0.20 μL Ex Taq (5 U / μL). The reaction procedure was 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 2 min, 30 cycles; 72℃ extension for 7 min. The amplified target fragment was recovered using a gel recovery kit. The pROKII vector plasmid was digested with SmaI restriction endonuclease, and after gel recovery, it was purified by T 4 The ligation system was 10.00 μL, including 3.00 μL of pROKⅡ linear vector (0.03 pmol / L), 5.00 μL of DoSUS2 gene fragment (0.03 pmol / L), 10×T 4 DNA ligase buffer 1.00 μL, T 4DNA ligase (350U / μL) 1.00μL. The ligation product was transformed into Escherichia coli DH5α competent cells, and a single clone was picked for bacterial liquid PCR verification and further sequencing verification. The recombinant vector with the correct sequence is the DoSUS2 gene overexpression vector, named pROKⅡ-DoSUS2, and was transformed into Agrobacterium tumefaciens strain EHA105 by conductivity method to obtain positive recombinant bacteria. The nucleotide sequence primers used for PCR amplification of the DoSUS2 gene are shown in the sequences SEQ ID NO: 10 and SEQ ID NO: 11.

[0078] 2. Transformation of Arabidopsis thaliana with recombinant bacteria using pROKII-DoSUS2 plant expression vector

[0079] Agrobacterium-mediated floral dip method was used to transform wild-type Arabidopsis Columbia ecotype with Agrobacterium tumefaciens strain EHA105 carrying plant expression vector pROKII-DoSUS2 (positive recombinant bacteria) to obtain overexpression strains. The harvested Arabidopsis T0 generation seeds were sterilized and sown on MS medium containing 50 mg / L kanamycin to screen for resistant plants. After 7 to 10 days, the selected resistant transgenic DoSUS2 plants were transferred to nutrient soil for normal culture. After 4 to 5 weeks, the leaves were taken and the total DNA of the leaves was extracted using the Trizol method. 1 μL of the total DNA was taken as a template and conventional PCR verification was performed using the vector constructed primers pROKⅡ-DoSUS2-F and pROKⅡ-DoSUS2-R and the vector primers pROKⅡ-F and pROKⅡ-R as shown in SEQ ID NO: 16 and SEQ ID NO: 17, wherein the untransformed wild Arabidopsis thaliana (WT) was used as a negative control and the pROKII-DoSUS2 recombinant plasmid was used as a positive control. The seeds of the T1 generation positive plants were harvested, and after low temperature vernalization, the seeds of the T1 generation positive plants were further screened according to the above method, and then the seeds of the T2 generation positive plants were harvested. The screening was continued until the positive plant T3 transgenic homozygous strain was obtained. The pROKⅡ vector primers shown in SEQ ID NO: 16 and SEQ ID NO: 17 were used to perform PCR detection on the T3 homozygous plants of Arabidopsis thaliana transgenic with DoSUS2 gene; the real-time quantitative RT-PCR specific primers of Dendrobium officinale DoSUS2 gene shown in SEQ ID NO: 12 and SEQ ID NO: 13 were used to perform quantitative and semi-quantitative PCR detection on the T3 homozygous plants of Arabidopsis thaliana transgenic with DoSUS2 gene. The Arabidopsis thaliana ubiquitin protein AtUBQ10 gene was used as the internal reference gene for real-time quantitative RT-PCR, and the internal reference gene primers are shown in the sequences of SEQ ID NO: 18 and SEQ ID NO: 19. The results are shown in FIG. Figure 5The results showed that a total of 5 homozygous T3 lines of Arabidopsis thaliana transgenic with DoSUS2 gene were obtained, among which the DoSUS2-OE2 transgenic line had the highest expression level, and the DoSUS2-OE3 transgenic line ranked second.

[0080] 3. Identification of drought tolerance of positive plants of DoSUS2 transgenic Arabidopsis thaliana T3 generation

[0081] In order to analyze the effect of overexpression of DoSUS2 gene on drought tolerance of Arabidopsis, the seeds of T3 generation overexpression lines of DoSUS2 gene transgenic Arabidopsis (DoSUS2-OE2 and DoSUS2-OE3) and wild-type Arabidopsis were sterilized and then sown on 1 / 2MS (Control), 1 / 2MS containing 200mM mannitol (Drought) and 1 / 2MS containing 2μM abscisic acid (ABA) medium, respectively. The germination rate was counted after 10-15 days. The results are shown in Table 1. Figure 6 As shown in the figure, under normal growth conditions (Control), there is no difference in growth and phenotype between transgenic Arabidopsis and wild-type Arabidopsis (WT), indicating that the DoSUS2 gene has no significant interference with plant growth and phenotype. Under 200mM mannitol (Drought) stress conditions, the average germination rates of DoSUS2-OE2 and DoSUS2-OE3 overexpressing transgenic Arabidopsis lines were 2.93 times and 2.39 times that of the wild-type lines, respectively. Under 2μM abscisic acid (ABA) stress conditions, the average germination rates of DoSUS2-OE2 and DoSUS2-OE3 overexpressing transgenic Arabidopsis lines were 11.09 times and 9.73 times that of the wild-type lines, respectively.

[0082] At the same time, in order to determine the effect of drought stress on the growth of transgenic DoSUS2 gene and wild-type Arabidopsis (WT), 10-day-old Arabidopsis seedlings grown on normal culture medium were transplanted into 1 / 2MS (Control), 1 / 2MS containing 300mM mannitol (Drought), and 1 / 2MS containing 100μM abscisic acid (ABA) medium, and the root length and fresh weight were counted after 7 days of growth. Figure 7 The results showed that under 300 mM mannitol (Drought) stress conditions, the average fresh weight of DoSUS2-OE2 and DoSUS2-OE3 overexpressing transgenic Arabidopsis lines were 2.27 times and 2.16 times that of the wild type (WT), respectively; under 100 μM abscisic acid (ABA) stress conditions, the average fresh weight of DoSUS2-OE2 and DoSUS2-OE3 overexpressing transgenic Arabidopsis lines were 1.36 times and 1.29 times that of the wild type (WT), respectively.

[0083] Three-week-old transgenic Arabidopsis thaliana overexpressing the DoSUS2 gene (DoSUS2-OE2 and DoSUS2-OE3) and wild-type Arabidopsis thaliana (WT) were subjected to simulated drought stress. Figure 8 As shown in the figure, under non-stress conditions (Control), there was no significant difference in the growth status of DoSUS2-OE2 and DoSUS2-OE3 transgenic lines and wild-type Arabidopsis thaliana (WT); however, after 7 days of 400 mM mannitol (Drought) and 200 μM abscisic acid (ABA) stress, the growth status of both DoSUS2-OE2 and DoSUS2-OE3 transgenic lines and wild-type Arabidopsis thaliana (WT) changed. The growth state of the SUS2-OE3 overexpression line was significantly better than that of the wild-type Arabidopsis (WT). The leaves of the wild-type Arabidopsis (WT) line were obviously wilted and yellowed, and the in situ staining area of ​​nitro blue tetrazolium (NBT) and 3,3'-diaminobenzidine (DAB) increased. The wilting and yellowing condition and staining degree were more serious than those of the two transgenic lines DoSUS2-OE2 and DoSUS2-OE3. This shows that under drought and ABA treatment conditions, the DoSUS2 overexpression line showed a lower level of OE2 than the WT. 2- and H 2 O 2 , the stress resistance of DoSUS2 overexpression strain was higher than that of WT.

[0084] The levels of malondialdehyde (MDA), ascorbic acid (ASA), and glutathione (GSH), the activities of peroxidase (POD), superoxide dismutase (SOD), and sucrose synthase (SUS), as well as the contents of glucose, fructose, and soluble sugars in DoSUS2-overexpressing Arabidopsis and WT plants after 7 days of 400 mM mannitol (Drought) and 200 μM abscisic acid (ABA) stress were quantified. Fig. 9 As shown in the figure, after 300mM mannitol (Drought) and 100μM abscisic acid (ABA) stress treatment, the MDA level of DoSUS2 overexpression lines was significantly lower than that of WT; the ASA and GSH levels, POD and SOD enzyme activities of DoSUS2 overexpression lines were significantly higher than those of WT plants, indicating that overexpression of the DoSUS2 gene improved the ROS scavenging ability of transgenic plants under stress. In addition, after 400mM mannitol (Drought) and 200μM abscisic acid (ABA) treatment, the SUS activity in DoSUS2 overexpression lines was significantly higher than that of the control group and WT plants, and the glucose, fructose and soluble sugar contents in DoSUS2 overexpression lines were significantly higher than those of WT, indicating that DoSUS2 overexpression played a powerful role, effectively increasing the sugar accumulation of transgenic Arabidopsis, thereby improving the tolerance of transgenic Arabidopsis to drought.

[0085] Example 3

[0086] Cloning and expression analysis of DoSUS2 gene promoter in Dendrobium officinale

[0087] Using Dendrobium officinale DNA as a template, three asymmetric primers were designed according to the CDS sequence of the DoSUS2 gene, and the promoter sequence of the DoSUS2 gene was cloned by TAIL-PCR technology, with a length of 948 bp. The asymmetric primers for cloning the promoter of the DoSUS2 gene are shown in SEQ ID NO: 20, SEQ ID NO: 21 and SEQ ID NO: 22.

[0088] The cis-acting elements contained in the cloned DoSUS2 gene promoter were analyzed using the PLACE promoter online sequence analysis tool. The results showed that the DoSUS2 gene promoter not only included basic transcription initiation elements such as TATA-box and CAAT-box, but also contained elements such as low temperature, drought, dehydration, hyperosmotic response, water stress regulation and ABA response. This indicates that the DoSUS2 gene may be induced by abscisic acid signals and play an important role in the response to adverse stresses such as drought and low temperature.

[0089] In order to analyze the expression characteristics of the DoSUS2 gene, the DoSUS2 gene promoter was directed to replace the 35S promoter of the vector pCAMBIA1301 plasmid and recombined with the GUS gene to construct a plant overexpression vector pCAMBIA1301-DoSUS2pro::GUS. Escherichia coli and Agrobacterium tumefaciens were transformed, and PCR detection and sequencing verification confirmed that the plant expression vector of the promoter DoSUS2pro::GUS was constructed.

[0090] Further, pCAMBIA1301-DoSUS2pro::GUS was used to transgenic Arabidopsis thaliana to obtain T3 transgenic Arabidopsis thaliana. After the surface of the transgenic seeds was disinfected, they were evenly sown on 1 / 2MS culture medium. Plants at different growth and development stages (1 day, 3 days, 5 days, 10 days, 2 weeks, 4 weeks, etc.) and tissues in different parts (leaves, flowers, inflorescences, pods, seeds, etc.) were taken for GUS staining. The results are shown in Figure 2. Fig.10As shown in the figure, the DoSUS2 gene is expressed in almost all tissues, among which old leaves and roots are dark blue, and young leaves are light blue, indicating that the expression level of the GUS gene is low in young leaves. The petals, sepals, stamens (filaments and anthers), pistils (stigmas), and seed pods of the reproductive period of transgenic Arabidopsis are all blue, while the seed coat and the middle section of the style are not blue. This shows that the GUS gene is successfully expressed in transgenic Arabidopsis, and the expression level is higher in tissues with high sugar content, indicating that the DoSS1-pro promoter not only has expression activity, but also has certain tissue expression specificity.

[0091] Example 4

[0092] Recognition and interaction between DobHLH14 transcription factor and DoSUS2 gene in Dendrobium officinale

[0093] 1. Screening and identification of DobHLH14, an upstream regulatory factor of DoSUS2 gene in Dendrobium officinale

[0094] Previous studies have fully demonstrated that DoSUS2, as a functional gene encoding SUS, can regulate its own expression, increase SUS protein activity, increase intracellular soluble polysaccharide content, and thus maintain cellular osmotic pressure balance, increase polysaccharide content, and prevent cell damage when plants are subjected to abiotic stress. However, the specific genes that regulate the expression of DoSS1 are still unclear.

[0095] Therefore, the leaf tissues of Dendrobium officinale were collected at 1, 3, 6, 9, 12 and 24 hours after drought stress and sent to Shenzhen BGI Genomics Co., Ltd. for high-throughput sequencing. The sequencing platform was Illumina HiSeq TM 2500 / Miseq TM The adapters and low-quality reads in the original sequencing sequences were removed to ensure the quality of information analysis, and finally the quality control data were obtained; the quality control data were aligned with the reference sequence of the Dendrobium officinale genome using Qubit 2.0 software, and assembled using Cufflinks software to obtain transcriptome data. The gene expression level was expressed in FPKM, and differentially expressed genes in response to drought stress were screened. The results are shown in Fig.11 As shown in Figure 2, compared with the untreated Dendrobium officinale (control), there were 361 genes that were differentially expressed after 1, 3, 6, 9, 12 and 24 hours of drought stress. The expression levels of these differentially expressed genes were annotated and screened, and the results were as follows: Fig.12As shown in the figure, a total of 9 transcription factors were screened, including 4 bHLH transcription factors (bHLH14, bHLH74, bHLH25 and AIB), 2 ERF transcription factors (ERF21 and AP2L4), 1 TCP transcription factor (TCP2), 1 MYC transcription factor (MYC4) and 1 MYB transcription factor (MYB306). Among them, DobHLH14 and DoSUS2 have the same expression pattern and the closest clustering relationship, which suggests that DobHLH14 may have an expression regulatory relationship with the DoSUS2 gene.

[0096] 2. Identification of the interaction between DobHLH14 transcription factor and DoSUS2 gene in Dendrobium officinale

[0097] In order to verify whether there is an expression regulatory relationship between DobHLH14 and DoSUS2 genes, we further cloned the CDS sequence of DobHLH14 gene in Dendrobium officinale and verified the recognition interaction relationship between DobHLH14 and DoSUS2 genes by yeast single-hybrid analysis.

[0098] 1. Cloning of the DobHLH14 gene from Dendrobium officinale

[0099] After surface disinfection, the capsules of Dendrobium officinale were sown on the culture medium at room temperature (25±2)℃ and light intensity of 16h·d. -1 After about 6 months of sterile culture, seedlings with good growth were selected, and leaf tissue samples were collected and quickly frozen in liquid nitrogen for RNA extraction. RNA from leaf tissues of Dendrobium officinale was extracted by CTAB method, and single-stranded cDNA was synthesized using a reverse transcription kit.

[0100] Using the known Yunnan Dendrobium officinale bHLH14 (gene ID: LOC110116682) in the GenBank database as a reference sequence, the Primer 5.0 software was used to design DobHLH14-specific upstream and downstream amplification primers (DobHLH14-F, DobHLH14-R) as shown in SEQ ID NO: 23 and SEQ ID NO: 24. RT-PCR amplification of the DobHLH14 gene was performed using Dendrobium officinale cDNA as a template.

[0101] The RT-PCR amplification system was 20.0 μL, including: 10×Ex Taq PCR buffer 2.0 μL, DoSUS2-F and DoSUS2-R primers (10.0 μmol·L -1 ) 1.0 μL each, dNTP Mixture (2.5 mmol·L -1 )1μL, cDNA template (40ng·μL -1 )2.0μL, Ex Taq DNA polymerase (5U·μmol-1 )0.25μL. RT-PCR amplification program: 94℃ pre-denaturation for 3min; 94℃ denaturation for 30s, 58℃ annealing for 30s, 72℃ extension for 60s, 30 cycles; 72℃ extension for 7min. After the RT-PCR product was detected by agarose gel electrophoresis, the amplified target fragment was recovered using a gel recovery kit.

[0102] The target gene recovered from the gel was connected to the pMD18-T linear vector, and the connection product was transformed into Escherichia coli DH5α competent cells. The Escherichia coli competent monoclonal clone was picked out and PCR was performed using gene primers DobHLH14-F and DobHLH14-R and vector primers pMD18-TF and pMD18-TR as shown in SEQ ID NO: 8 and SEQ ID NO: 9, respectively. The obtained specific fragment was sequenced and verified, and finally the full-length cDNA sequence of the Dendrobium officinale DoSUS2 gene as shown in SEQ ID No: 1 was obtained.

[0103] 2. Sequence analysis and domain verification of DobHLH14 gene in Dendrobium officinale

[0104] The cDNA sequence of the DobHLH14 gene of Dendrobium officinale obtained in this embodiment is 1296 bp in length and encodes 422 amino acids as shown in SEQ ID NO: 4. The molecular formula, theoretical molecular weight and theoretical isoelectric point of the protein encoded by the DobHLH14 gene of Dendrobium officinale were calculated and deduced using the ExPASyProtParam online analysis tool at the website (https: / / web.expasy.org / protparam / ). The results showed that the molecular formula of the protein encoded by the gene was C 2011 H 3192 N 586 O 613 S 13 , the theoretical molecular weight is 45.8kDa, and the theoretical isoelectric point is 5.98.

[0105] The NCBI-CDD online analysis tool (https: / / www.ncbi.nlm.nih.gov / Structure / cdd / wrpsb.cgi) was used to analyze the C 2011 H 3192 N 586 O 613 S 13 The structural domains of the proteins encoded by the genes are analyzed. Fig.13 As shown, the protein encoded by the DobHLH14 gene of Dendrobium officinale obtained in this embodiment contains a conserved domain of the bHLH family.

[0106] The hydrophilicity and secondary structure of the protein encoded by the DobHLH14 gene of Dendrobium officinale were analyzed using the SPLIT 4.0SERVER online analysis tool at the website (http: / / split.pmfst.hr / split / 4 / ); the tertiary structure of the protein encoded by the DobHLH14 gene of Dendrobium officinale was predicted and analyzed using the SWISS-MODEL online analysis tool at the website (https: / / swissmodel.expasy.org / ). The analysis results are as follows: Fig.14 As shown, the protein encoded by the DobHLH14 gene is a hydrophilic protein, and its secondary structure is composed of 16.59% Helix (α, pi and 3-10 helix), 12.09% beta-strand (β-folded conformation extended chain) and 71.33% random coil (random coil); its tertiary structure has a similarity of 68.25% with the plant transcription factor MYC2.

[0107] The protein sequence encoded by the DobHLH14 gene of Dendrobium officinale obtained in this embodiment is used as the reference sequence.

[0108] The BLASTP online program (https: / / blast.ncbi.nlm.nih.gov / Blast.cgiPROGRAM=blastp&PAGE_TYPE=BlastSearch&LIN K_LOC=blasthome) was used for sequence homology search, and the amino acid sequences of bHLH genes of 11 other different plants with high similarity were selected, and multiple sequence alignment was performed using DNAMAN 9.0 software.

[0109] The proteins encoded by the selected 11 different plant bHLH genes are:

[0110] Dendrobium chrysotoxum (KAH0457059.1), Cymbidium goeringii (QDF82449.1), Phalaenopsis equestris (XP_020571900.1), Dracaena cambodiana (QOJ43663.1), Elaeis guineensis (XP010909816.1), Cocos nucifera (EHA8587620.1), Acer yangbiense (TXG63085), Nyssa sinensis (KAA8546855), Carpinus fangiana (KAE7999309), Xanthoceras sorbifolia (Xanthoceras sorbifolia) sorbifolium, KAH7578098), Salix brachista, KAB5527240.

[0111] The Clustal software was further used to compare the sequence homology of the protein encoded by the DobHLH14 gene of Dendrobium officinale with the SUS genes of seven other plants with high similarity. Fig.15 As shown, the homology between the DobHLH14 protein of Dendrobium officinale and other plant bHLH proteins is greater than 45.57%, and both have the conserved structural domain of the bHLH protein family in the N segment of bHLH-MYC-N and the HLH region of 260 to 307 amino acid residues.

[0112] 3. Yeast one-hybrid analysis verifies the recognition interaction relationship between DobHLH14 and DoSUS2 genes

[0113] The cis-acting element E-box (5'-CANNTG-3') and its mutant sequence in the promoter sequence of the DoSUS2 gene were connected in series to form three repeating sequences (E-box and ME-box), and according to the fusion characteristics of the reporter vector pHIS2 and E-box and ME-box, EcoR I and Sac I endonucleases were introduced at the 5' end and 3' end, respectively, and primers pHIS2-E-box-F and pHIS2-E-box-R (primer sequences are shown in SEQ ID NO: 25 and SEQ ID NO: 26) and primers pHIS2-ME-box-F and pHIS2-ME-box-R (primer sequences are shown in SEQ ID NO: 27 and SEQ ID NO: 28) for constructing the recombinant reporter vector pHIS2-E-box were designed, respectively. pHIS2-E-box-F and pHIS2-E-box-R, pHIS2-ME-box-F and pHIS2-ME-box-R were renatured into double-stranded DNA fragments, respectively. The renaturation system was 10.0 μL, including: 10×Ex Taq PCR buffer 2.0 μL, forward and reverse primers (10.0 μmol·L -1 ) 4.0 μL each. Renaturation procedure: 95℃ denaturation for 30s, 72℃ for 2min, 37℃ for 2min, 25℃ for 2min. The double-stranded DNA fragment obtained by renaturation was connected to the pHIS2 linear vector after double digestion with EcoR I and Sac I, and the ligation product was transformed into Escherichia coli DH5α competent cells. The Escherichia coli competent monoclonal clone was selected and PCR verified using the vector primers pHIS2-F and pHIS2-R as shown in SEQ ID NO: 29 and SEQ ID NO: 30, respectively. The recombinant vector with the correct sequence is the reporter vector of E-box and ME-box. The constructed pHIS2-E-box and pHIS2-ME-box were stored in a -80℃ ultra-low temperature refrigerator for future use.

[0114] According to the fusion characteristics of the effect vector pGADT7-Rec2 and the DobHLH14 homologous gene, the pGADT7-Rec2 homologous sequences at both ends of the Sma I nuclease were introduced into the 5' end and 3' end of the DobHLH14 gene, and the primers pGADT7-Rec2-DobHLH14-F and pGADT7-Rec2-DobHLH14-R (primer sequences are shown in SEQ ID NO: 31 and SEQ ID NO: 32) for constructing the effect vector pGADT7-Rec2-DobHLH14 were designed. 0.2 μg of DobHLH14 homologous sequence PCR recovery product, 0.1 μg of Sma I single enzyme digested pGADT7-Rec2 linear vector, 5 μL of denatured salmon sperm DNA (10 μg / μL) and 0.1 μg of the corresponding pHIS2-E-box and pHIS2-ME-box were added to Y187 yeast competent cells respectively, and gently mixed. Then add 500μL PEG / LiAc and 20μL DMSO, mix gently by inversion, incubate at 42℃ for 20min, centrifuge and add 800μL YPDPlus Medium to resuspend the yeast cells, incubate at 30℃ and 220rpm for 30-45min. Centrifuge at 12,000rpm for 15s, resuspend the yeast cells with 1mL 0.9% NaCl solution, apply to DDO, TDO and TDO / 3-AT screening medium respectively, and incubate at 30℃ for 3-5d. Fig.16 As shown, DobHLH14 can recognize and interact with the E-box cis-acting element in the DoSUS2 promoter sequence, indicating that DoSUS2 is the target functional gene of DobHLH14 transcriptional regulation. This suggests that DobHLH14 regulates the transcriptional expression of the DoSUS2 gene by specifically binding to the E-box element in the DoSUS2 promoter, thereby playing an important role in the biosynthesis of polysaccharides in Dendrobium officinale.

[0115] Example 5

[0116] Construction of plant expression vector of DobHLH14 gene from Dendrobium officinale

[0117] 1. Construction of the overexpression vector pROKII-DobHLH14 of the Dendrobium officinale DobHLH14 gene

[0118] According to the multiple cloning site of the plant overexpression vector pROKII and the homologous fusion characteristics of the DobHLH14 gene, the homologous sequences at both ends of the SamI restriction endonuclease site were introduced at the 5' end and 3' end of the DobHLH14 gene when designing primers, and the primers pROKⅡ-DobHLH14-F and pROKⅡ-DobHLH14-R were designed for constructing the plant overexpression vector pROKII-DobHLH14. The primer sequences are shown in SEQ ID NO: 33 and SEQ ID NO: 34.

[0119] Using wild-type Dendrobium officinale leaf tissue cDNA as template, RT-PCR cloning of DobHLH14 gene was performed. The RT-PCR reaction system was 20.00 μL, including 2.00 μL template, 1.00 μL of gene-specific upstream and downstream primers (pROKⅡ-DobHLH14-F and pROKⅡ-DobHLH14-R) (10 μmol / L), 1.00 μL dNTPMix (10 mmol / L), 2.00 μL 10×ExTaqPCRbuffer, and 0.20 μL Ex Taq (5 U / μL). The reaction procedure was 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 90 s, 30 cycles; 72℃ extension for 7 min. The amplified target fragment was recovered using a gel recovery kit. The pROKII vector plasmid was digested with SamHI, and then recovered and connected with the In-Fusion Snap Assembly Master Mix enzyme kit. The connection system was 10.00μL, including 3.00μL of pROKⅡ digested vector (0.03pmol / L), 5.00μL of DobHLH14 gene amplification recovery product (0.03pmol / L), and 2.00μL of 5×In-Fusion HD Enzyme Premix. The connection product was transformed into Escherichia coli DH5α competent cells, and a single clone was picked for bacterial liquid PCR verification and further sequencing verification. The recombinant vector with the correct sequence is the DobHLH14 gene overexpression vector, named pROKⅡ-DobHLH14, and transformed into Agrobacterium tumefaciens strain EHA105. The constructed EHA105 (pROKⅡ-DobHLH14) was stored in a -80℃ ultra-low temperature refrigerator for future use.

[0120] 2. Construction of the suppression expression vector pFGC5941-DobHLH14 of the DobHLH14 gene in Dendrobium officinale

[0121] The DobHLH14 gene suppression expression vector was constructed using RNAi interference technology. First, the forward expression vector pFGC5941-DobHLH14-cis was constructed. According to the multiple cloning site of the plant suppression expression vector pFGC5941 and the fusion characteristics of the DobHLH14 gene, NcoI and AscI restriction endonuclease sites were introduced at the 5' and 3' ends of the DobHLH14 gene, respectively, and primers pROKⅡ-DobHLH14-cis-F and pROKⅡ-DobHLH14-cis-R were designed for constructing the plant overexpression vector pROKII-DobHLH14-cis. The primer sequences are shown in SEQ ID NO: 35 and SEQ ID NO: 36.

[0122] Using the purified product of DobHLH14 gene as template and pFGC5941-DobHLH14-cisF / pFGC5941-DobHLH14-cisR as primers, PCR was performed to amplify the DobHLH14-cis target fragment with NcoI and AscI restriction endonuclease sites. The DobHLH14-cis PCR product was recovered and purified using a gel recovery kit, and then the DobHLH14-cis target fragment and the plant RNAi vector pFGC5941 plasmid were double-digested with NcoI and AscI restriction endonucleases, respectively. After incubation at 37°C for 1 hour, the obtained enzyme digestion products were recovered and purified, and then T 4 DNAligase catalyzes the connection between the purified DobHLH14-cis double-enzyme digested target fragment and the plant RNAi vector pFGC5941 double-enzyme digested large fragment, and the reaction conditions are incubated at 16°C for 2 hours. The ligation product is transformed into E. coli DH5α competent cells, and the recombinant vector is named pFGC5941-DobHLH14-cis. After PCR and sequencing verification, the plasmid is extracted and stored for later use.

[0123] Secondly, pFGC5941-DobHLH14-anti was constructed. According to the multiple cloning site of the recombinant vector pFGC5941-DobHLH14-cis and the fusion characteristics of the DobHLH14-anti gene, BamHI and XbaI restriction endonuclease sites were introduced at the 5' and 3' ends of the DobHLH14-anti gene, respectively, when designing primers, and primers pROKⅡ-DobHLH14-anti-F and pROKⅡ-DobHLH14-anti-R were designed for constructing the plant overexpression vector pROKII-DobHLH14-anti. The primer sequences are shown in SEQ ID NO: 37 and SEQ ID NO: 38.

[0124] The purified product of DobHLH14 gene was used as template, and pFGC5941-DobHLH14-anti-F and pFGC5941-DobHLH14-anti-R were used as primers to PCR amplify the DobHLH14-anti target fragment with BamHI and XbaI restriction endonuclease sites. As above, after gel recovery, the DobHLH14-anti target fragment and the recombinant vector pFGC5941-DobHLH14-cis were double-digested with BamHI and XbaI restriction endonucleases respectively. The obtained digestion products were recovered and purified, and T 4 DNAligase catalyzes the connection of the purified DobHLH14-anti double-enzyme digested target fragment and the pFGC5941-DobHLH14-cis double-enzyme digested vector fragment at 16°C for 2h. The ligation product is then transformed into Escherichia coli DH5α competent cells, and a single clone is picked for bacterial liquid PCR detection of positive clones, and further sequenced for verification. The DobHLH14 gene inhibition expression vector was obtained, named pFGC5941-DobHLH14, and transformed into Agrobacterium tumefaciens EHA105 strain. The constructed EHA105 (pFGC5941-DobHLH14) was stored in a -80°C ultra-low temperature refrigerator for future use.

[0125] Example 6

[0126] Transient transformation of DobHLH14 gene in Dendrobium officinale

[0127] In this example, the DobHLH14 overexpression vector pROKII-DobHLH14 (DobHLH14-OE) and the DobHLH14 suppression expression vector pFGC5941-DobHLH14 (DobHLH14-SE) constructed in Embodiment 5 were respectively transferred into Dendrobium officinale by Agrobacterium-mediated efficient transient transformation technology to transiently overexpress or suppress the expression of the DobHLH14 gene. At the same time, the pROKII empty vector was transferred into Dendrobium officinale as a control (Empty).

[0128] The specific method is as follows:

[0129] 1. Select tissue culture seedlings of Dendrobium officinale that have been subcultured for 60 days and have a plant height of 2.5-3.0 cm, and put them into 1 / 4MS high osmotic treatment solution containing 25% (w / v) sucrose + 0.01% (v / v) Triton X-100 for 15 minutes.

[0130] 2. The Dendrobium officinale tissue culture seedlings treated with hyperosmotic pressure in step 1 were transferred to Agrobacterium tumefaciens infection solution containing pROKII-DobHLH14 recombinant vector, pFGC5941-DobHLH14 recombinant vector and pROKII empty vector, respectively. The infection solution OD 600 is 0.8, and placed in a constant temperature shaking incubator at 22°C and 100rpm for an infection time of 4.5h.

[0131] 3. Take out the Dendrobium officinale tissue culture seedlings after infection in step 2, and quickly wash them three times in a medium osmotic treatment solution containing 500 mM mannitol containing 150 μM acetosyringone.

[0132] 4. Take out the Dendrobium officinale tissue culture seedlings washed in step 3, dry them with sterile filter paper, place them in a co-culture solid medium containing 85 μM kanamycin, and culture them in the dark for 48 hours before switching to a photoperiod of 16 h light / 8 h dark and room temperature (25±2°C) for further culturing for 5 days.

[0133] In order to further analyze the expression of DobHLH14 gene in transient overexpression and suppressed expression of Dendrobium officinale, total RNA was extracted from transiently infected protocorms of Dendrobium officinale, reverse transcribed into cDNA, and the expression of DobHLH14 gene was analyzed by real-time fluorescence quantitative PCR (RT-qPCR). Fig.17 As shown, compared with Empty, the expression level of DobHLH14 in the overexpression strain was significantly increased, while it was significantly decreased in the suppressed expression strain, which indicates that the instantaneous transformation of DobHLH14 gene into Dendrobium officinale was successfully obtained in this specific embodiment.

[0134] Example 7

[0135] Gene expression analysis of transient DobHLH14 transgenic Dendrobium officinale under drought stress

[0136] In order to further analyze the expression of DobHLH14 and DoSUS2 genes in transgenic Dendrobium officinale seedlings, the total RNA of DobHLH14 transgenic Dendrobium officinale seedlings under normal growth conditions (Control), 200mM mannitol (Drought) and 100μM abscisic acid (ABA) stress for 24h was extracted, reverse transcribed into cDNA, and the expression patterns of DobHLH14 and DoSUS2 genes were analyzed by RT-qPCR. The results are shown in Figure 2. Fig.18 and Fig.19As shown in the figure, the expression patterns of DobHLH14 and DoSUS2 genes are consistent. Under normal growth conditions, compared with Empty, the expression levels of DobHLH14 and DoSUS2 genes in the overexpression strain were significantly increased; while in the suppressed expression strain, they were significantly decreased, indicating that DobHLH14 can regulate the expression of DoSUS2 gene. Under mannitol and abscisic acid stress, compared with the suppressed expression strain, the expression levels of DobHLH14 and DoSUS2 genes in the overexpression strain and Empty were significantly increased; compared with Control, the expression levels of DobHLH14 and DoSUS2 genes in the overexpression strain after drought stress were significantly higher than those in the Empty strain, and reached a very significant difference level, indicating that DobHLH14 plays a key role in regulating the expression of DoSUS2 gene in the response of Dendrobium officinale to drought stress.

[0137] Example 8

[0138] Analysis of polysaccharide content in transient DobHLH14 transgenic Dendrobium officinale under drought stress

[0139] In order to further analyze the effect of the increased expression of DobHLH14 and DoSUS2 genes in transgenic Dendrobium officinale seedlings on the polysaccharide content of transgenic Dendrobium officinale, the present embodiment uses the water extraction and alcohol precipitation method to prepare polysaccharide extracts of DobHLH14 transgenic Dendrobium officinale seedlings under normal growth conditions (Control), 200mM mannitol (Drought) and 100μM abscisic acid (ABA) stress for 24h, respectively, and the maximum absorption peak at a wavelength of 483nm is determined by the phenol-sulfuric acid method. Anhydrous glucose is used as the reference substance, and each sample is set up with 3 biological replicates to calculate the polysaccharide content in the above samples. GraphPad Prism8 software is used for data processing and analysis. The results are shown in the figure. Fig. 20 As shown in the figure, under normal growth conditions, compared with Empty, the polysaccharide content in the DobHLH14 transgenic overexpression line was significantly increased, 3.87% higher than that in the Empty plant; while the polysaccharide content in the suppressed expression line was slightly reduced, 1.69% lower than that in Empty, indicating that the overexpression of DobHLH14 regulated the expression of the DoSUS2 gene and thus increased the polysaccharide content of Dendrobium officinale. Under mannitol and abscisic acid stress, the polysaccharide content of the DobHLH14 transgenic overexpression line was significantly increased, 6.13% and 3.57% higher than that in Empty, respectively, indicating that the overexpression of DobHLH14 increased the expression of the DoSUS2 gene, thereby increasing the activity and stability of the sucrose synthase protein, thereby increasing the content of soluble polysaccharides in cells, and thus playing an important role in the drought stress response process.

[0140] In summary, through the analysis of transgenic Dendrobium officinale and Arabidopsis thaliana, the salt-tolerance mechanism of Dendrobium officinale DobHLH14 regulating DoSUS2 gene expression was comprehensively analyzed from two aspects: homologous overexpression of DobHLH14 and heterologous overexpression of DoSUS2 gene. The results showed that under drought stress, the regulation of DoSUS2 gene expression by Dendrobium officinale DobHLH14 transcription factor significantly increased the polysaccharide content of transgenic plants. Therefore, this method has a very important application prospect for preparing high-polysaccharide and drought-resistant transgenic plants, especially perennial herbaceous transgenic Dendrobium plants.

Claims

1. A method for regulating the expression of DoSUS2 under drought stress to increase the polysaccharide content of Dendrobium officinale gene DobHLH14, characterized in that The nucleotide sequence of DobHLH14 is shown in SEQ ID No:

4.

2. The amino acid sequence encoded by the gene DobHLH14 for regulating DoSUS2 expression under drought stress to increase the polysaccharide content in Dendrobium officinale as claimed in claim 1 is shown in SEQ ID NO:

5.

3. The gene DobHLH14 for regulating the expression of DoSUS2 under drought stress to increase the polysaccharide content of Dendrobium officinale as claimed in claim 1, characterized in that The DobHLH14 is used in increasing the polysaccharide content of plants or breeding drought-resistant transgenic plants.

4. The use according to claim 3, characterized in that The plant overexpression vector containing DobHLH14 is constructed and applied in increasing the polysaccharide content of plants or breeding drought-resistant transgenic plants.

5. The use according to claim 3 or 4, characterized in that The plants are woody plants.

6. The use according to claim 5, characterized in that The woody plant is Dendrobium officinale or Dendrobium nobile.

7. The use according to claim 3, characterized in that The plant overexpression vector containing DobHLH14 is pROKII-DobHLH14.

8. The use according to claim 7, characterized in that The plant overexpression vector pROKII-DobHLH14 is constructed as follows: Using wild-type Dendrobium officinale leaf tissue cDNA as a template, using pROKⅡ-DobHLH14-F and pROKⅡ-DobHLH14-R primers, RT-PCR cloning of DobHLH14 gene was performed, a gel recovery kit was used to recover the amplified target fragment, the pROKII vector plasmid was digested with SamHI, and after the fragment was recovered, it was connected using a kit, and the connection product was transformed into Escherichia coli DH5α competent cells, and a single clone was picked for verification. After the verification was correct, the plant overexpression vector was pROKII-DobHLH14; the pROKⅡ-DobHLH14-F sequence is as follows: CTCTAGAGGATCCCCATGGCTGATCACAGAACCTTG; the pROKⅡ-DobHLH14-R sequence is as follows: TCGAGCTCGGTACCCTTAATCATGGTGCAAAGGAAC.

9. The use according to claim 7, characterized in that The reaction system of the RT-PCR cloning is 2.00 μL of template, 1.00 μL of 10 μmol / L pROKⅡ-DobHLH14-F, 1.00 μL of 10 μmol / L pROKⅡ-DobHLH14-R, 1.00 μL of 10 mmol / L dNTPMix, 2.00 μL of 10×Ex TaqPCRbuffer, and 0.20 μL of 5U / μL Ex Taq; the reaction program is 94°C pre-denaturation for 3 min; 94°C denaturation for 30 s, 58°C annealing for 30 s, 72°C extension for 90 s, 30 cycles; 72°C extension for 7 min.

10. The use according to claim 7, characterized in that The connection system is 3.00 μL of 0.03 pmol / L pROKⅡ restriction vector, 5.00 μL of 0.03 pmol / L DobHLH14 gene amplification recovery product, and 2.00 μL of 5×In-Fusion HDEnzyme Premix.

Images