SNP (Single Nucleotide Polymorphism) site for detecting or inheriting meat traits of improved Dam long-tail chickens as well as application, primer and method

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) site for inheriting and improving meat quality traits of long-tailed chicken on Dam, application of the SNP site, a primer for detection, a method for detecting the meat quality traits of long-tailed chicken on Dam by utilizing the site, and a genetic breeding method. The SNP molecular marker is a variation site g.96619544Cgt of a 12th exon of a GBE1 gene on a chicken chromosome 1; the gene is T (rs313212342), the reference genome is GRCg6a, and the transcript is ENSGALT00000091071. The leg muscle fatty acid content of the CT genotype of the site is obviously higher than that of the TT genotype (Plt; 0.05), especially in key indexes of polyunsaturated fatty acids (PUFAs) such as alpha-linolenic acid and the like, and the CT genotype is a dominant genotype of indexes such as carcass weight, abdominal fat weight, leg muscle weight, full eviscerating weight and the like.

Description

Technical Field

[0001] The present invention belongs to the field of molecular genetics and poultry breeding, and specifically relates to a SNP site and application for detecting or genetically improving chicken quality traits of Bashang longtail chicken, primers for detection, a method for detecting chicken quality traits of Bashang longtail chicken based on the SNP site, and a method for genetically improving chicken quality traits. Background Art

[0002] With the development of modern animal husbandry and the increasing demand of consumers for healthy food, the quality of poultry products has received extensive attention, especially the meat flavor and nutritional content. The evaluation indicators of chicken quality mainly include fatty acid content, slaughter performance and meat quality characteristics:

[0003] Fatty acid content: Polyunsaturated fatty acids (PUFAs), such as docosahexaenoic acid (DHA) and α-linolenic acid, have become the focus of attention due to their significant benefits to human health.

[0004] Slaughter performance: Slaughter rate (over 80%), evisceration rate (over 60%), leg muscle weight and leg muscle rate, etc., are important indicators for evaluating chicken production.

[0005] Meat quality characteristics: Shear force (reflects meat tenderness), meat color (brightness value L*, redness value a*), water-binding capacity and pH value (affects meat juiciness and shelf life) directly determine the market acceptance and quality of chicken. Normal broiler pH range 24 hours after slaughter is 5.8-6.3. Too high or too low pH is not conducive to meat preservation and cooking, and determines shelf life by affecting microbial reproduction. Lower pH prolongs shelf life, and moderately high pH (6.0-6.3) improves chicken tenderness. Maintaining an appropriate pH range (5.8-6.3) is an important part of ensuring high quality chicken.

[0006] Traditional methods for improving chicken quality traits mainly rely on phenotypic measurements of adult chickens, that is, selecting excellent individuals by analyzing the fatty acid content and slaughter performance of chicken. However, this method has disadvantages such as long measurement time, high cost, complex operation of live chickens, inability to conduct early selection, low breeding efficiency, and slow progress.

[0007] In recent years, molecular marker-assisted selection (MAS) technology has been gradually applied in poultry breeding. MAS technology can identify genotypes in the early development stage of chickens by identifying genetic markers that are significantly associated with target traits, thereby achieving rapid and accurate early selection, greatly improving breeding efficiency and reducing costs. The GBE1 gene (glycogen branching enzyme gene) plays a core role in glycogen metabolism, affecting glycogen solubility and dynamic balance by regulating the structure of glycogen branch chains. Studies in recent years have shown that this gene plays an important role in metabolic disorders and fat deposition. Its expression in the liver and skeletal muscle not only regulates glycogen storage and metabolism, but may also further affect the synthesis and decomposition of fatty acids through the supply of glycogen metabolites. In existing studies, there has been no report on the association between the meat quality traits of the specific chicken species, the Bashang Longtail Chicken, and the GBE1 gene. Therefore, it is urgent to carry out relevant research and develop new molecular marker-assisted selection methods to optimize the meat quality traits of the Bashang Longtail Chicken. Summary of the invention

[0008] The purpose of the present invention is to provide a SNP site for detecting or genetically improving the meat quality traits of Bashang longtail chicken and its application, the SNP site is the variable site g.96619544C>T (rs313212342) of the 12th exon of the GBE1 gene on chicken chromosome 1. Specifically, the SNP site g.96619544C>T determined by the present invention is located in the 12th exon of the GBE1 gene, which is a synonymous mutation, the 26th amino acid arginine remains unchanged, the reference genome is GRCg6a, and the transcript is ENSGALT00000091071. The study found that the fatty acid content of the leg muscle of the CT genotype at this site is significantly higher than that of the TT genotype (P<0.05), especially in key indicators such as polyunsaturated fatty acids (PUFAs) such as α-linolenic acid, and the CT genotype is the dominant genotype for indicators such as carcass weight, abdominal fat weight, leg muscle weight and whole carcass weight.

[0009] The present invention also provides a primer set for detecting meat quality traits of Bashang Longtail Meat, and the detection of meat quality traits is achieved by detecting the above-mentioned SNP sites:

[0010] Upstream primer F: 5′-GGCACTTGTTGGTGATAAGACA-3′;

[0011] Downstream primer R: 5′-CCTGCCAAGCCTTCTGTAGATA-3′.

[0012] The present invention also provides a method for detecting the genotype of meat quality traits of Bashang long-tailed fish, comprising the following steps:

[0013] Step 1: extracting the genomic DNA template of Bashang long-tail chicken, and performing PCR amplification using the above primers to obtain an amplified product;

[0014] Step 2: Sequence the amplified product to determine the SNP typing. The meat quality traits of individuals with genotype CT are the best, the meat quality traits of individuals with genotype CC are medium, and the meat quality traits of individuals with genotype TT are the worst.

[0015] Preferably, the reaction system and procedure of PCR amplification are as follows:

[0016] The PCR reaction system included: Premix Taq 10.0 μL, 1.0 μL each of the aforementioned upstream and downstream primers (10.0 μmol / L), 1.0 μL of template DNA, and 7.0 μL of double distilled water.

[0017] The PCR reaction program included: pre-denaturation at 94°C for 10 minutes; denaturation at 94°C for 30 seconds; annealing at 56.4°C for 30 seconds; extension at 72°C for 1 minute, repeated for 35 cycles; final extension at 72°C for 10 minutes; and storage at 4°C.

[0018] The present invention also provides a method for genetically improving chicken meat traits, by detecting the genotypes of individuals in the population at the above-mentioned SNP sites, preferentially retaining CT genotype individuals as the core population, and rationally selecting mating to maintain the CT genotype ratio to avoid excessive TT genotype or loss of C allele.

[0019] The beneficial effect of the present invention is that the molecular genetic marker of the variable site g.96619544C>T (rs313212342) of the 12th exon of the GBE1 gene on chromosome 1 can be effectively used for the identification of the meat quality traits of the Bashang Longtail Chicken. By early detection of SNP genotypes, excellent populations can be quickly screened, the breeding process can be accelerated, the content of multiple fatty acids in leg muscles and slaughter performance can be improved, and higher quality chicken products can be provided to consumers, optimizing population resource allocation. The present invention first determined the significant correlation between the SNP site g.96619544C>T of the chicken GBE1 gene and the meat quality traits of the Bashang Longtail Chicken, designed specific primers for detecting meat quality traits, and developed an accurate genotype identification method based on PCR amplification and sequencing. Using the genotype information of the SNP site, the efficiency and scientificity of the breeding of the Bashang Longtail Chicken can be significantly improved. The present invention provides a new means for the molecular breeding of the meat quality traits of the Bashang Longtail Chicken, which can be applied to large-scale breeding practices to reduce breeding cycles and costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 An example diagram of the PCR electrophoresis results of the gene target fragment of the present invention.

[0021] Figure 2 An exemplary diagram of genotyping according to the present invention. DETAILED DESCRIPTION

[0022] Example 1 Obtaining GBE1 gene fragments and establishing a polymorphism detection method

[0023] Log in to the Ensembl database and obtain the chicken GBE1 gene sequence (accession number ENSGALG00000042771). The variant site g.96619544C>T is located on chromosome 1 of the GRCg6a reference genome. Use the Primer 3 online tool to design specific primers:

[0024] Upstream primer F: 5′-GGCACTTGTTGGTGATAAGACA-3′;

[0025] Downstream primer R: 5′-CCTGCCAAGCCTTCTGTAGATA-3′.

[0026] The genomic DNA of the Bashang long-tailed chicken was extracted and PCR amplified using the above primers. The PCR reaction system included: Premix Taq 10.0 μL, upstream and downstream primers (10.0 μmol / L) 1.0 μL each, template DNA 1.0 μL, double distilled water 7.0 μL; PCR reaction program: 94℃ pre-denaturation for 10 minutes; 94℃ denaturation for 30 seconds; 56.4℃ annealing for 30 seconds; 72℃ extension for 1 minute, repeated 35 cycles; 72℃ final extension for 10 minutes; 4℃ storage. PCR amplification obtained a target fragment, and the electrophoresis results were as follows: Figure 1 As shown, the length of the target amplified fragment is 251 bp, and the band is clear and in line with expectations, verifying the correctness of the primer design. The amplified product was sequenced to verify that the SNP site g.96619544C>T is located at the 104th base of the nucleotide sequence shown (C / T mutation).

[0027] The nucleotide sequence is:

[0028] AATAGGCACTTGTTGGTGATAAGACATTGGCATTTCGATTGATGGAT GCAGAGATGTACACAAACATGAGTGTGTTCACACCTCTTACTCCAGTTAT TGATCG C / T GGAATCCAGCTTCATAAAATGATTCGCCTCATTACTCACACG CTTGGAGGAGATGGCTATCTGAACTTCATGGGTAAGTAATCTTAGGAGCATGTCTTTCATTTTCTTATCTACAGAAGGCTTGGCAGGGAAATAAAAATATATGGTACCATCTTACAAC

[0029] Example 2: Correlation analysis between GBE1 site polymorphism and meat quality traits of Bashang longtailed chicken

[0030] 1. Experimental Materials and Data Collection

[0031] Leg muscle samples were collected from 60 Bashang long-tail chickens, and their meat quality traits were recorded. The chickens were bled out of the neck during slaughter and weighed using a Meilen electronic weighing scale in accordance with the Technical Manual for Livestock and Poultry Genetic Resources Survey. After slaughter, the carcass weight, whole carcass weight, leg muscle weight and abdominal fat weight of each hen were weighed using an electronic scale, and the proportion of each indicator was calculated.

[0032] Measure and record the pH value of the leg muscle of each chicken: Determine the pH value of the leg muscle 45 minutes and 24 hours after slaughter according to "NYT1333-2007 Determination of Meat Quality of Livestock and Poultry".

[0033] Drip loss rate, cooking loss rate and shear force: carried out in accordance with "NYT 1333-2007 Determination of Meat Quality of Livestock and Poultry".

[0034] Meat color: The lightness value (L*), redness value (a*) and yellowness value (b*) of leg muscle were measured using a CR400 colorimeter. Each sample was measured 3 times and the average value was taken.

[0035] The fatty acid content in leg muscle was determined using a gas chromatograph from the Beijing Institute of Nutritional Resources in accordance with GB / T 17377-2008 Gas Chromatographic Analysis of Fatty Acid Methyl Esters in Animal and Plant Oils.

[0036] 2. Genotyping

[0037] The genomic DNA of each chicken was extracted and PCR amplified using the primers designed in Example 1. The sequencing typing results are as follows: Figure 2 As shown, the sample genotype was confirmed to be CC, CT, or TT.

[0038] 3. Correlation Analysis

[0039] The association analysis between SNP genotype and leg muscle fatty acid content and slaughter performance indexes was performed using one-way analysis of variance. The results are shown in Tables 1 and 2.

[0040] Table 1: The contents of α-linolenic acid, myristic acid, cis-11-eicosadienoic acid, linoleic acid, oleic acid, palmitic acid, stearic acid, cis-11,14-eicosadienoic acid and fatty acids in leg muscle of CT genotype were significantly higher than those in TT genotype (P<0.05).

[0041] Table 2: The carcass weight, eviscerated weight and abdominal fat weight of individuals with CT genotype were significantly higher than those with CC genotype and TT genotype (P<0.05); the leg muscle weight of individuals with CT genotype was significantly higher than that of individuals with TT genotype (P<0.05), and there was no significant difference between CC genotype and TT and CT genotypes (P>0.05). The pH value of leg muscle of individuals with TT genotype was significantly higher than that of individuals with CC genotype 24 hours after slaughter (P<0.05).

[0042] Table 1 Association analysis between the g.96619544C>T site of GBE1 gene and fatty acid content

[0043]

[0044]

[0045] Table 2 Association analysis results between polymorphism of g.96619544C>T locus of GBE1 gene and slaughter and meat quality traits

[0046]

[0047]

[0048] Through the method of the present invention, the significant correlation between the SNP site g.96619544C>T and the meat quality traits of the Bashang longtail chicken was clarified, providing a scientific basis for the practical application of molecular marker-assisted selection technology in poultry breeding.

Claims

1. An application of a SNP locus as a detected object in the detection of meat quality traits of Bashang Longtail Meat or genetic breeding, characterized in that: The SNP site is the variation site g.96619544C>T in the 12th exon of the GBE1 gene on chicken chromosome 1, with GRCg6a as the reference genome.

2. The use according to claim 1, characterized in that In the detection of meat quality traits, the meat quality traits are best when the genotype at the SNP site is CT, medium when the genotype is CC, and worst when the genotype is TT; in genetic breeding, individuals with a genotype of CT at the SNP site and / or individuals with a genotype of CC at the SNP site are retained, and individuals with a genotype of TT at the SNP site are eliminated.

3. The use according to claim 1, characterized in that The meat quality traits are one or more of the unsaturated fatty acid content, saturated fatty acid content, leg muscle shear force, color index, drip loss rate, cooking loss rate, pH value of the leg muscle 45 minutes after slaughter, and pH value of the leg muscle 24 hours after slaughter.

4. A primer set for detecting meat quality traits of Bashang longtail chicken, which detects meat quality traits by detecting the SNP site described in claim 1, wherein the primer set is upstream primer F: 5'-GGCACTTGTTGGTGATAAGACA-3'; Downstream primer R: 5′-CCTGCCAAGCCTTCTGTAGATA-3′.

5. A method for detecting meat quality traits of Bashang Longtail Meat, characterized in that: The genotype at the SNP site in claim 1 is detected. When the genotype is CT, the meat quality trait is the best, when the genotype is CC, the meat quality trait is medium, and when the genotype is TT, the meat quality trait is the worst.

6. The method for detecting meat quality traits of Bashang Longtail Meat according to claim 5, characterized in that The steps include: Step 1: extracting a genomic DNA template from the Bashang long-tail chicken, and performing PCR amplification using the primer set described in claim 4 to obtain an amplified product; Step 2: Sequence the amplified product to determine the genotype at the SNP site. The meat quality trait of individuals with genotype CT is the best, the meat quality trait of individuals with genotype CC is medium, and the meat quality trait of individuals with genotype TT is the worst.

7. The method for detecting meat quality traits of Bashang Longtail Meat according to claim 6, characterized in that: The reaction system and reaction procedure of the PCR amplification are as follows: Reaction system: Premix Taq 10.0 μL, the concentration of the upstream primer and the downstream primer were both 10.0 μmol / L, the volume was 1.0 μL each, template DNA 1.0 μL, double distilled water 7.0 μL. Reaction procedure: pre-denaturation at 94°C for 10 minutes; denaturation at 94°C for 30 seconds; annealing at 56.4°C for 30 seconds; extension at 72°C for 1 minute, repeated 35 cycles; final extension at 72°C for 10 minutes; storage at 4°C.

8. A method for genetically improving meat quality traits of Bashang longtailed chicken, characterized in that: The genotypes of individuals in the Bashang long-tail chicken population at the SNP site described in claim 1 are detected, individuals with genotype CT and genotype CC are retained, and individuals with genotype TT are eliminated.

9. The method for genetically improving chicken meat traits according to claim 8, characterized in that: Only individuals with genotype CT were retained.

Images