Milk-derived Kluyveromyces marxianus and application of milk-derived Kluyveromyces marxianus in milk residue preparation

Abstract

The invention provides a milk source Kluyveromyces marxianus and application of the milk source Kluyveromyces marxianus in preparation of milk residues, the Kluyveromyces marxianus is preserved in the China Center for Type Culture Collection, and the preservation number is CCTCC (China Center for Type Culture Collection) NO: M20221259. Compared with other saccharomycetes, the kluyveromyces marxianus SY11 can more effectively decompose protein in cow milk to generate amino acid, generate a proper amount of alcohol and carbon dioxide, promote cow milk solidification and whey removal and form a uniform porous structure in the preparation of the milk residues, and compared with commercially available milk residues, the prepared milk residues are milky white in color and free of toxic and side effects. The taste and the texture are better.

Description

Technical Field

[0001] The invention relates to the technical field of food processing, in particular to a strain of Kluyveromyces marxii and application thereof in the preparation of milk residues. Background Art

[0002] Kluyveromyces marxense belongs to the genus Kluyveromyces and is listed as an edible species that can be added to fermented foods. Patent CN201510527940.0 discloses a new strain of Kluyveromyces marxense that can be used to prepare kombucha protein beverages and lactose hydrolysis.

[0003] Milk residue is a traditional Tibetan food, a kind of cheese product, with high nutritional value, and is often used as the main source of nutrition and energy for Tibetan compatriots. The content of protein, fat, calcium, vitamin B, and vitamin A2 in milk residue is 7 to 8 times that of fresh milk. As a good source of calcium that can be used by the human body, it can supplement the nutrients needed by the human body; at the same time, it has good medical and health care value, which can strengthen bones, reduce cardiovascular diseases, and improve the stomach and digestion.

[0004] Most of the milk residues sold in Tibetan areas are handmade by herders. They are fermented using a fermentation agent passed down from generation to generation, heated to discharge whey, and then dried. The milk residues usually made are hard and difficult to chew. This patent uses a yeast strain separated and screened from traditional fermented dairy products. It can use the lactose in cow's milk to produce acid and a small amount of ethanol, and produce a certain amount of carbon dioxide gas. It also has a good ability to decompose protein and can partially decompose the protein in cow's milk to produce amino acids during the fermentation process. Therefore, the above characteristics can be used to produce milk residue products that are rich in amino acids, loose and porous after drying, and easy to chew. Not only are they more nutritious, easier to digest and absorb, but they also have a better taste and texture. Summary of the invention

[0005] The invention provides a Kluyveromyces marxii yeast and an application thereof in the preparation of milk residues. The strain can be compounded with lactic acid bacteria to ferment milk and produce milk residues with good flavor and uniform texture.

[0006] The Kluyveromyces marxianus SY11 of the present invention has a deposit number of CCTCC NO: M20221259. The colony morphology of the Kluyveromyces marxianus SY11 of the present invention on the YPD solid culture medium is as follows: the colony is milky white or light yellow, the surface is smooth and moist, the edge is neat or wrinkled, the colony is raised, the texture is fine, and the colony area is large. After staining and observation under a microscope, the cell morphology is mainly round or oval.

[0007] The mixture of Kluyveromyces marxense and lactic acid bacteria can better utilize lactose to produce acid and a small amount of ethanol and carbon dioxide, can better promote the coagulation of milk, has a good ability to decompose protein, and can partially decompose protein in milk to produce amino acids during the fermentation process.

[0008] The Kluyveromyces marxii SY11 of the present invention provides a method for preparing milk residue.

[0009] Preferably, the method for preparing milk residue comprises fermenting milk with Kluyveromyces marxii SY11 and lactic acid bacteria, followed by coagulation, and drying after draining the whey.

[0010] Among them, in the method for activating Kluyveromyces marxii SY11 strain in milk, the activation temperature is preferably 30-37° C., the activation time is preferably 18-24 hours, and the number of activations is preferably 3-5 times.

[0011] The yeast and lactic acid bacteria are preferably introduced in a ratio of 1:1 to 5:1, and the lactic acid bacteria include Lactobacillus bulgaricus and Streptococcus thermophilus, but are not limited to these two lactic acid bacteria.

[0012] Among them, the inoculation amount of yeast and lactic acid bacteria mixed strains is 10 2 ~10 7 CFU / mL.

[0013] The added amount of sucrose is 0 to 8%.

[0014] Among them, the fermentation temperature is 25-40°C.

[0015] After the fermented curd is completed, the temperature is raised to 45-60°C to allow the whey to be fully discharged.

[0016] The drying condition of the wet milk residue is to use a vacuum drying oven at 45-60° C. to dry to constant weight.

[0017] The drying conditions are as follows: the material thickness is preferably 1 to 5 mm, and the drying temperature is preferably 40 to 60°C.

[0018] The vacuum degree is 0.02~0.08MPa.

[0019] Beneficial effects:

[0020] Compared with the milk residue currently available on the market, the milk residue prepared by Kluyveromyces marxii SY11 of the present invention has uniform pores, delicate taste, rich milky aroma and natural milky white color. It can be stored for more than one year under low temperature conditions (below 4°C), and the free amino acid content is higher ( Figure 4 ).

[0021] Description of the accompanying tables and graphs

[0022] Figure 1 This is the colony morphology of Kluyveromyces marxianus SY11.

[0023] Figure 2 The cell morphology of Kluyveromyces marxianus SY11.

[0024] Figure 3 The milk residue (a) obtained by combining Kluyveromyces marxianus SY11 with commercial lactic acid bacteria is compared with the commercially available milk residue (b).

[0025] Figure 4 To compare the free amino acid content of milk residue fermented with Kluyveromyces marxianus SY11 and lactic acid bacteria with commercially available milk residue (fermented with lactic acid bacteria). DETAILED DESCRIPTION

[0026] The experimental methods and conditions in the examples of the present invention are conventional methods unless otherwise specified. The reagents or materials are from commercial sources unless otherwise specified.

[0027] Implementation case 1 Isolation and identification of strains

[0028] The Kluyveromyces marxii SY11 of the present invention is screened and obtained from fermented milk samples of yaks in western Sichuan, and is identified by physiological and biochemical characteristic analysis and 26S rDNA sequence analysis.

[0029] The colony morphology of Kluyveromyces marxianus SY11 on YPD solid medium was as follows: the colonies were milky white or light yellow, with smooth and moist surfaces, neat or wrinkled edges, raised colonies, fine texture, and large colony areas ( Figure 1 ). After staining and observation under a microscope, the cell morphology is mainly round or oval ( Figure 2 ). 26SrDNA is preferably as follows:

[0030] AGCGGAGGAAAAGAAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTCGACGTCCGAGTTGTAATTTGAAGAAGGCGACTTTGTAGCTGGTCCTTGTCTATGTTCC TTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGATCCCAGTTATTTGTAAAGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAG AGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGCGTTTGCTTCGGCTTTCGCTGGGCCAGCATCAGT TTTAGCGGTTGGATAAATCCTCGGGAATGTGGCTCTGCTTCGGTAGAGTGTTATAGCCCGTGGGAATACAGCCAGCTGGGACTGAGGATTGCGACTTTTGTCAAGGATGCTGGCGTAATGGTTAAATGCCGCCCGTCTTGAA

[0031] The Kluyveromyces marxii SY11 of the present invention has a preservation number of CCTCC NO: M20221259.

[0032] Example 2 Preparation of compound milk residues of Kluyveromyces marxii SY11 and commercial starter

[0033] (1) Strain activation and starter culture preparation

[0034] Kluyveromyces marxii SY11, Lactobacillus bulgaricus and Streptococcus thermophilus were inoculated at 10 2 ~10 7 CFU / mL is inoculated into sterilized and cooled milk at 30-37°C. The activation time is preferably 18-24h and the number of activations is preferably 3-5 times. After the activation, it is used as a starter.

[0035] (2) Preparation of milk residue

[0036] Sterilized milk is inoculated with a starter culture, including Kluyveromyces marxianus, Lactobacillus bulgaricus, and Streptococcus thermophilus (the preferred inoculation ratio of Kluyveromyces marxianus, Lactobacillus bulgaricus, and Streptococcus thermophilus is 2:1:1 to 10:1:1, and the lactic acid bacteria include Lactobacillus bulgaricus and Streptococcus thermophilus, but are not limited to these two lactic acid bacteria), and the inoculation amount of the mixed strains is 10 2 ~10 7 CFU / mL, add 0-8% sucrose, and ferment at a constant temperature of 25-40°C until curdling. After heating to 45-60°C to allow the whey to be fully discharged, use a vacuum drying oven at 45-60°C to dry to constant weight.

Claims

1. A strain of Kluyveromyces marxianus SY11 isolated from dairy products, characterized in that: The deposit number of the Kluyveromyces marxii is CCTCC NO: M20221259.

2. The yeast according to claim 1 is mixed with lactic acid bacteria for the preparation of curd.

3. The method according to claim 2, characterized in that Sterilized milk is inoculated with Kluyveromyces marxianus and lactic acid bacteria (the preferred inoculation ratio of yeast to lactic acid bacteria is 1:1 to 5:1, and the lactic acid bacteria include Lactobacillus bulgaricus and Streptococcus thermophilus, but are not limited to these two lactic acid bacteria). The inoculation amount of the mixed strains is 10 2 ~10 7 CFU / mL, add 0-8% sucrose, ferment at a constant temperature of 25-40°C until curdling, raise the temperature to 45-60°C to allow the whey to be fully discharged, and then use a vacuum drying oven at 45-60°C to dry to constant weight.

Images