Nucleic acid combination for detecting FGFR2 gene fusion mutation in bile duct cancer and detection method

Abstract

The invention discloses a nucleic acid combination for detecting FGFR2 gene fusion mutation in bile duct cancer and a detection method, and develops a design method of a universal joint based on digital PCR (Polymerase Chain Reaction) by utilizing the characteristic that most breakpoints of FGFR2-driven fusion genes are positioned at the tail end of an FGFR217 exon, and all fusion of which the breakpoints are the tail end of the FGFR217 exon can be detected at one time. In addition, a tail sequence Tail is specially designed for a fusion specific primer, and the purpose of inhibiting FGFR2WT cDNA amplification is achieved through complementation of the tail sequence Tail and a sequence, close to a breakpoint, of FGFR2WT exon18, so that the amplification efficiency of FGFR2fusion is greatly improved. The detection method is convenient to operate, and has the characteristics of high sensitivity, high accuracy, low cost and the like.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to a nucleic acid combination and a detection method for detecting FGFR2 gene fusion mutation in cholangiocarcinoma. Background Art

[0002] Intrahepatic cholangiocarcinoma (ICC) is an important subtype of cholangiocarcinoma (CCA), accounting for about 10%-20% of all primary liver cancers. ICC is a fatal primary liver cancer, but the early symptoms of ICC are not obvious. Patients are usually diagnosed in the late unresectable stage, with limited treatment options and poor prognosis. Therefore, timely diagnosis and treatment are urgently needed.

[0003] With the development of sequencing technology, the generation of fusion genes has been found to be one of the important driving factors for the occurrence and progression of cancer.

[0004] In ICC, the main fusion mutation gene is the fusion gene driven by fibroblast growth factor receptor 2 (FGFR2), and more than 15% of ICC patients have FGFR2 gene fusion mutations.

[0005] There are many fusion partner genes of FGFR2 in ICC, and more than 150 have been found so far. Most of the FGFR2-driven fusion genes have a fixed structure: at the N-terminus, the fusion proteins share an almost identical FGFR2 part, including a complete kinase domain (FGFR2 exon1-17), and at the C-terminus, there is a dimerization / oligomerization domain provided by different fusion partner genes, including Bicaudal family RNA-binding protein 1 (BICC1), adenosine homocysteinease 1 (AHCYL1) and Periphilin 1 (PPHLN1). This pattern shows that the breakpoints of FGFR2-driven fusion genes in cholangiocarcinoma are mostly located at the end of FGFR2 exon 17.

[0006] After the FGFR2 gene fuses with genes such as BICC1 and AHCYL1, it will continuously activate the FGFR2 tyrosine kinase region and downstream signaling pathways, causing tumorigenesis. Clinical studies have found that small molecule targeted drugs such as Pemigatinib, Derazantinib, Erdafitinib, Infigratinib, Futibatinib / TAS-120, etc. can specifically act on FGFR2 gene fusion mutations, inhibit the activity of the FGFR2 tyrosine kinase region, block its downstream signal transduction pathways, and inhibit tumor cell proliferation to achieve therapeutic effects. Therefore, detecting the FGFR2 fusion mutation status is a prerequisite for guiding the use of targeted drugs, and is of great significance for improving the survival rate of patients with cholangiocarcinoma, prolonging survival, and improving the quality of life.

[0007] At present, the methods used to detect fusion genes mainly include chromosome karyotype analysis, fluorescence in situ hybridization (FISH), real-time fluorescence PCR (RT-PCR) and next-generation sequencing (NGS). The first two technologies are commonly used clinical auxiliary diagnosis methods, but their sensitivity is very limited. RT-PCR and NGS have high sensitivity, both of which can reach 1%, but RT-PCR has limited fusion gene targets and cannot detect unknown fusions. NGS can detect unknown fusion genes, but the detection cost is high and the detection cycle is long.

[0008] For example, Chinese patent document CN 112143815 B (application number 202011332715.9) discloses a nucleic acid composition and detection method for detecting human FGFR2 gene fusion mutations. It is a real-time fluorescence PCR (RT-PCR) detection method: first, the RNA of the test sample is extracted and reverse transcribed into cDNA, and then the cDNA is used as a template using the above-mentioned kit for real-time fluorescence PCR reaction. Finally, the positive and negative of the test sample is determined according to the Ct value. It can simultaneously detect 18 FGFR2-driven fusion genes.

[0009] For example, Chinese patent document CN 112301115 B (application number 202011001862.8) discloses a method for detecting FGFRs gene mutations based on high-throughput sequencing, comprising the following steps: co-extracting sample genomic DNA and total RNA; fragmenting the genomic DNA and recovering the fragmented DNA; performing total RNA shearing and / or primer hybridization according to the quality control of the total RNA; synthesizing the first chain of cDNA; synthesizing the second chain of cDNA; mixing the fragmented DNA with cDNA to construct a mixed library; using capture probes for hybridization and capture; amplifying and purifying the library after capture; high-throughput sequencing and mutation analysis.

[0010] Digital PCR (dPCR) is an emerging absolute quantitative technology that can determine the absolute number of target molecules to be detected as low as a single copy by processing samples into micro-units, greatly improving the accuracy and sensitivity of detection, and is an effective detection method for fusion gene detection. However, conventional dPCR detection has the same limitations as RT-PCR, that is, the detection targets are limited and unknown fusions cannot be detected. Summary of the invention

[0011] The technical problem to be solved by the present invention is that the conventional method of detecting fusion genes using digital PCR can only detect known fusions and has limited detection targets; a method for detecting FGFR2 gene fusion mutations in cholangiocarcinoma using digital PCR is provided, which effectively breaks through the problem of limited detection targets, and a nucleic acid combination for detecting FGFR2 gene fusion mutations in cholangiocarcinoma is provided.

[0012] The technical solution to achieve the first object of the present invention is a nucleic acid combination for detecting FGFR2 gene fusion mutations in cholangiocarcinoma, comprising the following primer and probe sequences:

[0013] Reverse transcription primer Uni-N6, wherein the Uni sequence is any artificially synthesized fixed sequence, and N represents a random primer. Optionally, the last base of the Uni sequence is A.

[0014] Universal primer F primer, Universal primer F primer is a sequence that is identical or partially identical to the Uni sequence of reverse transcription primer Uni-N6.

[0015] GSP primer-R-Tail primer, where GSP primer-R is a sequence on exons 1-17 of the FGFR2 transcript, and Tail is a sequence complementary to a sequence near the breakpoint of FGFR2 WT exon18. The specific sequence of Tail can be adjusted, the key is that the sequence is located in the part of FGFR2 exon18 close to Exon17, between the breakpoint and the WT probe; it can also be modified to increase affinity, such as locked nucleotide LNA or thiolated modified S.

[0016] Fusion probe, the Fusion probe is a sequence on exons 1-17 of the FGFR2 transcript.

[0017] WTprobe probe, WTprobe probe is any sequence on exon 18 of FGFR2 transcript.

[0018] The 5' end of the Fusion probe sequence is modified with a fluorescent group, and the 5' end of the WTprobe sequence is modified with a fluorescent group, and the 5' end fluorescent groups of the Fusionprobe and WTprobe sequences are different.

[0019] The 3' end of the Fusionprobe sequence is modified with a quenching group, and the 3' end of the WTprobe sequence is modified with a quenching group.

[0020] The length of each primer or probe sequence is greater than or equal to 8 bases.

[0021] The GSP primer-R and Fusion probe are two different sequences on exons 1-17 of the FGFR2 transcript, and on the cDNA template, the Fusion probe is located in the upstream region of the GSP primer-R primer position.

[0022] Optionally, the fluorescent group at the 5' end of the Fusionprobe sequence is one of FAM, HEX, VIC, TET, ROX, TAMRA, JOE, Cy3, Cy5, and Cyc5.5 fluorescent groups; the fluorescent group at the 5' end of the WTprobe sequence is one of FAM, HEX, VIC, TET, ROX, TAMRA, JOE, Cy3, Cy5, and Cyc5.5 fluorescent groups.

[0023] Optionally, the 3' end group of the Fusion probe sequence is one of BHQ1, BHQ2, BHQ3, NFQ, Dabcyl, Eclipse quenching group and MGB; the 3' end group of the WTprobe sequence is one of BHQ1, BHQ2, BHQ3, NFQ, Dabcyl, Eclipse quenching group and MGB; wherein MGB is modified with a minor groove binder plus a NFQ quenching group.

[0024] Optionally, the gene sequence of the reverse transcription primer Uni-N6 is SEQ ID NO.1, SEQ ID NO.8 or SEQ ID NO.15, preferably SEQ ID NO.1 or SEQ ID NO.15, wherein N represents a random primer.

[0025] The gene sequence of Universal primer F is SEQ ID NO.2, SEQ ID NO.9 or SEQ ID NO.16;

[0026] The gene sequence of GSP primer-R in the GSP primer-R-Tail primer is SEQ ID NO.3, SEQ ID NO.10 or SEQ ID NO.17, the gene sequence of Tail is CGAGAGGTTGGCTGAGGTCCAAGTA or ACTGTTCGAGAGGTTGGCTGAGGTCCAAGTA. The gene sequence of the Fusion probe probe is SEQ ID NO.6, SEQ ID NO.11 or SEQ ID NO.18.

[0027] The gene sequence of the WTprobe probe is SEQ ID NO.7, SEQ ID NO.12 or SEQ ID NO.19.

[0028] In the Fusion probe and WTprobe probe, "+" indicates locked nucleic acid LNA modification, 5'VIC and 5'FAM are modified with fluorescent groups, and 3'BHQ1 and 3'MGB are modified with quenching groups.

[0029] The technical solution for achieving the second purpose of the present invention is a method for detecting FGFR2 gene fusion mutations in cholangiocarcinoma using the above-mentioned nucleic acid combination. After the RNA of the sample to be tested is extracted, a fixed sequence Uni is introduced at the 5' end of the cDNA in the reverse transcription stage, and the upstream primer Universal primer-F in the digital PCR stage is bound to the Uni sequence, and the downstream primer GSP primer R-Tail is bound to a sequence before the 3' end of FGFR2 exon 17, the mutation probe Fusion probe is bound to a sequence between the downstream primer binding site and the 3' end of FGFR2 exon 17, and the wild-type probe WTprobe is bound to FGFR2 exon 18.

[0030] After the amplification reaction, the amplified droplets were tested for fluorescence signals, and the copy numbers of the wild-type and fusion transcripts of FGFR2 were calculated using the insertion-deletion analysis method. The droplet fluorescence distribution was combined with the insertion-deletion analysis method to make a judgment: when the wild-type transcript of FGFR2 was amplified, dual fluorescence marked by the Fusion probe and WTprobe was generated, and when the FGFR2 fusion transcript was amplified, only single fluorescence marked by the Fusion probe was generated, which distinguished the wild-type transcript of FGFR2 from the FGFR2 fusion transcript; the total copy number of the mutant gene calculated by the insertion-deletion analysis was ≥1, and the positive detection was judged by combining the fluorescence intensity, and the total copy number of the mutant gene was <1, which was judged as no positive detection.

[0031] Furthermore, the extracted RNA contains mRNA.

[0032] When RNA is reverse transcribed into cDNA, the RNA is first heated to denature the secondary structure and then rapidly cooled on ice; a reverse transcription reaction mixture is prepared on ice, the reverse transcription reaction mixture comprising a reverse transcription buffer, reverse transcriptase, Uni-N6primer, RNA template and enzyme-free water.

[0033] Optionally, the reverse transcription reaction is performed under the following conditions: first incubate at 37°C for 15 min, then at 85°C for 5 s, and finally at 4°C until the reverse transcription is completed.

[0034] Optionally, the digital PCR stage includes the following steps:

[0035] S3-1. Prepare PCR system, including primer probe, PCR buffer, DNA polymerase, cDNA and enzyme-free water. Primer probe includes Universal primer-F, GSP primer-R-Tail, Fusion probe and WTprobe.

[0036] S3-2. Use a droplet generation instrument to prepare the obtained PCR reaction system into droplets of uniform size.

[0037] S3-3. The droplets are subjected to an amplification reaction on a digital PCR instrument. After the reaction is completed, the fluorescence signal of the amplified droplets is detected, and the copy number of the FGFR2 wild-type transcript and the fusion transcript is calculated using the insertion and deletion analysis method.

[0038] The present invention has positive effects: the present invention utilizes the characteristic that most of the breakpoints of FGFR2-driven fusion genes are located at the end of FGFR2 exon 17, and develops a design method of a universal linker based on digital PCR, which can detect all (about 150 types) fusions with breakpoints at the end of FGFR2 exon 17 at one time.

[0039] Based on the universal adapter, the detection method of the present invention further solves the problem of competitive inhibition in the same tube. The amplification of WT RNA will greatly inhibit the detection sensitivity of fusion RNA. Therefore, we specially designed a tail sequence Tail for the fusion-specific primer, which is complementary to the sequence near the breakpoint of FGFR2 WT exon18 to achieve the purpose of inhibiting the amplification of FGFR2 WT cDNA, thereby greatly increasing the amplification efficiency of FGFR2 fusion.

[0040] The present invention combines the detection technology of single-end anchoring and ddPCR amplification, which can effectively break through the problem of limited detection targets. The technical principle of the present invention is: a fixed sequence (Uni) is introduced at the 5' end of cDNA in the reverse transcription (RT) stage as the upstream primer (Universal primer-F) binding site, and after being reversed to cDNA, a sequence is selected on FGFR21-17 exons (exon1-17) as the downstream primer (GSP primer-R) binding site, and the entire region after FGFR217 exon can be fully amplified during ddPCR. The present application adds a sequence tail at the 5' end of GSP primer-R, which is complementary to a sequence near the breakpoint of FGFR2 WTexon18. At the same time, a sequence is selected between the downstream primer binding site and the 3' end of exon 17 as the binding site of the mutation probe (Fusionprobe, 5' end fluorescent group label), and a sequence is selected on exon 18 (exon18) as the binding site of the wild probe (WT probe, 5' end fluorescent group label). The 5'-end labeled fluorescent groups of Fusionprobe and WTprobe are different. When the wild-type transcript of FGFR2 is amplified, dual fluorescence labeled by Fusionprobe and WTprobe is generated simultaneously. When the FGFR2 fusion transcript is amplified, only single fluorescence labeled by Fusion probe is generated, so that the FGFR2 fusion gene and the FGFR2 wild-type gene can be distinguished. Because the tail sequence at the 5' end of the fusion-specific primer (GSPprimer-R) is complementary to the sequence near the breakpoint of FGFR2 WT exon18, it can inhibit the amplification of FGFR2 WT cDNA and increase the amplification efficiency of FGFR2 fusion.

[0041] The detection method of the present invention is easy to operate and has the characteristics of high sensitivity, high accuracy, low cost, etc., and can be used as a reference for clinical drug use. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 This is the schematic diagram of the present application.

[0043] Figure 2 1D scatter plot of FGFR2 GSP primer R group: FAM channel (FGFR2 WT Type) and VIC channel (FAM cutoff: 17000; VIC cutoff: 13000).

[0044] Figure 31D scatter plot of FGFR2 GSP primer R-Tail 1 group: FAM channel (FGFR2 WT Type) and VIC channel (FAM cutoff: 17000; VIC cutoff: 13000).

[0045] Figure 4 1D scatter plot of FGFR2GSP primer R-Tail 2 groups: FAM channel (FGFR2 WT Type) and VIC channel (FAM cutoff: 17000; VIC cutoff: 13000).

[0046] Figure 5 This is the 2D scatter plot of FGFR2 GSP primer R / GSP primer R-Tail 1 / GSP primer R-Tail 2 group (FAM cutoff: 17000; VIC cutoff: 13000).

[0047] Figure 6 Three sets of 2D scatter plots of FGFR2 GSP primer-R_NO.8 / GSP primer-R_NO.8-Tail 1 / GSP primer-R_NO.8-Tail 2 (FAM cutoff: 20000; VIC cutoff: 11000).

[0048] Figure 7 Three sets of 2D scatter plots of FGFR2 GSP primer-R_NO.11 / GSP primer-R_NO.11-Tail 1 / GSP primer-R_NO.11-Tail 2 (FAM cutoff: 25000, VIC cutoff: 8800).

[0049] Figure 8 2D scatter plot for reproducibility verification of FGFR2 GSP primer R-Tail 1 (FAM cutoff: 20000; VIC cutoff: 13000).

[0050] Fig. 9 The linear relationship of the copy number under different RNA input amounts of FGFR2 GSP primer R-Tail 1 (FAM cutoff: 20000; VIC cutoff: 13000).

[0051] Fig.102D scatter plot of FGFR2 GSP primer R-Tail 1 clinical samples (FAM cutoff: 20000; VIC cutoff: 13000). DETAILED DESCRIPTION

[0052] Introduced below are some of the multiple possible embodiments of the present invention, which are intended to provide a basic understanding of the present invention, and are not intended to confirm the key or decisive elements of the present invention or to limit the scope of protection. It is easy to understand that according to the technical solution of the present invention, without changing the essential spirit of the present invention, a person of ordinary skill in the art can propose other mutually replaceable implementations. Therefore, the following specific embodiments are only exemplary descriptions of the technical solution of the present invention, and should not be regarded as the whole of the present invention or as a limitation or restriction to the technical solution of the present invention.

[0053] The following examples (1 and 2) and the partial primer and probe sequence information involved in the test examples are as follows:

[0054]

[0055] In the table, Uni sequence is any artificially synthesized fixed sequence, N represents a random primer, + represents locked nucleic acid (LNA) modification, 5'VIC and 5'FAM are fluorescent group modifications, and 3'BHQ1 is a quenching group modification.

[0056] The fluorescent group at the 5' end of Fusion probe and WTprobe is one of FAM, HEX, VIC, TET, ROX, TAMRA, JOE, Cy3, Cy5, and Cyc5.5 fluorescent groups, and the fluorescent groups at the 5' end of Fusion probe and WTprobe are different.

[0057] In addition to the BHQ1 mentioned above, the 3' end quenching group of Fusionprobe and WTprobe can also be one of BHQ2, BHQ3, Dabcyl and Eclipse quenching groups; the 3' end group of Fusion probe and WTprobe can also be modified with MGB, which is a minor groove binder modified with NFQ quenching group.

[0058] The sequence of Universal primer-F is a sequence identical or partially identical to the Uni sequence of RT primer (Uni-N6), and the sequence in the table is the same sequence. The sequence of GSP primer-R is the base sequence of the 2886-2905 position of the E1-17 region of the FGFR2 transcript (NM_022970.3). The Tail1 part of GSP primer R-Tail 1 is reverse complementary to the 2955-2980 sequence on the E18 of the FGFR2 transcript (NM_022970.3), and the Tail2 part of GSP primer R-Tail 2 is reverse complementary to the 2955-2986 sequence on the E18 of the FGFR2 transcript (NM_022970.3). The GSP primer-R primer and the Fusionprobe probe are two different sequences on the 1-17 exons of the FGFR2 transcript, and the Fusion probe probe is in the downstream region of the GSPprimer-R primer position. The WTprobe probe is any sequence on exon 18 of the FGFR2 transcript.

[0059] (Example 1)

[0060] See Figure 1 The method of detecting FGFR2 gene fusion mutation in cholangiocarcinoma using digital PCR in this embodiment comprises the following steps:

[0061] S1. Preparation of genomic RNA of samples to be tested.

[0062] The wax blocks of the samples to be tested were cut into 10 μm tissue sections and, after dewaxing, were sliced ​​using Qiagen The DSP FFPEKit RNA extraction kit extracts genomic RNA from the sample to be tested to obtain 20 μL of total RNA with a concentration of 100-300 ng / μL.

[0063] Any extraction method that extracts RNA including mRNA can be used.

[0064] Specifically, the RNA extraction method can be any one of the extraction methods such as phenol-chloroform method, silica gel column method, magnetic bead method, Trizol method and RNeasy method, or a commercial extraction kit can be directly used.

[0065] S2. RNA is reverse transcribed into cDNA. During the reverse transcription (RT) stage, a fixed sequence Uni-N6 is introduced into the 5' end of the cDNA as the upstream primer (Universal primer-F) binding site.

[0066] S2-1. Heat RNA at 65±5°C (65°C in this example) for 1.5-2.5 min (2 min in this example) to denature the secondary structure, and then quickly cool on ice.

[0067] S2-2. Prepare the following reverse transcription reaction system on ice:

[0068]

[0069]

[0070] The reverse transcription buffer (PriScript Buffer) and reverse transcriptase (PriScript RT Enzyme) were ordered from Bio-Rad Biotechnology (Beijing) Co., Ltd. (Cat. No.: RR037A). The amount of RNA input can be adjusted according to the sample type and experimental purpose.

[0071] S2-3. Perform reverse transcription reaction according to the following conditions:

[0072] temperature time 37℃ 15min 85℃ 5sec 4℃ Incubate until reverse transcription is complete .

[0073] S3. Digital PCR reaction.

[0074] S3-1. Take 5uL of RT reaction product as amplification template, add it to PCR expression reagent, prepare the following dPCR system at room temperature, mix well and take 30μL of the system to enter the droplet generation step.

[0075]

[0076]

[0077] Among them, 5X DNA Master mix comes from Roche (Roche, catalog number: 09393544001). 5X DNA Master mix includes reaction buffer, i.e. PCR buffer, DNA polymerase, and the input amount of cDNA template and primer probe can be adjusted according to experimental requirements.

[0078] S3-2. The obtained PCR reaction system was prepared into droplets of uniform size using a Roche Digital LC sample splitter. The droplet size was about 1 nL.

[0079] For droplets, the following conditions were used in Roche Digital Amplification reaction and fluorescence signal detection on digital PCR instrument:

[0080]

[0081] After the reaction is completed, use Digital The insertion and deletion analysis method of the Development Software (Roche) calculates the copy number of the wild-type transcript and the fusion transcript of FGFR2. Combined with the droplet fluorescence distribution, the following judgment is made: when the wild-type transcript of FGFR2 is amplified, both VIC fluorescence and FAM fluorescence are generated, and when the fusion transcript of FGFR2 is amplified, only VIC fluorescence is generated, thereby distinguishing the FGFR2 fusion transcript from the wild-type transcript of FGFR2; the total copy number of the mutant gene calculated by the insertion and deletion analysis is ≥1, and the fluorescence intensity is combined to judge that there is a positive detection; the total copy number of the mutant gene is <1, and it is judged that there is no positive detection.

[0082] (Example 2)

[0083] The rest of the detection method of this embodiment is the same as that of Example 1, except that GSP primer-R-Tail 2 is used in the dPCR system, so the dPCR system is as follows:

[0084]

[0085]

[0086] (Example 3-4)

[0087] The rest of the detection method of Example 3-4 is the same as that of Example 1, except that the primer probe sequence information used is as follows, wherein GSP primer-R_NO.8-Tail 1 is used in the dPCR system of Example 3 (i.e., the nucleic acid combination used in Example 3 is SEQ ID NO.8, 9, 11, 12, 13), and GSP primer-R_NO.8-Tail 2 is used in the dPCR system of Example 4 (i.e., the nucleic acid combination used in Example 4 is SEQ ID NO.8, 9, 11, 12, 14):

[0088]

[0089] (Example 5-6)

[0090] The rest of the detection method of Examples 5-6 is the same as that of Example 1, except that the primer probe sequence information used is as follows, wherein GSP primer-R_NO.11-Tail 1 is used in the dPCR system of Example 5 (i.e., the nucleic acid combination used in Example 5 is SEQ ID NO.15, 16, 18, 19, 20), and GSP primer-R_NO.11-Tail 2 is used in the dPCR system of Example 6 (i.e., the nucleic acid combination used in Example 6 is SEQ ID NO.15, 16, 18, 19, 21):

[0091]

[0092] (Test Example 1) Validity test of the solutions in Examples 1 and 2.

[0093] 1) full-length RNA (8Kb) of FGFR2-Casp7 fusion cell line; 2) full-length RNA (5Kb) of FGFR2-BICC1 fusion cell line; 3) a 1:1 mixture of full-length RNA of FGFR2-Casp7 and FGFR2-BICC1 fusion cell line as positive templates, and normal liver cell line LO2 RNA as negative control, reverse transcription was performed according to the RT system of Example 1, and then 5 μL of RT product was taken for PCR amplification.

[0094] The three nucleic acid combinations tested were:

[0095] GSP-R group: SEQ ID NO.1, 2, 3, 6, 7.

[0096] Tail 1 group: SEQ ID NO.1, 2, 4, 6, 7.

[0097] Tail 2 group: SEQ ID NO.1, 2, 5, 6, 7.

[0098] After the program is completed, the droplet fluorescence distribution is combined with the insertion and deletion analysis method to determine whether there is a positive detection. The experimental results are shown in Tables 1 and 2, and see Figures 2 to 5 .

[0099] Table 1 Copy number display of FGFR2 GSP primer R / GSP primer R-Tail 1 / GSP primer R-Tail 2 group (FAM cutoff: 17000; VIC cutoff: 13000)

[0100]

[0101] Table 2 Differences between theoretical and actual copy numbers of FGFR2-BICC1+Casp7 mixed at a ratio of 1:1

[0102]

[0103] The result interpretation is mainly based on the fluorescence intensity reading results, and cluster analysis is performed using 1D scatter plots. First, the fluorescence intensity of each negative experimental group is used as a reference to divide the two fluorescence channels (FAM+VIC) by threshold. After dividing the threshold, the result map can be divided into four quadrants. The first quadrant is the double positive droplet area that excites FAM and VIC fluorescence at the same time, the second quadrant is the single positive droplet area that only excites FAM fluorescence, the third quadrant is the droplet area without any excitation fluorescence, that is, the negative droplet area, and the fourth quadrant is the single positive droplet area that only excites VIC fluorescence.

[0104] According to the principle of this technology, the amplification of the FGFR2 wild-type template will simultaneously excite FAM and VIC fluorescence, and the droplets will gather in the first quadrant. When the FGFR2 fusion template is amplified, only VIC will be excited, and the droplets will gather in the fourth quadrant. Negative droplets without any excited fluorescence should gather in the third quadrant.

[0105] from Figure 5 It can be seen that no positive droplets appeared in the negative experimental group, indicating that there was no non-specific amplification in this system, while in the GSP-R group, the first and fourth quadrants of the fusion positive template experimental group (FGFR2-BICC1 / Casp7 / BICC1+Casp7) showed obvious droplet aggregation, that is, there were double positive droplets (green) and VIC single positive droplets (blue), corresponding to FGFR2 wild-type detection and FGFR2 fusion detection, respectively. This result is in line with expectations and is valid.

[0106] from Figure 5 It can also be seen that in the Tail1 and Tail2 groups, in the fusion positive template experimental group (FGFR2-BICC1 / Casp7 / BICC1+Casp7), the original double positive droplets had no green droplets in the first quadrant due to the inhibition of WT amplification. Figure 3-4 It can also be seen that compared with Figure 2In the GSP-R group, the fusion positive template experimental group (FGFR2-BICC1 / Casp7 / BICC1+Casp7), the FAM channel WT amplification signal was significantly reduced, while the VIC channel fusion signal was significantly increased, and more signals were close to the high signal value of 18400 due to good amplification effects, and the overall positive signal was more concentrated. This difference in copy number amplification can be further seen from Table 1. In addition, we also noticed that the last group of BICC1+Casp7 fusion cell line full-length RNA was mixed 1:1, and the amplified copy number was similar to the average copy number detected by 20ng of FGFR2-BICC1 and FGFR2-Casp7 (Table 2). This shows that the bias for unknown fusion detection of FGFR2 is very small.

[0107] The above experimental results show that this protocol can not only detect FGFR2 wild-type targets and FGFR2 fusion targets at the same time, but also achieve the purpose of inhibiting FGFR2 WT cDNA amplification through the special design of the fusion-specific primer 5'tail, which is complementary to the sequence near the breakpoint of FGFR2 WT exon18, thereby greatly increasing the amplification efficiency of FGFR2 fusion. In addition to the two groups of FGFR2-driven fusion genes verified by the above experiments, this protocol is also applicable to the detection of other FGFR2-driven fusion targets.

[0108] (Test Example 2) Effectiveness test of Examples 3-6.

[0109] 1. Validity test of embodiments 3 and 4.

[0110] 1) full-length RNA (8Kb) of FGFR2-Casp7 fusion cell line; 2) full-length RNA (5Kb) of FGFR2-BICC1 fusion cell line; 3) a 1:1 mixture of full-length RNA of FGFR2-Casp7 and FGFR2-BICC1 fusion cell line were used as positive templates, and normal liver cell line LO2 RNA was used as negative control. According to the conditions of Example 1, the nucleic acid combination of Example 3 and Example 4 was reverse transcribed, and then 5 μL of RT product was taken for PCR amplification.

[0111] The three nucleic acid combinations tested were:

[0112] GSP primer-R_NO.8 group: SEQ ID NO.8, 9, 10, 11, 12.

[0113] GSP primer-R_NO.8_Tail 1 group: SEQ ID NO.8, 9, 11, 12, 13.

[0114] GSP primer-R_NO.8_Tail 2 group: SEQ ID NO.8, 9, 11, 12, 14.

[0115] After the program is completed, the droplet fluorescence distribution is combined with the insertion and deletion analysis method to determine whether there is a positive detection. The experimental results are shown in Table 3 and Table 4 and refer to Figure 6 .

[0116] Table 3 FGFR2 GSP-R_NO.8 / GSP primer-R_NO.8_Tail 1 / GSP primer-R_NO.8_Tail 2 copy number display (FAM cutoff: 20000; VIC cutoff: 11000)

[0117]

[0118] Table 4 Differences between theoretical and actual copy numbers of FGFR2-BICC1+Casp7 mixed at a ratio of 1:1

[0119]

[0120] 2. Validity test of embodiments 5 and 6.

[0121] 1) full-length RNA (8Kb) of FGFR2-Casp7 fusion cell line; 2) full-length RNA (5Kb) of FGFR2-BICC1 fusion cell line; 3) a 1:1 mixture of full-length RNA of FGFR2-Casp7 and FGFR2-BICC1 fusion cell line as positive templates, and normal liver cell line LO2 RNA as negative control, reverse transcription was performed according to the conditions of Example 1 and the reaction primers of Example 5 and Example 6, and then 5 μL of RT product was taken for PCR amplification.

[0122] The three nucleic acid combinations tested were:

[0123] GSP primer-R_NO.11 group: SEQ ID NO.15, 16, 17, 18, 19.

[0124] GSP primer-R_NO.11_Tail 1 group: SEQ ID NO.15, 16, 18, 19, 20.

[0125] GSP primer-R_NO.11_Tail 2 groups: SEQ ID NO.15, 16, 18, 19, 21.

[0126] After the program is completed, the droplet fluorescence distribution is combined with the insertion and deletion analysis method to determine whether there is a positive detection. The experimental results are shown in Table 5 and Table 6. Figure 7 .

[0127] Table 5 FGFR2 GSP-R_NO.11 / GSP primer-R_NO.11_Tail 1 / GSP primer-R_NO.11_Tail 2 copy number display

[0128]

[0129] Table 6 Differences between theoretical and actual copy numbers of FGFR2-BICC1+Casp7 mixed at a ratio of 1:1

[0130]

[0131]

[0132] in conclusion:

[0133] 1. Primers No. 8 and No. 11 in Example 3-6 have some FAM single-positive spots in the second quadrant. There are two possible reasons: 1) The VIC probe concentration is low and FGFR2 WT does not bind sufficiently; 2) The WT FAM probe is not specific enough and will bind to other primers to form primer dimers or extended product-primer polymers, resulting in false positives.

[0134] 2. From Figure 6 and Figure 7 It can be seen that the primers NO.8 and NO.11 have no specificity. Figure 5 The first set of primers was so good, but the phenomenon of suppressing WT amplification by complementing Tail with WT was reproducible. In the GSP primer R-Tail 1 and GSPprimer R-Tail2 groups, the double positive droplets in the first quadrant of the fusion positive template experimental group (FGFR2-BICC1 / Casp7 / BICC1+Casp7) had a reduced FAM value due to the inhibition of WT amplification.

[0135] 3. It can also be seen from Tables 3 and 5 that compared with the GSP primer R group, the WT copy number of the fusion positive template experimental groups (FGFR2-BICC1 / Casp7 / BICC1+Casp7) of these two groups was reduced to a certain extent, and the copy number of the VIC channel fusion was also reduced, which may be related to the nonspecific amplification of the primer itself. The primer dimers and the dimers generated during the amplification process will affect the detection of the fusion signal.

[0136] 4. The primer system in Examples 1 and 2, and the two primer systems in Examples 3 and 4 (NO.8) and Examples 5 and 6 (NO.11) detect the same target, but the detected copy numbers are quite different. Example 1> Table Example 5 and 6 (NO.11)> Example 3 and 4 (NO.8), indicating that the optimization of primers in this method is very important.

[0137] The above experimental results show that this scheme can not only detect FGFR2 wild-type targets and FGFR2 fusion targets at the same time, but also achieve the purpose of inhibiting the amplification of FGFR2 WT cDNA through the special design of the fusion-specific primer 5'tail and its complementarity with the sequence near the breakpoint of FGFR2 WT exon18, thereby increasing the amplification efficiency of FGFR2 fusion.

[0138] (Test Example 3) Repeatability Test

[0139] The complete FGFR2-Casp7 and FGFR2-BICC1 fusion cell line RNA was mixed in a ratio of 1:1 as the positive template, and four gradient RNA input experimental groups of 20ng, 10ng, 5ng and 2.5ng were set up. At the same time, 20ng of normal liver cell line LO2 RNA was used as a negative control. The downstream primer Tail1 of cDNA replaced GSP-R and each group was repeated 5 times. The RT system was prepared and reverse transcribed according to Example 1, and then 5μL of RT product was taken for PCR amplification. After the program was completed, the number of wild-type and fusion copies of FGFR2 in each experimental group was counted according to the insertion and deletion analysis method. The results are shown in Table 7, see Figure 8 and Fig. 9 .

[0140] Table 7 Repeated detection copy number of FGFR2 GSP primer R-Tail 1 at different RNA input amounts (FAM cutoff: 20000; VIC cutoff: 13000)

[0141]

[0142] In the above table, from top to bottom, they are 2.5ng, 5ng, 10ng and 20ng experimental groups respectively.

[0143] from Figure 8 It can be seen that this scheme can achieve specific detection of FGFR2 fusion targets for positive samples of 2.5-20ng and effectively inhibit the wild-type copy number.

[0144] Table 7 shows that the difference in fusion detection of the replicate groups at 2.5 ng input was 12%, which may be due to the low RNA input. However, at 5 ng, 10 ng and 20 ng input, the difference in fusion and copy number detection of the five replicate experimental groups was basically less than 10%, indicating that the detection repeatability of this scheme was good within the detection limit.

[0145] from Fig. 9 It can be seen that the copy number linear relationship of the system under different RNA input amounts is good, and the linear R 2 =0.9883.

[0146] (Test Example 4) Clinical positive sample detection

[0147] 20 ng of each of three clinical RNA samples (clinical samples 1-3) that have been verified to be positive for both FGFR2-BICC1 and FGFR2-Casp7 fusions were taken, and 20 ng of normal liver cell line LO2 RNA was used as a negative control. The RT system was prepared according to Example 1 and reverse transcription was performed. Then 5 μL of RT product was taken for PCR amplification. After the program was completed, the Roche digital PCR analysis software (Digital The data were analyzed by the insertion and deletion analysis method in Development Software. The results are shown in Table 8. Fig.10 .

[0148] Table 8 FGFR2 fusion and wild-type transcript copy numbers in clinical positive samples

[0149]

[0150] from Fig.10 As can be seen in the results of the three clinical samples, there is a more obvious VIC single positive droplet aggregation in the fourth quadrant, indicating that the FGFR2 fusion target exists in all three samples, which is consistent with the clinical test results. And there are no droplets in the first quadrant, indicating that the wild-type amplification is strongly inhibited when using this method.

[0151] The FGFR2 wild-type copy number and fusion copy number in each sample obtained after data analysis and conversion are shown in Table 8, where fusion / wild-type (copy / μL) is the output result of the analysis software, and fusion / wild-type (copies) is the target copy number in the converted sample. The results show that in the 30μL system, the total copy number of the mutant gene calculated by the three groups of clinical samples is greater than 1 (total copy number = concentration (copy / μL) × volume (30μL)), indicating fusion positive. The above experimental results prove that the detection results of this scheme are consistent with the clinical detection results.

Claims

1. A nucleic acid combination for detecting FGFR2 gene fusion mutation in cholangiocarcinoma, comprising the following primer and probe sequences: Reverse transcription primer Uni-N6, where the Uni sequence is any artificially synthesized fixed sequence and N represents a random primer; Universal primer F primer, Universal primer F primer is a sequence identical or partially identical to the Uni sequence of reverse transcription primer Uni-N6; GSPprimer-R-Tail primer, wherein the GSPprimer-R primer is a sequence on exons 1-17 of the FGFR2 transcript, and Tail is a sequence complementary to a sequence near the breakpoint of FGFR2 WT exon18; Fusion probe, which is a sequence on exons 1 to 17 of the FGFR2 transcript; WTprobe probe, WTprobe probe is any sequence on exon 18 of FGFR2 transcript; The 5' end of the Fusion probe sequence is modified with a fluorescent group, and the 5' end of the WTprobe sequence is modified with a fluorescent group, and the 5' end fluorescent groups of the Fusionprobe and WTprobe sequences are different; The 3' end of the Fusionprobe sequence is modified with a quenching group, and the 3' end of the WTprobe sequence is modified with a quenching group.

2. The nucleic acid combination for detecting FGFR2 gene fusion mutation in cholangiocarcinoma according to claim 1, characterized in that: The last base of the Uni sequence in the reverse transcription primer Uni-N6 is A.

3. The nucleic acid combination for detecting FGFR2 gene fusion mutation in cholangiocarcinoma according to claim 1, characterized in that: GSPprimer-R and Fusionprobe are two different sequences on exons 1-17 of the FGFR2 transcript, and on the cDNA template, the Fusionprobe probe is located in the upstream region of the GSPprimer-R primer position.

4. The nucleic acid combination for detecting FGFR2 gene fusion mutation in cholangiocarcinoma according to claim 1, characterized in that: The fluorescent group at the 5' end of the Fusion probe sequence is one of the fluorescent groups FAM, HEX, VIC, TET, ROX, TAMRA, JOE, Cy3, Cy5, and Cyc5.5; the fluorescent group at the 5' end of the WTprobe sequence is one of the fluorescent groups FAM, HEX, VIC, TET, ROX, TAMRA, JOE, Cy3, Cy5, and Cyc5.5; The 3' end group of the Fusion probe sequence is one of BHQ1, BHQ2, BHQ3, Dabcyl, Eclipse quenching group and MGB; the 3' end group of the WTprobe sequence is one of BHQ1, BHQ2, BHQ3, Dabcyl, Eclipse quenching group and MGB; among which MGB is modified with a minor groove binder plus a NFQ quenching group.

5. The nucleic acid combination for detecting FGFR2 gene fusion mutation in cholangiocarcinoma according to any one of claims 1 to 4, characterized in that: The length of each primer or probe sequence is greater than or equal to 8 bases.

6. The nucleic acid combination for detecting FGFR2 gene fusion mutation in cholangiocarcinoma according to claim 1, characterized in that: The gene sequence of the reverse transcription primer Uni-N6 is SEQ ID NO.1, SEQ ID NO.8 or SEQ ID NO.15, wherein N represents a random primer; The gene sequence of Universal primer F is SEQ ID NO.2, SEQ ID NO.9 or SEQ ID NO.16; The gene sequence of GSP primer-R in the GSP primer-R-Tail primer is SEQ ID NO.3, SEQ ID NO.10 or SEQ ID NO.17, and the gene sequence of Tail is CGAGAGGTTGGCTGAGGTCCAAGTA or ACTGTTCGAGAGGTTGGCTGAGGTCCAAGTA; the gene sequence of the Fusion probe is SEQ ID NO.6, SEQID NO.11 or SEQ ID NO.18; The gene sequence of the WTprobe probe is SEQ ID NO.7, SEQ ID NO.12 or SEQ ID NO.19; In the Fusion probe and WTprobe probe, "+" indicates locked nucleic acid LNA modification, 5'VIC and 5'FAM are modified with fluorescent groups, 3'BHQ1 is modified with a quenching group, and 3'MGB is modified with a 3' end-linked minor groove binder plus a NFQ quenching group.

7. A method for detecting FGFR2 gene fusion mutation in cholangiocarcinoma using the nucleic acid combination of any one of claims 1 to 6, characterized in that: After RNA of the sample to be tested is extracted, a fixed sequence Uni is introduced at the 5' end of cDNA in the reverse transcription stage. In the digital PCR stage, the upstream primer Universal primer-F is bound to the Uni sequence, the downstream primer GSP primer R-Tail is bound to a sequence before the 3' end of exon 17 of FGFR2, the mutation probe Fusion probe is bound to a sequence between the downstream primer binding site and the 3' end of exon 17 of FGFR2, and the wild-type probe WT probe is bound to exon 18 of FGFR2. After the amplification reaction, the fluorescence signal of the amplified droplets was detected, and the copy number of the FGFR2 wild-type transcript and the fusion transcript was calculated using the insertion and deletion analysis method; the judgment was made based on the droplet fluorescence distribution combined with the insertion and deletion analysis method: when the FGFR2 wild-type transcript was amplified, the dual fluorescence marked by the Fusion probe and the WTprobe was generated, and when the FGFR2 fusion transcript was amplified, only the single fluorescence marked by the Fusion probe was generated, so as to distinguish the FGFR2 wild-type transcript and the FGFR2 fusion transcript; the total copy number of the mutant gene was calculated by the insertion and deletion analysis.

8. The method for detecting FGFR2 gene fusion mutation in cholangiocarcinoma according to claim 7, characterized in that: The extracted RNA contains mRNA.

9. The method for detecting FGFR2 gene fusion mutation in cholangiocarcinoma according to claim 7, characterized in that: When RNA is reverse transcribed into cDNA, the RNA is first heated to denature the secondary structure and then rapidly cooled on ice; a reverse transcription reaction mixture is prepared on ice, the reverse transcription reaction mixture comprising reverse transcription buffer, reverse transcriptase, Uni-N6 primer, RNA template and enzyme-free water.

10. The method for detecting FGFR2 gene fusion mutation in cholangiocarcinoma according to claim 7, characterized in that The digital PCR stage includes the following steps: S3-1. Prepare PCR system, including primer probe, PCR buffer, DNA polymerase, cDNA and enzyme-free water. Primer probe includes Universal primer-F, GSPprimer-R-Tail, Fusion probe and WTprobe; S3-2, using a droplet generation instrument to prepare the obtained PCR reaction system into droplets of uniform size; S3-3. The droplets are subjected to an amplification reaction on a digital PCR instrument. After the reaction is completed, the fluorescence signal of the amplified droplets is detected, and the copy number of the FGFR2 wild-type transcript and the fusion transcript is calculated using the insertion and deletion analysis method.

Images