Microneedle raw material composition and microneedle and acoustic power system formed by microneedle raw material composition

Abstract

The invention discloses a microneedle raw material composition as well as a microneedle and a sonodynamic system formed by the microneedle raw material composition. The microneedle raw material composition comprises a zinc-based porphyrin metal organic framework MOF (Zn-TCPP) modified by mPEG-PEI. The sonodynamic system provided by the invention can kill redundant white fat cells. Obese mice treated with this ultrasound gene therapy show significant improvements in glucose tolerance and insulin sensitivity, successfully achieving weight loss and inhibiting weight rebound.

Description

Technical Field

[0001] The invention belongs to the field of biomedicine, and specifically relates to a microneedle raw material composition and a microneedle formed therefrom and an acoustic power system. Background Art

[0002] The increasing prevalence of obesity and its association with various complications, including cardiovascular disease, type 2 diabetes, osteoarthritis, fatty liver disease, and several cancers (e.g., breast, colorectal, ovarian, liver, and pancreatic cancer), have made obesity a global health priority and the second leading preventable cause of death worldwide. Obesity is a condition of excessive fat accumulation in adipose tissue, which is mainly divided into white adipose tissue (WAT) and brown adipose tissue (BAT) based on its location and function; the former can effectively store lipids, while the latter generates heat by consuming lipids and glucose. Due to its superficial location and easy access, inducing its browning has been proposed as a major therapeutic strategy to combat obesity. Brown adipocytes contain multiple mitochondria that express unique thermogenic genes, among which uncoupling protein (UCP1) plays a central role. UCP1 uncouples oxidative phosphorylation from adenosine triphosphate, thereby converting energy into heat, thereby combating obesity and related metabolic disorders. Several reports have demonstrated the positive role of UCP1 overexpression in therapeutic strategies to combat obesity. However, gene regulation techniques that allow for sustained overexpression of UCP1 still have limitations, such as immunogenicity and the effects of gene mutations.

[0003] The clusters of regularly interspaced short palindromic repeat-associated nuclease protein 9 (CRISPR-Cas9) system, including CRISPR activation (CRISPRa) and CRISPR interference gene editing technologies, is a powerful tool for manipulating gene expression. It allows stable long-term overexpression and knockout of target genes with high efficiency and precision in gene editing, which has been widely adopted by the scientific community. Subtypes of the activation system rely on the fusion of dead Cas9 (dCas9) with transcriptional activation domains such as VP64 and KRAB, which together regulate the expression of endogenously activated genes. This technology has been used to activate the UCP1 gene in mouse white preadipocytes. Studies have shown that the dCas9 system has a lower risk of off-target effects and a milder effect than Cas9. However, when CRISPR-dCas9 technology is directly delivered into the body for disease treatment, the CRISPR system (such as plasmid DNA and ribonucleoprotein) will be degraded and immune-cleared. In addition, commonly used vectors such as adeno-associated virus, lentivirus and non-viral vector lipid nanoparticles have limited loading capacity and systemic toxicity. A new model and method for treating obesity is urgently needed. Summary of the invention

[0004] The technical problem to be solved by the present invention is that a new mode and method for treating obesity is urgently needed. Obesity is a growing global health problem, which requires an effective, feasible and innovative treatment mode. Therefore, the present invention provides a microneedle raw material composition and a microneedle and sonodynamic system formed by the composition. The patent develops a spatiotemporal controllable microneedle platform for ultrasound-gene therapy to combat obesity. The (mPEG-PEI) modified metal organic framework (MOF) sonosensitizer encapsulates the regularly interspaced short palindromic repeat activation (CRISPRa) / CRISPRa uncoupling protein (UCP1) system, which is prepared as a MN patch and delivered intradermally to adipocytes. In general, this treatment platform can achieve two major strategies of "treating the enemy" and "turning the tables": one is to kill excess white adipocytes through sonodynamic therapy, and the other is to promote the browning of white adipocytes through the controlled release of the CRISPRa-UCP1 system. Obese mice treated with this ultrasound gene therapy showed significant improvements in glucose tolerance and insulin sensitivity, successfully achieved weight loss and inhibited weight rebound. This study provides a new standard treatment mode for gene therapy of obesity and other metabolic diseases.

[0005] On one hand, the present invention provides a microneedle raw material composition, which uses mPEG-PEI to modify zinc-based porphyrin metal organic framework MOF (Zn-TCPP), and the composition is named MP.

[0006] In a preferred embodiment, in the microneedle raw material composition, the mass ratio of mPEG to PEI is 1:(0.5-5), preferably 1:0.5, 1:0.8, 1:1, 1:1.5, 1:1.8, 1:2, 1:2.5, 1:3, 1:3.5, 1:4, 1:4.5 or 1:5.

[0007] In a preferred embodiment, in the microneedle raw material composition, the mass ratio of mPEG-PEI to the MOF is 1:(2-10), preferably 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9 or 1:10.

[0008] Another aspect of the present invention further provides a method for preparing the raw material composition as described in the present invention, comprising: adding a mixed solution of mPEG and PEI to a zinc-based porphyrin metal organic framework MOF solution to obtain the MP.

[0009] Another aspect of the present invention provides a microneedle, wherein the microneedle carries the raw material composition as described in the present invention.

[0010] In a preferred embodiment, the microneedle further comprises 10-20 wt % of hyaluronic acid, such as 10 wt % of hyaluronic acid, 13 wt % of hyaluronic acid, 15 wt % of hyaluronic acid, 18 wt % of hyaluronic acid or 20 wt % of hyaluronic acid.

[0011] Another aspect of the present invention provides a method for preparing a microneedle, which comprises the following steps:

[0012] (a) mixing the raw material composition of the present invention with hyaluronic acid and depositing the mixture in the microneedle cavity;

[0013] (b) Continue to fill the microneedle cavity with hyaluronic acid solution to obtain the microneedle.

[0014] Another aspect of the present invention provides a microneedle patch, which comprises the microneedle and patch as described in the present invention.

[0015] Preferably, the content of the microneedle raw material composition in each microneedle patch is 50-200 μg; preferably 50 μg, 70 μg, 80 μg, 90 μg, 100 μg, 120 μg, 150 μg, 180 μg or 200 μg.

[0016] On the other hand, the present invention also provides an acoustic power system, which includes ultrasound, and a platform formed by the microneedle raw material composition and / or the microneedle patch described in the present invention, and uses the ultrasound to irradiate the raw material composition and / or the microneedle patch.

[0017] In a preferred embodiment, in the ultrasound-regulated gene editing system of the present invention, the ultrasound satisfies one or more of the following conditions:

[0018] 1.0-3.0 MHz, such as 1.0 MHz, 1.5 MHz, 2.0 MHz, 2.50 MHz or 3.0 MHz;

[0019] 0.1-3.0W cm -2 For example, 0.5W cm -2 , 0.8W cm -2 , 1.0W cm -2 、1.3W cm -2 , 1.5W cm -2 、1.8Wcm -2 , 2.0W cm -2 , 2.5W cm -2 or 3.0W cm -2 ;

[0020] and / or, 10%-50% duty cycle, such as 10% duty cycle, 20% duty cycle, 30% duty cycle, 40% duty cycle or 50% duty cycle;

[0021] The ultrasonic irradiation time is 3-15 min, for example 5 min.

[0022] On the other hand, the present invention also provides the use of the raw material composition according to the present invention, the raw material composition obtained by the preparation method according to the present invention, the microneedle according to the present invention, the microneedle patch obtained by the preparation method according to the present invention, the microneedle patch according to the present invention or the sonodynamic system according to the present invention in the preparation of drugs for treating obesity.

[0023] In a preferred embodiment, the raw material composition, the microneedle or the microneedle patch has one or more of the following characteristics:

[0024] I. promoting the drug to increase the level of ROS in white adipocytes of the subject;

[0025] II, promoting the drug to increase apoptosis of white fat cells in the subject;

[0026] III, promoting the drug to reduce the triglyceride storage capacity of the subject's white fat cells;

[0027] IV, promoting the drug to reduce fat in the subject's IgWAT, PgWAT, and PrWAT;

[0028] V. Promoting the drug to improve glucose tolerance and insulin resistance in a subject.

[0029] The microneedle patch described in the present invention is a new type of transdermal drug delivery device, the surface of which is covered with tiny needles, which can painlessly penetrate the surface layer of the skin and deliver drugs to subcutaneous cells.

[0030] The CRISPRa-UCP1 plasmid described in the present invention is a gene activation tool based on CRISPR / Cas9 system modification, which is used to enhance the expression of UCP1 (mitochondrial brown fat uncoupling protein 1) gene.

[0031] The MOF (Zn-TCPP) described in the present invention is a metal organic framework material coordinated by zinc ions and TCPP (tetracarboxyphenylporphyrin) and has a high surface area and high biocompatibility.

[0032] Obesity as described in the present invention refers to a chronic metabolic disease in which excessive accumulation or abnormal distribution of body fat leads to weight gain.

[0033] The present invention constructs an intelligent time-space controllable microneedle (MN) patch, which achieves ultrasound-gene therapy for obesity by upregulating browning genes and killing excess white fat cells. Figure 1As shown, by using mPEG (methoxy polyethylene glycol) or mPEG-PEI (methoxy polyethylene glycol-polyethyleneimine) modified zinc meso-tetrakis (4-carboxyphenyl) porphyrin (Zn-TCPP) MOF (metal organic framework material) as a carrier, loaded with CRISPRa-UCP1 plasmid (hereinafter also referred to as aUCP1) that upregulates UCP1, and then encapsulated in a hyaluronic acid (HA) MN patch, a US-regulated weight loss platform (hereinafter also referred to as MN-MP / aUCP1, where "MP" refers to mPEG-PEI modified MOF (Zn-TCPP)) was successfully prepared. The platform uses the transdermal properties of the MN patch to deliver the ultrasound-gene regulation system (hereinafter also referred to as MP / aUCP1) to the subcutaneous fat layer and penetrate into the adipocytes. Zn-TCPP modified with mPEG-PEI (600Da) exhibits high molecular weight and high cationic charge density, which can achieve effective gene aggregation and endosomal escape. In addition, US irradiation can promote intracellular plasmid transfection and gene overexpression. In general, under the spatiotemporal regulation of US, on the one hand, MOF is activated to efficiently produce reactive oxygen species (ROS) to kill excessive white adipocytes, and on the other hand, the activation of UCP1 is promoted through the CRISPRa-UCP1 system, thereby "rebelling" white adipocytes and promoting their browning. This method significantly promoted weight loss in mice (18.3% ± 1.7%), improved insulin resistance, and suppressed weight rebound for a long time. In addition, genome editing treatment caused by US significantly increased the level of oxidative stress in adipose tissue (e.g., 8-hydroxydeoxyguanosine (8-OHdG)) and upregulated the expression of browning-related genes (e.g., UCP1).

[0034] On the basis of being in accordance with the common sense in the art, the above-mentioned preferred conditions can be arbitrarily combined to obtain the preferred embodiments of the present invention.

[0035] The reagents and raw materials used in the present invention are commercially available.

[0036] The positive and progressive effects of the present invention are:

[0037] This patent develops a spatiotemporally controllable microneedle platform for ultrasound-gene therapy to combat obesity. The (mPEG-PEI) modified metal organic framework (MOF) sonosensitizer encapsulates the regularly interspaced short palindromic repeat activation (CRISPRa) / CRISPRa uncoupling protein (UCP1) system, which is prepared as a MN patch and delivered intradermally to adipocytes. Overall, this therapeutic platform is able to achieve two major strategies: "traitorous enemy" and "rebellion": one is to kill excess white adipocytes through sonodynamic therapy, and the other is to promote the browning of white adipocytes through the controlled release of the CRISPRa-UCP1 system. Obese mice treated with this ultrasound gene therapy showed significant improvements in glucose tolerance and insulin sensitivity, successfully achieved weight loss and inhibited weight rebound. This study provides a new standard treatment model for gene therapy of obesity and other metabolic diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 The preparation process of MN-MP / aUCP1 and its application in weight loss treatment with a spatiotemporally controllable ultrasound gene therapy platform. a) Schematic diagram of the synthesis process of the MN-MP / aUCP1 patch. b) Insertion of the MN-MP / aUCP1 patch into the white adipose tissue of the inguinal region of obese mice. c) Controlled release of MP / aUCP1 from the MN patch under US irradiation. d) "Traitor" and "rebellion": apoptosis and browning of white adipocytes. MN: microneedle; US: ultrasound.

[0039] Figure 2Characterization and ROS generation capacity of the MP / aUCP1 nanosystem. a) Transmission Electron Microscope (TEM) image of Zn-TCPP nanosheets (scale bar: 100 nm) and the corresponding elemental map. b) X-ray photoelectron spectroscopy (XPS) measurement scans of TCPP and Zn-TCPP. c) Ultraviolet-visible (UV-vis) absorption spectra of TCPP and Zn-TCPP nanosheets. d) Fourier transform infrared (FT-IR) spectra of TCPP and Zn-TCPP. e) Schematic diagram of the PX330 vector with sgRNA inserted and sequencing results of sgRNA targeting UCP1 in CRISPRa-UCP1 plasmid (aUCP1). f) Protein expression of UCP1 in mature adipocytes after co-incubation with or without aUCP1. g) Agarose gel electrophoresis of MP / aUCP1 with different mass ratios (aUCP1:MP=4:1, 2:1, 1:1, 1:0, 1:2, 1:3 or 1:4). H) Zeta potential of MOF (Zn-TCPP), MP, aUCP1 and MP / aUCP1, data are shown as mean standard deviation (SD) (n=3). I) X-ray diffraction (XRD) patterns of Zn-TCPP and MP / aUCP1 nanosheets. j, k) Addition of MP / aUCP1 (50 μg mL -1 )(j) or H 2 O(k) UV-visible (UV-vis) absorption spectra of DPBF (2,6-di(tert-butyl)phenol) under US irradiation. l) Electron spin resonance (ESR) measurements of US only, MP / aUCP1, and MP / aUCP1+US.

[0040] Figure 3 The sonodynamic properties of MP / aUCP1 nanosheets are shown. a, b) Flow cytometry (FCM) analysis of reactive oxygen species (ROS) levels (a) in mature 3T3-L1 adipocytes and the corresponding fluorescence intensity (b) after various treatments, data are shown as mean ± SD (n = 3). For gating strategy, see Fig. 9 b. c) Mature adipocytes stained with 2,7-dichlorofluorescein diacetate (DCFH-DA) were observed by confocal laser scanning microscopy (CLSM) after different treatments (scale bar: 10 μm). d) The expression of DCFH-DA in adipocytes was detected by ELISA with different concentrations (0, 2.5, 5, 10, 25 or 50 μg mL -1 ) MP / aUCP1 nanosheets for 24 h. The data are presented as mean ± SD (n = 5). e) The viability of mature adipocytes after co-culture with MP / aUCP1 (50 μg mL -1 ) plus various sound intensities (0, 0.25, 0.5, 0.75, 1 and 1.5 W cm-2 ) Viability of mature adipocytes treated with US radiation, data are expressed as mean ± SD (n = 5). f) Flow cytometric apoptosis analysis of mature adipocytes in different groups. For gating strategy, see Fig. 9 f. g) Cell triglyceride (TG) concentration after different treatments, data are expressed as mean ± SD (n = 3). I: control; II; US irradiation; III: aUCP1; IV: MP / aUCP1; V: MP+US; VI: MP / aUCP1+US. Significance was calculated by Student's t test. *P < 0.05, ***P < 0.001, ****P < 0.0001.

[0041] Figure 4 Preparation and characterization of MN-MP / aUCP1. a) Schematic diagram of microneedle (MN) patch preparation. b, c) Representative digital photos of MN patch (b) and MN patch loaded with MP / aUCP1 (c) (scale bar: 200 nm). d) Scanning electron microscope (SEM) image of MN-MP / aUCP1 patch (scale bar: 200 μm). e) Schematic diagram of the mechanical strength of MN patches with different HA concentrations and the corresponding test device. f) Hematoxylin-eosin (H&E) staining of mouse skin shows the penetration of MN (scale bar: 100 μm). g) Top: Images of MN tips pressed into the skin at different time points; MNs were almost completely dissolved within 15 minutes (scale bar: 200 μm); Bottom: Skin recovery after MN treatment (scale bar: 5 mm). h) Fluorescence image of MN patch containing MP nanosheets loaded with aUCP1-ICG (IndocyanineGreen, an indigo green compound) and Cy3 (Cyanine 3, a cyanine fluorescent dye) (scale bar: 200 μm). I) In vivo fluorescence images of MN patches inserted into the inguinal region by subcutaneous injection (InJ) or insertion, showing the delivery of aUCP1 (aUCP1-ICG) and MP / aUCP1 (aUCP1-ICG loaded with MP). j) Quantification of fluorescence intensity during the 3-day treatment period, data are expressed as mean ± SD (n = 3). k, l) Fluorescence biodistribution (k) and corresponding fluorescence intensity quantitative analysis (l) of the main organs of mice 24 hours after subcutaneous injection or MN patch delivery of aUCP1 and MP / aUCP1, data are expressed as mean ± SD (n = 3). Statistical significance was calculated by Student's t test. *P<0.05, **P<0.01, ****P<0.0001.

[0042] Figure 5Figure 2 shows the anti-obesity therapeutic effect of MN-MP / aUCP1 under US irradiation. a) Schematic diagram of different treatments of mice. b, c) Changes in body weight (b) and high-fat diet (HFD) intake (c) of mice under different treatment conditions, data are expressed as mean ± SD (n = 5). d) Representative photos of mice on day 21 after various treatments. e) Representative photos of adipose tissues from different parts extracted from mice in d). f) Weight of adipose tissues in e), data are expressed as mean ± SD (n = 5). g) Representative hematoxylin-eosin (H&E) images of adipose tissues from different parts (scale bar: 50 μm). h) Corresponding morphometric analysis of adipocyte size. i) H&E and Oil Red O staining of liver sections isolated from mice after 21 days of different treatments (scale bar: 50 μm). IgWAT: inguinal white adipose tissue; PgWAT: perigonadal white adipose tissue; PrWAT: perirenal white adipose tissue. Statistical significance was calculated by Student's t test. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

[0043] Figure 6 Figure 4 shows the improvement and long-term effects of obesity-related metabolic dysfunction in mice after treatment with MN-MP / aUCP1+US. a-c) Serum glucose (a) and insulin (b) levels of mice on day 21 after various treatments, IRI (c) calculated from the above serum glucose and insulin levels; data are expressed as mean ± SD (n = 5). d-f) Triglyceride (TG) (d), free fatty acid (FFA) (e) and cholesterol (CHO) (f) levels, data are expressed as mean ± SD (n = 5). g) Sirius red staining of white adipose tissue (IgWAT) of mice in different groups after 21 days of treatment (scale bar: 100 μm). h) Masson staining and Sirius red staining of livers of mice in different groups after 21 days of treatment (scale bar: 500 μm). I) Daily dietary intake of mice with different treatments during the 15-day weight recovery monitoring period. j, k) Body weight change (j) and corresponding percentage of body weight change (k) during the weight recovery monitoring period, data are expressed as mean ± SD (n = 3). I: control; II: MN+US; III: MN-aUCP1; IV: MN-MP / aUCP1; V: MN-MP+US; VI: MN-MP / aUCP1+US. Statistical significance was calculated by Student's t test. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

[0044] Figure 7Changes in the molecular levels of IgWAT after MN-MP / aUCP1+US treatment. a) Representative terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) images showing apoptosis (red) in inguinal white adipose tissue (IgWAT), perigonadal WAT (PgWAT), and perirenal WAT (PrWAT) (scale bar: 50 μm). b) Representative fluorescence images of reactive oxygen species (ROS) levels in IgWAT (scale bar: 50 μm). ce) Oxidative stress levels in IgWAT of different treatment groups, including MDA (c), 4-HNE (d), and 8-OHdG (e), data are expressed as mean ± SD (n = 5). f) Representative immunofluorescence images of UCP1 labeling of IgWAT sections (scale bar: 50 μm). g) mRNA expression levels of UCP1 in IgWAT of mice in different groups, data are expressed as mean ± SD (n = 3). h) Western blot analysis of UCP1, PGC1-β and PPARγ in IgWAT. I, j) mRNA expression levels of PGC1-β (I) and PPARγ (j), data are expressed as mean ± SD (n = 3). k) Determination of TG content in IgWAT, data are expressed as mean ± SD (n = 3). l) First-generation sequencing results of UCP1 in mouse IgWAT. I: control; II: MN+US; III: MN-aUCP1; IV: MN-MP / aUCP1; V: MN-MP+US; VI: MN-MP / aUCP1+US. Statistical significance was calculated by Student's t test. **P<0.01, ***P<0.001, ****P<0.0001.

[0045] Figure 8 : a) Bright field image of MOF (Zn-TCPP) nanosheets (scale bar: 200 nm). b) TEM image and corresponding elemental map of MP / aUCP1 nanosheets (scale bar: 100 nm). c) Particle size distribution of Zn-TCPP, MP and MP / aUCP1 (n=3).

[0046] Fig. 9 :a) Under US irradiation, MP / aUCP1 (50 μg mL -1 ) or H 2 b) Flow cytometry gating strategy for analyzing ROS levels. c) Quantification of reactive oxygen species (ROS) levels in mature 3T3-L1 adipocytes by confocal laser scanning microscopy (CLSM). Data are presented as mean ± SD (n = 3). d) 3T3-L1 preadipocytes treated with different concentrations (0, 2.5, 5, 10, 25, and 50 μg mL -1) after 24 h of co-culture with MP / aUCP1 nanosheets. Data are presented as mean ± SD (n = 5). e) The viability of MP / aUCP1 nanosheets co-cultured with MP / aUCP1 (50 μg mL -1 ) plus different sound intensities (0, 0.25, 0.5, 0.75, 1 and 1.5 W cm -2 ) Viability of 3T3-L1 preadipocytes treated with US irradiation. Data are presented as mean ± SD (n = 5). f) Gating scheme for apoptosis analysis using flow cytometry. g) Fluorescence microscopy images of 3T3-L1 preadipocytes stained with Calcein AM and PI after different treatments (scale bar: 50 μm). Significance was calculated by Student's t test. ns: not significant, ****P<0.0001.

[0047] Fig.10 : a) Confocal laser scanning microscopy (CLSM) (left) and corresponding quantitative analysis (right) were used to observe the cellular uptake of different treatment groups after incubation with mature adipocytes for 4 hours (scale bar: 20 μm). b) CLSM images (left) and corresponding fluorescence intensity (right) of MP / aUCP1 co-incubated with mature adipocytes for 4 hours without or with US irradiation were used to evaluate the lysosomal / endosomal escape ability (scale bar: 20 μm).

[0048] Fig.11 : The transfection capacity of 3T3-L1 preadipocytes (a) and mature adipocytes (b) after different treatments was evaluated by flow cytometry. Data are presented as mean ± SD (n = 3). The significance was calculated by Student's t test. **P < 0.01, ***P < 0.001, ****P < 0.0001.

[0049] Fig.12 : a, b) Transfection efficiency of 3T3-L1 preadipocytes was evaluated by fluorescence microscopy (a) and corresponding quantitative analysis (b). c, d) Transfection efficiency of mature adipocytes was evaluated by fluorescence microscopy (c) and corresponding quantitative analysis (d) (scale bar: 50 μm). Data are expressed as mean ± SD (n = 3). Significance was calculated by Student's t test. **P < 0.01, ***P < 0.001.

[0050] Fig.13: a) Scanning electron microscopy (SEM) images of hyaluronic acid (HA) microneedle (MN) patches (scale bar: 200 μm). b) Hematoxylin-eosin (H&E) staining of mouse skin 24 h after administration of PBS (left) and MN patches (right) (scale bar: 500 μm). c) Mechanical strength of MN patches with different MP / aUCP1 contents. d) Representative photos of MN patches implanted subcutaneously in the inguinal region of mice for 1 min (left) and 15 min (right). e) Transfection capacity of mature adipocytes after different treatments was evaluated by flow cytometry. f) Skin photos 24 h after different treatments. gi) Fluorescence biodistribution (g) and corresponding fluorescence intensity quantitative analysis of the main organs of mice on days 2 (h) and 3 (i) after different treatments. Data are expressed as mean ± SD (n = 3). Statistical significance was calculated by Student's t test. ns: not significant, *P<0.05, **P<0.01, ***P<0.001.

[0051] Fig.14 : a) Percentage change in body weight of mice under different treatment conditions during 21 days of treatment. Data are presented as mean ± SD (n = 5). b) Representative photos of isolated livers of mice on day 21 after various treatments. c) Changes in blood glucose concentration during oral glucose tolerance test after 8 hours of fasting in different groups of mice. Data are presented as mean ± SD (n = 3). Statistical significance was calculated by Student's t test. *P < 0.05, ***P < 0.001, ****P < 0.0001.

[0052] Fig.15 : Representative hematoxylin-eosin (H&E)-stained histological images of the main organs such as heart, spleen, lung, and kidney of mice in different groups after 21 days of treatment (scale bar: 200 μm).

[0053] Fig.16 : Routine blood analysis of mice on day 21 after different treatments. The range within the dashed line represents the normal norm. Data are expressed as mean ± SD (n = 5). RBC: red blood cell; WBC: white blood cell count; Lymph: lymphocyte; Gran: granulocyte; Mon%: monocyte percentage; Lymph%: lymphocyte percentage; Gran%: granulocyte percentage; MCH: mean corpuscular hemoglobin; MCV: mean corpuscular volume; PLT: platelet count.

[0054] Fig.17: Serum biochemistry of mice on day 21 after different treatments (ah). Serum ALT (a), AST (b) and TP (c) reflect liver function. Serum CK (d), CK-MB (e) and LDH (f) reflect cardiac function. Serum urea (g) and creatinine (h) reflect renal function. Data are expressed as mean ± SD (n = 5). Statistical significance was calculated by Student's t test. ns: not significant, *P < 0.05, **P < 0.01.

[0055] Fig.18 : af) Analysis of interleukin-6 (IL-6), IL-1β, and tumor necrosis factor α (TNF-α) levels in mouse serum (ac) and IgWAT (df). Data are presented as mean ± SD (n = 5). g) Photographs of mice treated with various conditions during the 15-day weight recovery monitoring period. Statistical significance was calculated by Student's t-test. ns: not significant, ****P < 0.0001.

[0056] Fig.19 : a) Quantitative analysis of terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) images in inguinal white adipose tissue (IgWAT), PgWAT (perigonadal white adipose tissue); PrWAT (perirenal white adipose tissue). Data are expressed as mean ± SD (n = 3). b) Quantitative analysis of ROS levels in IgWAT. c) Quantitative analysis of UCP1 levels in IgWAT. Data are expressed as mean ± SD (n = 3). d) Western blot analysis of PPARα in IgWAT. e) Free fatty acid (FFA) levels in IgWAT of mice on day 21 after different treatments. Data are expressed as mean ± SD (n = 3). f) Principal component analysis (PCA) plot of RNA-seq data of IgWAT isolated from untreated and MN-MP / aUCP1+US treated mice (n = 5). Statistical significance was calculated by Student's t test. ns: not significant, **P<0.01, ***P<0.001, ****P<0.0001. DETAILED DESCRIPTION

[0057] The present invention is further described below by way of examples, but the present invention is not limited to the scope of the examples. The experimental methods in the following examples without specifying specific conditions are carried out according to conventional methods and conditions, or selected according to the product specifications.

[0058] Overview of Materials and Methods

[0059] 1. Materials

[0060] Unless otherwise stated, all chemicals in this patent were obtained from Sigma-Aldrich. Meso-tetrakis(4-carboxyphenyl)porphine (TCPP, 97%) was purchased from Tokyo Chemical Industry Co., Ltd. Ethanol was purchased from Merck. Pyrazine (99%) was purchased from Aladdin. SDS-PAGE gel rapid preparation kit was purchased from Beyotime Co., Ltd. Hyaluronic acid (10 kDa) was purchased from Meilun Biotechnology Co., Ltd. Dulbecco's Modified Eagle Medium (DMEM), calf serum and fetal bovine serum (FBS) were purchased from Biological Industries. Blood glucose, free fatty acid (FFA) and insulin detection kits were purchased from Nanjing Jiancheng. Mouse IL-6, IL-1β and TNF-α ELISA kits were purchased from Youbiai (Shanghai, China). Various other detection kits used in this patent were purchased from Beyotime. Anti-UCP1 antibody was from CST, and anti-PGC1β antibody, anti-PPARα antibody, and anti-PPARγ antibody were from Abcam.

[0061] 2. Characterization

[0062] The morphology of MOF (Zn-TCPP) and MP / aUCP1 nanosheets was obtained by TEM (FEI Tecnai G2 F20, accelerating voltage = 200 kV). The corresponding element mapping was observed by JEM-2100F. XPS was performed by X-ray photoelectron spectrometer (Thermoescalab 250XI). The UV-visible absorption spectrum was examined by UV-visible near-infrared spectrophotometer (PE Lambda 950). The infrared spectrum was studied with Shimadzu IR Prestige-21 infrared spectrometer. The size and ζ potential were detected by Malvern ZetaParticle Sizer Nano Series (Nano ZS90). The XRD pattern was tested with a bruker D8 X-ray diffractometer. Confocal images were captured by CLSM (Carl Zeiss, LSM 900). Determined by electron spin resonance (ESR) spectrometer (200A300-10 / 12) 1 O 2 The morphology of MN patches was observed using a scanning electron microscope (ZEISS GeminiSEM 300). Fluorescent sections were observed using a Nikon biological microscope (CI-L).

[0063] 3. Synthesis of MOF (Zn-TCPP) nanopatch

[0064] PVP (105 mg), Zn(NO3 ) 2 6H 2 O (22.5 mg, 0.075 mmol) and pyrazine (4 mg, 0.05 mmol) were dissolved in a 85 mL brown flask with a lid containing a mixture of 60 mL of DMF and ethanol (V:V=3:1). TCPP (20 mg, 0.025 mmol) dissolved in a mixture of 25 mL of DMF and ethanol (volume ratio = 3:1) was then added dropwise under stirring. Next, the prepared solution was ultrasonically treated for 20 minutes. The flask was placed in a water bath with magnetic stirring and reacted at 80°C for 16 hours. After washing twice with ethanol and centrifuging at 8000 r.pm for 8 minutes, MOF (Zn-TCPP) nanosheets were obtained. Subsequently, the collected Zn-TCPP nanosheets were dispersed in 50 mL of ethanol.

[0065] 4. Building the CRISPRa-UCP1 system

[0066] The UCP1 gene sequence is available at https: / / www.ncbi.nlm.nih.gov / and its Gene ID is 7350. The target of the UCP1 gene sequence was designed using an online tool (http: / / chopchop.cbu.uib.no / .): AGGGCTTTGGGAGTGACGCG (SEQ ID NO: 1). sgRNA and CRISPR-dCas9 system were obtained from Integrated DNA Technologies.

[0067] 5. Western blot analysis of mature adipocytes

[0068] After 3T3-L1 preadipocytes (white adipocytes) were differentiated into mature adipocytes, the CRISPRa-UCP1 plasmid was mixed with Lipofectamine 2000 and treated on mature adipocytes for 3 days. The total protein concentration was assessed using the BCA protein detection kit. Equal amounts of protein (25 μg) were separated in 12% sodium dodecyl sulfate polyacrylamide gel. The protein was transferred to a PVDF membrane and incubated with blocking buffer for 1 hour at room temperature. The membrane was incubated overnight with a 1000-fold diluted anti-UCP1 antibody (CST, Catalog No.72298), followed by immersion in the coupled secondary antibody for 1 hour at room temperature. Finally, after 3 washes, the protein expression level was measured by a chemiluminescence imaging system (GE healthcare, USA).

[0069] 6. Synthesis of P / aUCP1, MP and MP / aUCP1 nanosheets

[0070] A mixture of mPEG and PEI (w:w=1:2) and aUCP1 were mixed at a mass ratio of 1:1.25 and stirred overnight to prepare P / aUCP1. 40 mg of Zn-TCPP was dispersed in 5 mL of PBS, to which 10 mg of a mixture of mPEG and PEI (w:w=1:2) was added and stirred overnight in the dark at room temperature. Then, mPEG-PEI-modified Zn-TCPP was obtained. MP / aUCP1 nanosheets were obtained by mixing MP with aUCP1 at a mass ratio of 4:1 for 2 h.

[0071] 7. Agarose gel electrophoresis analysis

[0072] CRISPRa-UCP1 plasmids with different mass ratios were incubated with MP overnight. The mixture was then centrifuged at 8000 rpm for 8 minutes and the supernatant was collected. Subsequently, 5 μL of the supernatant with different mass ratios was mixed with 1 μL of 6× DNA loading buffer to prepare various loading solutions. These loading solutions were then added to the sample wells in a 0.5% agarose gel and electrophoresed at 80 V for 40 minutes. Gel imaging was performed using a gel documentation system (ChampChemi 910Plus).

[0073] 8. In vitro sonodynamic performance evaluation

[0074] Under US irradiation, 1,3-diphenylisobenzofuran (DPBF) was used as 1 O 2 Indicator for evaluating MP / aUCP1 production in vitro 1 O 2 To test this, a DMSO solution containing DPBF (5 μL, 10 mM) was mixed with 50 μg mL -1 The MP / aUCP1 solution was mixed. The UV-vis absorption spectrum of DPBF was measured to evaluate the absorption of DPBF by US (1.0 MHz, 1.5 W·cm -2 , 50% duty cycle) after irradiation for different durations (0min, 1min, 2min, 3min and 4min) 1 O 2 In addition, 2,2,6,6-tetramethylpiperidine (TEMP) was used as a trapping agent to detect the presence of 2,2,6,6-tetramethylpiperidine in different treatment groups by ESR spectroscopy. 1 O 2 , including H 2 O+TEMP+US (1.0 MHz, 1.5 W cm -2 , 50% duty cycle, 5 min), TEMP+MP / aUCP1 (50 μg mL -1 ), and MP / aUCP1 (50 μg mL -1)+TEMP+US(1.0MHz,1.5W cm -2 , 50% duty cycle, 5min).

[0075] 9. Culture of cells and mice

[0076] 3T3-L1 embryonic fibroblasts (preadipocytes) were purchased from the American Type Culture Collection (ATCC) and cultured in a medium containing 10% calf serum and 5% CO. 2 The cells were cultured in DMEM medium at 37°C. The cell line was authenticated quarterly to ensure that there was no mycoplasma contamination. For the differentiation of 3T3-L1 preadipocytes, when the cell confluence reached 100%, the prepared MDI induction medium (90% DMEM, 10% FBS, 0.5 mM 3-isobutyl-1-methylxanthine, 1 μM dexamethasone and 10 μg mL -1 Insulin) and cultured for 2 days, then switched to DMEM containing 10% FBS and 1 μM dexamethasone and cultured for 2 days. Subsequently, the culture medium was replaced with DMEM medium containing 10% FBS and continued to be cultured, and the liquid was changed every 2 days until 3T3-L1 preadipocytes were induced into mature adipocytes on the 8th to 10th day. All mouse experiments throughout the study were carried out in accordance with the policies of the Ministry of Health and approved by the Experimental Animal Center of the Tenth People's Hospital of Shanghai. Male C57BL / 6J mice aged 6-8 weeks were purchased from Lingchang Biotechnology Co., Ltd. Mice were fed a high-fat diet (HFD) (Wuxi Fanbo Biotechnology Co., Ltd., FB-D12492, 60% fat) for about 8 weeks, and their body weight increased from ≈18g to ≈35g.

[0077] 10. Sonodynamic properties and anti-obesity performance at the cellular level

[0078] To verify the sonodynamic properties at the cellular level, 3T3-L1 preadipocytes were induced to differentiate into mature adipocytes according to the previous method. The mature adipocytes were divided into six groups: control, US (1.0 MHz, 1.5 W cm -2 , 50% duty cycle, 5 min), aUCP1 (according to the manufacturer's instructions, 10 μg mL -1 Mixed with Lipofectamine 2000), MP / aUCP1 (50 μg mL -1 )、MP+US(MP, 40μg·mL -1 ; US, 1.0MHz, 1.5W cm -2 , 50% duty cycle, 5 min) and MP / aUCP1+US (MP / aUCP1, 50 μg mL -1 ; US, 1.0MHz, 1.5W cm -2, 50% duty cycle, 5 min). After 12 h, ROS levels were measured using DCFH-DA probe and FCM analysis. In addition, after loading the DCFH-DA probe, ROS generation was observed using CLSM. ROS-positive areas were quantified using Image J software. Cell marker content was quantified by a colorimetric analysis kit. On the other hand, the cell viability of 3T3-L1 preadipocytes and mature adipocytes was determined by a standard CCK-8 assay, and cell apoptosis was identified by flow cytometry after annexin V-FITC / propidium iodide staining.

[0079] 11. Analysis of cellular uptake and lysosomal escape

[0080] P / aUCP1, aUCP1 (mixed with Lipofectamine 2000) and MP / aUCP1 were modified with FITC to produce P / aUCP1-FITC, aUCP1-FITC and MP / aUCP1-FITC. The induced differentiated mature adipocytes were divided into four groups: P / aUCP1-FITC (18 μg mL -1 )、aUCP1-FITC(10μg mL -1 )、MP / aUCP1-FITC(50μg mL -1 ) and MP / aUCP1-FITC+US (MP / aUCP1, 50 μg mL -1 ; US: 1.0MHz, 1.5W cm -2 , 50% duty cycle, 5 min). Four hours later, the nuclei were stained with DAPI and the uptake of the material was observed using confocal laser microscopy. To analyze lysosomal escape, lysosomes / endosomes and nuclei were stained with lysosomal red fluorescent probe and DAPI 4 hours after the cells were treated. Subsequently, the cells were washed three times with PBS, fixed with 4% paraformaldehyde, and observed under CLSM.

[0081] 12. Evaluation of gene transfection ability

[0082] P / aUCP1@EGFP, aUCP1@EGFP (mixed with Lipofectamine 2000), and MP / aUCP1@EGFP, each containing an equal amount of pEGFP, were co-incubated with 3T3-L1 preadipocytes and mature adipocytes. The cells were cultured for 6 hours, and then fresh DMEM medium was added and co-cultured for another day. Subsequently, the transfection efficiency of the harvested cells was evaluated using FCM and fluorescence microscopy.

[0083] 13. Preparation of microneedle patches

[0084] MN patches were fabricated using a polydimethylsiloxane (PDMS) mold, with each needle cavity having a 300 μm × 300 μm square base tapering to a height of 800 μm. MNs were arranged in a 12 × 12 array with a center spacing of 600 μm. To prepare the MN patch, HA solution was prepared by dissolving 15 wt% HA in PBS. 100 μL of HA solution was mixed with MP (80 μg), aUCP1 (20 μg mixed with Lipofectamine 2000), and MP / aUCP1 (100 μg) and deposited in the needle cavity and dried under vacuum for 20 min. The needle chamber was then filled with 100 μL of HA solution, and the micromold was left to stand at 25 °C overnight to form the MN patch. The morphology of empty and drug-loaded MNs was observed using a scanning electron microscope. HA MN patches with 10%, 15%, or 20% by weight were prepared, and the mechanical strength of the MNs was measured using a tensile tester (WDW-10). The prepared nanosheets are Figure 1 shown.

[0085] 14. Characterization of MN-MP / aUCP1 patches

[0086] MN patches containing different amounts of MP / aUCP1 were prepared and tested for mechanical strength. To evaluate the transfection efficiency of drug-loaded MN patches after US irradiation, different MNs were incubated with mature adipose tissue for 6 hours, followed by replacement with fresh DMEM medium and culture for another day. Subsequently, the transfection efficiency of the collected cells was evaluated using FCM. aUCP1-ICG and MP / Cy3 were used to prepare MN patches for fluorescence imaging. The aUCP1 solution was mixed with ICG, stirred at room temperature in the dark for 24 hours, and aUCP1 labeled with ICG was obtained after dialysis. MP and Cy3 were stirred in the dark for 24 hours, then centrifuged to obtain MP / Cy3. Fluorescence images of MN sections were taken by CLSM. In vivo imaging system (IVIS) spectral imaging system (VISQUE Invivo Smart-LF) was used for in vivo imaging of obese mice and fluorescence imaging of ex vivo organs and tissues.

[0087] 15. In vivo treatment of obesity using MN-MP / aUCP1 patch

[0088] Diet-induced obese mice were randomly divided into 6 groups, including control group, MN+US group, MN-aUCP1 group, MN-MP / aUCP1 group, MN-MP+US group, and MN-MP / aUCP1+US group. The abdominal hair of the mice was shaved and anesthetized, and different drug-loaded MN patches were inserted into the subcutaneous fat layer of the right inguinal area. After 15 minutes, 1 cm 2 The ultrasonic probe is 1.0MHz, 1.5W cm -2The abdomen of the mice with the MN patch inserted was irradiated for 5 minutes at 50% duty cycle. Each mouse received 7 courses of treatment, once every 3 days. During the treatment period, the food intake and body weight of the mice were monitored every 3 days. At the end of the 21-day treatment, blood samples were collected from mice fasted for 12 hours by retro-orbital puncture, and serum was separated by centrifugation. Serum glucose and insulin levels were measured by detection kits, serum glucose (mmol L -1 )× serum insulin (mIU L -1 ) / 22.5 to calculate IRI. Subsequently, the mice were subjected to an oral glucose tolerance test. Glucose (2 g kg -1 ). Glucose concentration in tail vein blood was measured by glucose meter (Yuwell) at 0, 0.5 and 2 hours. Then, mice were sacrificed, blood samples were obtained for serum biochemical analysis, and major organs (heart, liver, spleen, lung and kidney) were collected for H&E staining. Liver sections were stained with Oil Red O to characterize the degree of lipid droplet infiltration.

[0089] Meanwhile, inguinal, perigonadal, and perirenal adipose tissues were isolated from each mouse, fixed, wrapped in paraffin, and cut into sections. The size of adipose tissues was observed by H&E staining. The stained sections were photographed by microscope. Apoptotic cells in adipose tissues of different parts were detected by TUNEL kit. IgWAT was immunofluorescently stained with anti-UCP1 antibody (1:100 dilution). Malondialdehyde content was determined by colorimetry. ROS, 4-HNE, and 8-OHdG levels were determined by corresponding ELISA kits. Quantitative analysis of fluorescent images was performed using image J software. Total RNA was extracted from IgWAT using TRIzol reagent (Invitrogen), and cDNA was synthesized using a reverse transcription system (Thermo Fisher). The relative gene expression of UCP1, PGC1-β, and PPARγ was evaluated by 7500 real-time PCR system (ABI Step oneplus, Applied Biosystems). In addition, UCP1, PGC1-β, PPARγ and PPARα levels were assessed based on Western blotting using anti-UCP1 antibody (CST, catalog number 72298), anti-PGC1-β antibody (Abcam, catalog number ab176328), anti-PPARγ antibody (Abcam, catalog number ab178860) and anti-PPARα antibody (Abcam, catalog number ab314112) (1:1000 dilution). TAG content was determined using a colorimetric assay kit. First-generation sequencing was performed using a 3730xl sequencer (Applied Biosystems), and sequencing results were interpreted using sequencing analysis 5.2.0 software.

[0090] 16. Monitoring of body weight recovery after MN-MP / aUCP1+US treatment

[0091] After 21 days of treatment with MN-MP / aUCP1+US, mice were monitored for HFD and weight recovery over 15 days. Food intake of mice was recorded daily, and body weight was measured on days 24, 30, and 36 during this period.

[0092] 17. RNA Sequencing

[0093] IgWAT was isolated from mice after 7 courses of treatment with MN-MP / aUCP1+US, and IgWAT from obese mice was used as a control. RNA from IgWAT was extracted using a universal RNA extraction kit (Magen Biotech Co., Ltd.). RNA sequencing was performed using the RNA Nano 6000 detection kit of the Agilent Bioanalyzer 2100 system (Agilent Technologies).

[0094] Statistical analysis

[0095] All data are shown as mean ± SD. Statistical differences were calculated using unpaired Student's t test by GraphPad Prism software (version 9.0.0) and are indicated as ns, not significant, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

[0096] Example 1: Preparation and characterization of MP / aUCP1 nanosheets

[0097] The morphology and size of MOF (Zn-TCPP) were observed using a transmission electron microscope (TEM), which showed a layered structure with an average diameter of about 250 nm ( Figure 2 A and Figure 8 a). TEM elemental maps show that zinc (Zn), carbon (C), nitrogen (N), and oxygen (O) elements are uniformly distributed throughout the structure of the metal-organic framework (Zn-TCPP) structure ( Figure 2 a). To further verify the elemental composition and valence state of Zn-TCPP nanosheets, X-ray photoelectron spectroscopy (XPS) was performed. It was found that the main composition of the elements was consistent with the results observed in the drawing image ( Figure 2 b). In addition, Zn 2p showed two distinct peaks, confirming the existence of Zn valence states in Zn-TCPP nanosheets. The optical properties of Zn-TCPP nanosheets were examined using UV-visible (UV-vis) spectroscopy ( Figure 2c). Free TCPP shows a characteristic peak of the porphyrin ring at 425nm, while the characteristic peak of Zn-TCPP nanosheets shows a slight red shift (435nm). The free form of TCPP molecules shows a range of 510-650nm, while Zn-TCPP nanosheets show two Q bands at 558nm and 595nm, respectively, indicating that the porphyrin ring is bound by Zn 2+ The ions were successfully metallized. The binding mode between porphyrin and Zn atom was further studied by Fourier transform infrared spectroscopy (FT-IR). Figure 2 In the TCPP spectrum, at ≈1700 cm -1 The absence of C=O stretching vibration peaks at ≈1600 and 1400 cm -1 Two new peaks appeared at 982 cm-1, indicating that the carboxyl group in the TCPP ligand formed a Zn-O bond with the metal. In addition, the plane vibration of NH -1 Disappeared at 995cm -1 A new peak appears at , indicating that Zn-TCPP belongs to metalloporphyrin.

[0098] By cloning sgRNA targeting UCP1 and stably expressing the vector encoding dCas9, the CRISPRa-UCP1 plasmid was constructed to edit the uncoupling protein gene. The fusion protein contains the viral protein 16 transcriptional activator (VP64), the NF-κB transactivation subunit p65, and the Epstein-Barr virus R transactivator (Rta) (the above three constitute VP64-p65-Rta) ( Figure 2 The results showed that UCP1 expression was increased in mature adipocytes transduced with CRISPRa-UCP1 compared with the control group ( Figure 2 f). The binding affinity between mPEG-PEI modified MOF (MP) and aUCP1 was studied by agarose gel electrophoresis ( Figure 2 g). As the amount of aUCP1 increased, the MP capacity became insufficient. To improve transfection efficiency and protect the plasmid from nuclease degradation, MP was effectively combined with aUCP1 at a mass ratio of 4:1. TEM analysis showed an increase in C, N, and O elements in MP / aUCP1, indicating the successful modification of mPEG-PEI. And the presence of phosphorus (P) element further confirmed the successful loading of aUCP1 in MP ( Figure 2 A and Figure 8 b). In addition, after mPEG-PEI modification, the potential changed from negative to positive ( Figure 2 Subsequently, MP was used to load aUCP1 by electrostatic adsorption, and the final average potential of MP / aUCP1 was measured to be 3.39 mV ( Figure 2h). Dynamic light scattering (DLS) measurements showed that the loading of aUCP1 increased the average size of MPs from 257.1 nm to 288 nm ( Figure 8 c). As shown by X-ray diffraction (XRD), the MP / aUCP1 nanosheets still maintained good crystallinity despite the loading of mPEG-PEI and aUCP1, indicating that the crystal structure was not significantly affected ( Figure 2 The above results indicate the successful co-loading of mPEG-PEI and aUCP1.

[0099] Example 2: Sonodynamic properties and in vitro anti-obesity performance of the MP / aUCP1 system

[0100] To further investigate the sonodynamic properties of the MP / aUCP1 nanosystem, UV-visible spectroscopy and electron spin resonance (ESR) spectroscopy were used to detect the generation of ROS. 1 O 2 The production has increased significantly ( Figure 2 J and Fig. 9 a), confirming that the nanosystem has the desired properties. However, pure H 2 After ultrasound irradiation 1 O 2 No significant increase ( Figure 2 k and Fig. 9 a). In addition, 2,2,6,6-tetramethylpiperidine (TEMP) was used to capture 1 O 2 Compared with the US and MP / aUCP1 groups, 1 O 2 Characteristic signal (1:1:1)( Figure 2 Flow cytometry (FCM) analysis and confocal laser scanning microscopy (CLSM) were used to test the ability of the nanosystem to produce ROS in mature 3T3-L1 cells. Figure 3 a, b and Fig. 9 As shown in b, the average levels of ROS in mature adipocytes were 50.8% and 50.4% in the MP+US group and the MP / aUCP1+US group, respectively, which were significantly higher than those in the control group. Similarly, the results obtained from CLSM using a 2,7-dichlorofluorescein diacetate (DCFH-DA) probe were consistent with those from FCM analysis, confirming that MP / aUCP1 was able to generate significant intracellular ROS under US stimulation, which confirmed the efficient sonodynamic effect (Sonodynamic Therapy) against obesity ( Figure 3 C and Fig. 9 c).

[0101] The anti-obesity effects were then evaluated in vitro. Fig. 9 D and Figure 3 As shown in d, the results indicate that MP / aUCP1 has high biosafety and its cytotoxicity to 3T3-L1 preadipocytes and mature adipocytes is negligible even at higher concentrations. After incubation with MP / aUCP1, both 3T3-L1 preadipocytes and mature adipocytes showed an intensity-dependent therapeutic effect when exposed to US radiation ( Fig. 9 E and Figure 3 e). To further verify the therapeutic potential of the nanosystem, FCM was used to detect the viability of mature adipocytes after different treatments. Compared with other treatments, the MP / aUCP1+US group showed a significantly higher apoptosis rate (43.5%) ( Fig. 9 f and Figure 3 f). Correspondingly, the killing effect was also observed in 3T3-L1 preadipocytes ( Fig. 9 At the same time, the study evaluated the therapeutic effects of each group of treatments on triglyceride (TG) storage in adipocytes. The results showed that mature adipocytes co-incubated with MP / aUCP1 showed a significant decrease in intracellular TG after US irradiation, which means that MP / aUCP1 effectively inhibited lipid storage ( Figure 3 g).

[0102] Example 3: The MP / aUCP1 system has efficient lysosomal escape and gene editing capabilities in vitro. CLSM was used to study the cellular uptake ability of FITC-labeled MP / aUCP1. The P / aUCP1 group (synthesized by mPEG-PEI-encapsulated aUCP1) and the aUCP1 group (using commercially available Lipofectamine2000 as a transfection aid) were used as control groups. The results showed that mature adipocytes effectively internalized MP / aUCP1, and US enhanced the cellular enrichment of MP / aUCP1 ( Fig.10 a). Efficient escape from lysosomes after endocytosis is crucial for gene editing. Fig.10 As shown in Figure b, after 4 hours of incubation, the MP / aUCP1 nanosheets successfully avoided lysosomes, which was mainly attributed to the "proton sponge" effect induced by PEI in MP / aUCP1. Importantly, this endosomal escape effect was more obvious under US irradiation, confirming that US enhanced the genome editing potential of the MP / aUCP1 nanosystem.

[0103] Next, the transfection efficiency of MP / aUCP1 in cells was investigated after US irradiation. A plasmid encoding enhanced green fluorescent protein (pEGFP) was selected as a reporter gene, which is similar in size to the CRISPRa-UCP1 plasmid. FCM analysis showed that MP / aUCP1 transfected more than 50% of 3T3-L1 preadipocytes and mature adipocytes, with a transfection efficiency approximately 3-fold higher than that of P / aUCP1 and comparable to that of Lipofectamine 2000 (aUCP1 group @EGFP) ( Fig.11 In addition, after US irradiation, the cell transfection rate exceeded 60% ( Fig.11 ). Similarly, fluorescence microscopy confirmed consistent results ( Fig.12 ). These results indicate that the MP / aUCP1 system significantly increased US-mediated plasmid transfection.

[0104] Example 4: Preparation and characterization of MN-MP / aUCP1 microneedle patch

[0105] The MN patch was fabricated using a micromolding method, in which a 15% by weight HA solution was mixed with the MP / aUCP1 solution and placed in a polydimethylsiloxane (PDMS) mold. The mold was then vacuum treated, after which a 15% by weight HA solution was placed in the micromold, dried at room temperature, and demolded ( Figure 4 a). Figure 4 b and Fig.13 As shown in a, the MN patch has a size of 1 cm × 1 cm with an array of 12 mn × 12 mn. Each needle is molded into a pyramid shape with a base diameter of 300 μm and a height of 800 μm. The color of the MN loaded with MP / aUCP1 deepened, and the scanning electron microscopy (SEM) image showed that the loaded drug did not affect the successful synthesis of MN ( Figure 4 c, d). The mechanical strength of the patches made from 10wt%, 15wt% and 20wt% HA solutions was determined using a tensile tester ( Figure 4 e). The smooth continuous force-displacement curve indicated that there was no microneedle breakage during the compression process. In addition, the 15wt% MN patch exhibited excellent mechanical properties, which provided sufficient hardness to penetrate the skin compared with the 10wt% HA patch, which had a significantly higher minimum average force required for skin penetration (0.058N) ( Figure 4 e). Hematoxylin and eosin (H&E) staining clearly depicts MNs passing through the epidermis into the dermis ( Figure 4 f). The patch was applied to the skin of the inguinal area of ​​obese mice, and after 15 minutes the MN was completely dissolved in the skin, with no obvious skin irritation or damage at the administration site ( Figure 4 g). Compared with the skin tissue not treated with the patch, no obvious inflammatory reaction was found in the area pressed by the patch ( Fig.13 b).

[0106] MN patches with different amounts of MP / aUCP1 were fabricated and tested, and increasing the MP / aUCP1 content from 50 μg to 200 μg resulted in changes in MN hardness ( Fig.13 Interestingly, the MN patch with 100 μg MP / aUCP1 showed similar mechanical strength to the patch with 50 μg MP / aUCP1 and was able to penetrate the skin smoothly ( Fig.13 C and Fig.13 d). Therefore, MN patches loaded with 100 μg MP / aUCP1 were selected for further study. FCM analysis showed that the cell transfection rate was slightly improved when HA MN patches were used for drug delivery ( Fig.13 e). Figure 4 h shows the fluorescence image of a representative MN patch containing MP / Cy3 and aUCP1-ICG, in which the loaded MP nanosheets and CRISPRa system were evenly distributed inside the MN. In addition, no obvious redness was observed in the MN-MP / aUCP1-treated group after 1 day compared with the control group and MP / aUCP1-injected skin ( Fig.13 f). The biodistribution and WAT targeting ability of the drug-loaded patch were monitored using an in vivo imaging system (IVIS) spectral imaging system. Clearly, in vivo fluorescence imaging confirmed that aUCP1 was preserved for one day without MN encapsulation, while MP-encapsulated aUCP1 injection (InJ) continued to be visible subcutaneously in obese mice until the second day ( Figure 4 MN-MP / aUCP1-treated mice still had a significantly higher fluorescence signal on the third day compared to MN-aUCP1-treated mice ( Figure 4 Analysis of the distribution of ex vivo organs within 3 days after treatment showed that relatively little fluorescence signal remained in organs such as liver, lung, and kidney in all groups. In contrast, mice treated with MN administration showed higher signal intensity in the inguinal WAT (IgWAT) ( Figure 4 k, l and Fig.13 Taken together, these findings suggest that the MN patch improves the long-term retention of MP / aUCP1 in tissues.

[0107] Example 5: In vivo weight loss therapeutic effect of MN-MP / aUCP1 patch

[0108] This example evaluates the potential of drug-loaded patches to treat obesity in mice. To simulate obesity, C57BL / 6J male mice (6-8 weeks old, about 18 g) were fed a high fat diet (HFD) for about 8 weeks until they reached a body weight of about 35 g ( Figure 5a). Considering the abundant WAT in the inguinal region of mice and its superficial location, MN patches were implanted into the IgWAT of mice for anti-obesity treatment. The mice were randomly assigned to six groups, and each group received the following treatments: I) control, II) MN+US, III) MN-aUCP1, IV) MN-MP / aUCP1, V) MN-MP+US, and VI) MN-MP / aUCP1+US. The anti-obesity treatment was divided into 7 courses, with the MN patch applied once every 3 days, and then the inguinal region of the mice was irradiated 15 minutes after the MN patch injection ( Figure 5 a). Food intake and body weight were monitored every three days during the 21-day weight loss treatment. Despite similar high-fat diet intake among the groups of mice, the mice in the control and US-only groups gained 8.2±2.2% (from 34.6±1.0 to 37.4±0.8 g) and 8.3±1.6% (from 34.4±0.8 to 37.3±0.9 g) body weight, respectively. In contrast, the MN-MP / aUCP1+US and MN-MP+US groups lost 18.3%±1.7% and 13.4%±3.2% of their body weight, respectively. Treatment with MN-MP / aUCP1 without US irradiation resulted in a 6.9%±2.1% weight loss in mice, which was similar to that in the MN-aUCP1 group (8.3%±2.3% weight loss) ( Figure 5 b, c and Fig.14 In addition, photographs of mice taken at the end of treatment demonstrated that mice in the MN-MP+US and MN-MP / aUCP1+US groups showed a reduction in body fat and a leaner body shape ( Figure 5 d). The mice were then killed and IgWAT, PgWAT, and PrWAT were dissected out to compare their size and mass. The subcutaneous and visceral WAT in the MN-MP / aUCP1+US group were smaller in volume and lower in mass than in the other groups ( Figure 5 e, f).

[0109] H&E staining of isolated fat further demonstrated that the MN-MP / aUCP1+US treatment regimen significantly reduced the adipocyte size not only in IgWAT but also in PgWAT and PrWAT, indicating that this treatment was not limited to subcutaneous inguinal fat but caused systemic fat loss ( Figure 5 In addition, H&E staining showed that the fat content of the liver of mice treated with ultrasound-gene therapy strategy was significantly reduced compared with the control group and MN+US group ( Figure 5 i), accompanied by a significant reduction in liver size ( Fig.14 b). The corresponding Oil Red O staining demonstrated that the CRISPRa-UCP1 system has the ability to effectively alleviate the complications of fatty liver. The addition of US radiation further enhanced the anti-obesity therapeutic effect ( Figure 5i).

[0110] Furthermore, the combination of MN-MP / aUCP1 and US was found to significantly improve obesity-related metabolic dysfunction in mice. Mice treated with MN-MP / aUCP1+US had lower circulating glucose and insulin levels compared to the control group, leading to significant improvements in insulin resistance and glucose tolerance ( Figure 6 The ac and Fig.14 c). After MN-MP / aUCP1+US treatment, plasma chemical analysis consistently showed a downward trend in TG and cholesterol levels, as well as an increase in free fatty acids (FFA) produced by lipolysis ( Figure 6 These findings suggest that this treatment strategy has the potential to improve overall obesity symptoms.

[0111] In addition, the inventors evaluated the biosafety of this ultrasound-gene therapy strategy. The inventors' anti-obesity treatment regimen did not show any damage to major organs ( Fig.15 The blood routine, cardiac function and serum biochemistry results of mice also proved that the treatment had no potential toxic side effects ( Fig.16 , Fig.17 ). The control groups (control group and MN+US) showed increased circulating amounts of ALT and AST. In contrast, the levels of these enzymes in the other groups remained within the normal range, which may be attributed to the fatty liver symptoms in the control group. Sonodynamic oxidative damage may trigger a strong inflammatory response, further exacerbating obesity-induced liver and adipose tissue fibrosis. To assess the extent of damage, the inventors further measured the levels of serum and adipose inflammatory cytokines and evaluated the degree of fibrosis in the liver and adipose tissue. Fortunately, enzyme-linked immunosorbent assay (ELISA) tests of mouse serum and IgWAT showed that MN-M / aUCP1+US treatment did not stimulate the production of inflammatory cytokines such as IL-1β, IL-6, and TNF-α ( Fig.18 In addition, US radiation did not lead to a significant increase in the degree of liver and adipose tissue fibrosis ( Figure 6 g, h). Therefore, these data indicate that the ultrasound-gene therapy strategy of the present invention has high biosafety.

[0112] Example 6: Monitoring of weight recovery after MN-MP / aUCP1+US treatment

[0113] Weight maintenance after weight loss is a major challenge in obesity treatment. To verify the durability and effectiveness of the US-regulated CRISPRa-UCP1 system for anti-obesity treatment, high fat intake and weight regain of mice were continuously monitored after seven courses of treatment ( Figure 5a). During the 15-day monitoring period, mice in all groups consumed almost equal amounts of food. However, at the end of the observation period, mice in the MN-MP / aUCP1+US group showed the lowest weight gain compared to all other groups ( Figure 6 IK, Fig.18 In summary, the ultrasound-gene therapy strategy effectively reduced the body weight of obese mice and significantly inhibited weight rebound.

[0114] Example 7: Changes in IgWAT molecular levels after MN-MP / aUCP1+US treatment

[0115] In order to better evaluate the efficacy of MN-MP / aUCP1-mediated ultrasound-gene therapy, the inventors studied the role of US-regulated genome editing system at the molecular level in obese mice. Terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) showed that compared with MN-MP+US, apoptotic cells in IgWAT, PgWAT, and PrWAT of mice treated with MN-MP / aUCP1+US increased significantly, with the most significant effect in IgWAT ( Figure 7 a, Fig.19 a). This suggests that apoptosis of adipocytes is largely due to oxidative stress induced by sonodynamic response, which leads to the accumulation of ROS in the cytoplasm and organelles, damaging lipids, proteins and DNA, and ultimately leading to cell death. To demonstrate this, the inventors detected the levels of adipose reactive oxygen species, lipid peroxidation products (malondialdehyde (MDA), 4-hydroxynonenal (4-HNE)) and DNA oxidation products (8-hydroxy-2'-deoxyguanosine (8-OHdG)). As expected, ROS levels were significantly increased in the MN-MP+US group and the MN-MP / aUCP1+US group ( Figure 7 b, Fig.19 b). The levels of major oxidation products also increased, such as Figure 7 ce, indicating that oxidative stress occurred in these two groups after US stimulation.

[0116] Immunofluorescence was used to confirm the overexpression of UCP1 in adipose tissue of mice treated with the CRISPRa system. In contrast to the control group, the expression of UCP1 in IgWAT of mice was increased in the MN-aUCP1, MN-MP / aUCP1, and MN-MP / aUCP1+US groups ( Figure 7 f, Fig.19 c), which was also confirmed by equivalent detection at the mRNA and protein levels ( Figure 7Meanwhile, the results of qPCR and western blot analysis showed that the expression level of PGC1-β in IgWAT of the MN-MP / aUCP1+US group was significantly increased, while the expression level of PPARγ was decreased ( Figure 7 hj). PGC1-β is considered a key regulator of mitochondrial metabolism, while PPARγ, as an indicator of adipogenesis, promotes adipogenesis and lipid synthesis. In addition, IgWAT of PPARα, which is mainly found in brown / beige adipocytes, was also upregulated in the MN-MP / aUCP1+US group ( Fig.19 d). These findings suggest that MN-MP / aUCP1+US treatment not only induces the transformation of white adipocytes into brown-like adipocytes, but also reverses obesity by inhibiting adipogenesis and enhancing metabolism. As expected, ultrasound-gene therapy significantly reduced adipose TG content and increased FFA levels ( Figure 7 k and Fig.19 e). The results of first-generation sequencing showed that the ultrasound-gene editing system only led to stable overexpression of the target gene without gene insertion, deletion or mutation ( Figure 7 Taken together, all the above results indicate that white adipocytes undergo apoptosis and effectively transform into brown-like adipocytes.

Claims

1. A microneedle raw material composition, characterized in that: The invention comprises using mPEG-PEI to modify zinc-porphyrin metal organic framework MOF (Zn-TCPP), and the composition is named MP.

2. The raw material composition according to claim 1, characterized in that The mass ratio of mPEG to PEI is 1:(0.5-5), preferably 1:2; and / or the mass ratio of mPEG-PEI to the MOF is 1:(2-10), preferably 1:

4.

3. The method for preparing the raw material composition according to claim 1 or 2, comprising: The MP is obtained by adding a mixed solution of mPEG and PEI to a zinc-based porphyrin metal organic framework MOF solution.

4. A microneedle, characterized in that: The microneedles are loaded with the raw material composition as claimed in claim 1 or 2; preferably, the microneedles further include 10-20wt% hyaluronic acid, such as 15wt% hyaluronic acid.

5. A method for preparing a microneedle, comprising the following steps: (a) mixing the raw material composition as claimed in claim 1 or 2 with hyaluronic acid and depositing the mixture in the microneedle cavity; (b) continuously filling the microneedle cavity with a hyaluronic acid solution to obtain the microneedle.

6. A microneedle patch, comprising the microneedle and patch according to claim 4; preferably, the content of the microneedle raw material composition in each microneedle patch is 50-200 μg, preferably 80 μg.

7. An acoustic power system, comprising ultrasound, and a platform formed by the raw material composition according to claim 1 or 2 and / or the microneedle patch according to claim 6, wherein the ultrasound is used to irradiate the raw material composition and / or the microneedle patch.

8. The acoustic power system according to claim 7, characterized in that The ultrasonic wave meets one or more of the following conditions: 1.0-3.0MHz; 0.1-3.0W cm -2 For example, 1.5W cm -2 ; and / or, 10%-50% duty cycle, such as 50% duty cycle; The ultrasonic irradiation time is 3-15 min, for example 5 min.

9. Use of the raw material composition according to claim 1 or 2, the microneedle raw material composition obtained by the preparation method according to claim 3, the microneedle according to claim 4, the microneedle patch obtained by the preparation method according to claim 5, the microneedle patch according to claim 6, or the sonodynamic system according to claim 7 or 8 in the preparation of a drug for treating obesity.

10. The use according to claim 9, characterized in that The microneedle raw material composition, the microneedle or the microneedle patch has one or more of the following characteristics: I. promoting the drug to increase the level of ROS in white adipocytes of the subject; II, promoting the drug to increase apoptosis of white fat cells in the subject; III, promoting the drug to reduce the triglyceride storage capacity of the subject's white fat cells; IV, promoting the drug to reduce fat in the subject's IgWAT, PgWAT, and PrWAT; V. Promoting the drug to improve glucose tolerance and insulin resistance in a subject.

Images