Application of APP in nonalcoholic steatohepatitis

Abstract

The present invention discloses an application of APP in non-alcoholic fatty hepatitis, specifically including the application of APP in the preparation of NASH detection reagents and the application of APP in the preparation of NASH therapeutic drugs. Changes in APP expression have a regulatory effect on NASH. If the therapeutic drug contains an APP small interfering siRNA sequence, the expression of APP in the liver can be downregulated, and the fatty changes in the liver of NASH can be alleviated. The present invention also discloses a method for constructing a NASH animal model, in which the APP gene is knocked out, and it is intended to solve and make up for the deficiencies of the existing technology in the detection and treatment research of the occurrence and development of NASH and the role and evaluation method of APP. The present invention provides a research method and application of APP in NASH, which is convenient for in-depth analysis of the role of APP in NASH. At the same time, the application of this technical solution facilitates the elucidation of the mechanism of action of APP and provides a new perspective for the study of APP.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to the application of APP in non-alcoholic fatty liver disease, including the use for preparing detection reagents, therapeutic drugs and constructing NASH animal models. Background Art

[0002] Non-alcoholic fatty liver disease (NAFLD) is one of the most common chronic liver diseases in clinical practice, with a global prevalence of approximately 32.4%, and it is showing an increasing trend year by year. In 25% of patients, NAFLD progresses to non-alcoholic steatohepatitis (NASH), and approximately 30% of NASH patients eventually develop liver fibrosis, cirrhosis, and even hepatocellular carcinoma. The development of NASH-related liver cancer is usually hidden, and patients may not have obvious symptoms in the early stages. Once discovered, it is often in the late stages. Therefore, early detection and intervention of NASH are crucial for the prevention of liver cancer. However, there is still a lack of specific treatments for NASH, and there is an urgent need to understand the pathogenesis of NASH and identify new therapeutic targets.

[0003] Amyloid precursor protein (APP) is a multifunctional transmembrane protein encoded by the APP gene located on human chromosome 21q21.3. After hydrolysis, APP generates an amyloid peptide chain (amyloidβ, Aβ) consisting of 40 to 42 amino acids, so it is called amyloid precursor protein. APP is mainly expressed in the central nervous system, and the aggregation of Aβ peptides generated by it in the brain is one of the main pathogenic factors of Alzheimer's disease. Although APP is highly expressed in the brain and regulates neuronal metabolism, it is also widely distributed in peripheral tissues such as adipose tissue, liver, muscle, and pancreas, and participates in the metabolic processes of these tissues. Studies have shown that the body weight of APP gene knockout mice is 15-20% less than that of the control group. At the same time, APP expression is upregulated in the adipose tissue of obese mice, and overexpression of APP can aggravate the occurrence of obesity, which indicates that APP may play an important role in obesity and related metabolic diseases. Since the occurrence and development of obesity and NASH are closely related, whether APP is associated with NASH deserves further exploration.

[0004] This technical solution proposed for the first time that APP may be associated with NASH, and through preliminary experiments, it was found that in animal and cell models of NASH, the expression of APP increased significantly, suggesting that it may play a regulatory role in NASH. At the same time, in human specimens of NASH, the expression level of APP protein in the liver tissue of NASH patients was significantly increased compared with the liver tissue of healthy people, suggesting that it may play a regulatory role in NASH. The present invention generates APP gene-deficient mice through gene knockout technology, and uses this model to study the occurrence and progression of NASH, which helps to reveal the potential pathogenic mechanism of APP in NASH. This study provides a new perspective for exploring new NASH treatment methods, has important scientific research and clinical application value, and may bring significant social and economic benefits.

[0005] The CRISPR-Cas9 system has become one of the most effective gene editing tools due to its wide adaptability, simple operation and rapid vector construction. The Cas9 protein contains two nuclease domains that can cut the DNA double strands separately to form double-strand breaks. In this process, Cas9 combines with crRNA and tracrRNA to form a complex, recognizes and binds to the PAM sequence (5'-NGG-3') on the target DNA, and then achieves precise DNA cutting. Due to the simple structure of the PAM sequence and the small restrictions on sequence selection, CRISPR-Cas9 is widely used in gene knockout experiments in various model organisms, including mammalian cells, bacteria, yeast, plants and fish. In gene function research, the CRISPR-Cas9 system has been widely used in the construction of disease models and the study of functional genes. Therefore, this protocol uses this technology to construct APP gene knockout mice and use them for NASH research. Summary of the invention

[0006] The purpose of the present invention is to provide the application of APP in non-alcoholic steatohepatitis (NASH) and the construction of a NASH animal model.

[0007] To achieve the above objectives, the technical solution of the present invention is as follows:

[0008] In a first aspect, an application of APP in the preparation of a NASH detection reagent is disclosed, wherein the NASH detection reagent uses APP as a detection target.

[0009] Furthermore, the NASH detection reagent comprises the sequences shown in SEQ ID NO.7 and SEQ ID NO.8.

[0010] In a second aspect, the present invention provides the use of APP in the preparation of a NASH therapeutic drug, wherein the NASH therapeutic drug comprises APP small interfering siRNA for downregulating the expression level of APP.

[0011] Furthermore, the NASH therapeutic drug comprises the sequence shown in SEQ ID NO.9.

[0012] In a third aspect, the present invention relates to a method for constructing a NASH animal model, in which the APP gene is knocked out.

[0013] Furthermore, the knockout position of the APP gene is the position of the second exon.

[0014] Furthermore, the animal model evaluation method includes comprehensive evaluation based on body weight, serological indicators, insulin resistance, oil red staining, histological characteristics, etc.

[0015] Furthermore, gene knockout was performed by targeting the second exon of the APP gene using specific sgRNA.

[0016] Furthermore, the specific sgRNA sequence is shown in SEQ ID NO.1.

[0017] Furthermore, the detection primer sequence near the target site of the second exon is shown as SEQ ID NO.3-6.

[0018] Furthermore, the animal model is used in NASH research.

[0019] Furthermore, the animal model is used in APP research.

[0020] Fourthly, a specific sgRNA is disclosed that specifically targets the mouse APP gene.

[0021] Furthermore, the sgRNA targeting sequence is shown in SEQ ID NO.1.

[0022] Furthermore, the PCR detection primer sequence near the sgRNA target site is shown in SEQ ID NO.3-6.

[0023] The present invention has the following beneficial effects:

[0024] The present invention studies non-alcoholic fatty liver disease, constructs and applies a NASH mouse model in the context of APP gene deletion, and solves and makes up for the deficiencies of the existing technology in the detection and treatment research of NASH occurrence and development on the role and evaluation method of APP. The detection confirmed that the model construction achieved the ideal effect and provided its application in NASH research. The present invention provides a research method for APP in NASH, which is convenient for in-depth analysis of the role of APP in NASH. At the same time, the application of this technical solution facilitates the elucidation of the mechanism of action of APP and provides a new perspective for APP research. On the other hand, the present invention also provides the application of APP in the detection, efficacy evaluation, drug development and potential pathogenesis research of non-alcoholic fatty liver disease. The present invention is of great value. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is the NASH model evaluation result diagram, where: Figure 1 A is a graph showing the results of the body weight assessment of NASH model mice; Figure 1 B is the result of serum triglyceride measurement in NASH model mice; Figure 1 C is the result of liver triglyceride measurement in NASH model mice; Figure 1 D is the result of serum alanine aminotransferase measurement in NASH model mice;

[0026] Figure 1 E is the result of serum aspartate aminotransferase assay in NASH model mice; Figure 1 F is the result of glucose tolerance experiment in NASH model mice; Figure 1 G is the result of H&E staining of liver in NASH model mice; Figure 1 H is the result of oil red staining of liver of NASH model mice; Figure 1 I is the result of Sirius red staining of liver in NASH model mice;

[0027] Figure 2 Design diagram for APP-Cas9-KO mouse strategy;

[0028] Figure 3 Transcript for APP;

[0029] Figure 4 This is a diagram of the activity detection results of saCas9 / gRNA;

[0030] Figure 5 It is a method for identifying genes in APP-Cas9-KO mice;

[0031] Figure 6 This is the detection diagram of APP gene expression in the liver of gene knockout mice;

[0032] Figure 7This is the evaluation result diagram of NASH model in APP gene knockout mice, where: Figure 7 A is a graph showing the results of body weight assessment of APP gene knockout mice in the NASH model; Figure 7 B is the result of triglyceride measurement in liver of APP gene knockout mice NASH model mice; Figure 7 C is the result of serum alanine aminotransferase assay in APP gene knockout mice NASH model; Figure 7 D is the result of serum aspartate aminotransferase assay in APP gene knockout mice NASH model; Figure 7 E is the result of glucose tolerance experiment in APP gene knockout mice NASH model mice; Figure 7 F is the result of H&E and Oil Red staining of the liver of APP gene knockout mice NASH model mice;

[0033] Figure 8 Figure 2 is a graph showing changes in APP expression in NASH animal and cell models, where: Figure 8 A shows the expression changes of APP in the liver of NASH mice compared with healthy mice. Figure 8 B shows the expression changes of APP in NASH cell model;

[0034] Fig. 9 This is the result of the gene chip data mining analysis in the NCBI gene expression database, where: Fig. 9 A is the expression change of APP in the liver of patients with type 2 diabetes compared with healthy people. Fig. 9 B shows the expression changes of APP in the liver of NAFLD patients compared with healthy subjects;

[0035] Fig.10 Schematic diagram of the effect of upregulating APP expression on NASH; Fig.10 A is the knockout efficiency verification of small interfering siRNA, Fig.10 B is the quantitative analysis of intracellular triglyceride after knocking out APP. Fig.10 C is the result of Oil Red staining after knocking out APP in cells. DETAILED DESCRIPTION

[0036] The present invention constructs a method for constructing an APP gene knockout animal model in NASH and its application. The application of APP in the preparation of NASH detection reagents and therapeutic drugs also belongs to the protection scope of the present invention. The application of the NASH model based on the APP gene knockout background and the NASH gene knockout mouse model also belongs to the protection scope of the present invention. The technical scheme in the present invention is clearly and completely described below in conjunction with the embodiments. The following examples will help those skilled in the art to further understand the present invention, but do not limit the present invention in any form. It should be pointed out that for those of ordinary skill in the art, several adjustments and improvements can be made without departing from the concept of the present invention. These all belong to the protection scope of the present invention.

[0037] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from conventional biochemical reagent stores unless otherwise specified, and Oil Red O is purchased from Nanjing Jiancheng Company. Statistical methods: SPSS11.5 statistical analysis software was used for analysis, and the comparison of the mean of each sample was analyzed by Student t test, P<0.05 was considered statistically significant, *P<0.05, **P<0.01, ***P<0.001.

[0038] Example 1: NASH animal model based on APP gene knockout background.

[0039] The method for constructing an APP gene knockout animal model in NASH is achieved by the following steps:

[0040] Step 1: Establish NASH animal model;

[0041] Step 2: Construct an APP gene knockout animal model;

[0042] Step 3: NASH animal model based on APP gene knockout background;

[0043] Step 4: Verify the successful construction of the APP gene knockout animal model in NASH.

[0044] The details are as follows:

[0045] Step 1-1: 8-week-old wild-type C57BL / 6J mice were randomly divided into the following groups:

[0046] Normal diet group (SCD): wild-type C57BL / 6J mice, normal drinking water, normal diet;

[0047] Western diet group (WDSW): Wild-type C57BL / 6J mice, high-sugar drinking water, for 24 weeks.

[0048] The high-sugar drinking water was prepared as follows: 23.1 g fructose + 18.9 g glucose dissolved in 1 L ultrapure water. The Western diet feed used was purchased from Harlan Company, USA, item number 120528, which contained 21.1% fat, 41% sucrose and 1.25% cholesterol.

[0049] Step 1-2: NASH model evaluation

[0050] Each group was fed according to the plan, and experiments (1)-(3) were carried out during the feeding period. After feeding to the planned modeling time, the mice were euthanized, and liver tissue samples and blood samples were taken from each group for experiments (4)-(7).

[0051] (1) Weigh your body every other week and record the trend of weight changes.

[0052] (2) Glucose tolerance test (GTT)

[0053] One week before collecting samples, a glucose tolerance test was performed to detect the level of insulin resistance in the liver. The mice in each group were fasted for 16 hours and allowed to drink water normally. The mice were weighed and intraperitoneally injected with 0.1 mg / 10 g of glucose solution prepared with normal saline according to their weight. Blood sugar was measured at 0, 15 min, 30 min, 60 min, 90 min, and 120 min.

[0054] (3) Serum biochemical index testing.

[0055] Blood was collected from the eye sockets, and serum was separated to detect serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels, as well as serum triglyceride (TG) content.

[0056] (4) Oil Red O staining

[0057] Take a small piece of frozen liver tissue, cut 8 μm thick liver tissue slices with a freezing slicer, stain with diluted Oil Red O staining solution (stock solution: ddH20 = 5:2, filtered) for 15 minutes, wash with distilled water for 15 to 30 seconds. Stain with hematoxylin for 5 minutes, wash with water for 30 to 60 seconds. Observe under a microscope after sealing.

[0058] (5) Tissue triglyceride determination

[0059] The operation was performed according to the instructions of the triglyceride determination kit. Specifically, a small piece of mouse liver tissue was weighed into a 2 ml centrifuge tube, 500 μl of lysis solution was added, and the mixture was homogenized and lysed using a tissue grinder (with magnetic beads added) or a grinding rod until the mixture was evenly mixed to obtain a mixed solution. After centrifugation at 4°C and 12000 rpm for 15 min, 50 μl of the supernatant was taken and the protein content was determined using the BCA protein quantification kit. The remaining mixed solution was heated at 70°C for 10 min, centrifuged at room temperature at 2000 × g for 5 min, and the supernatant was used for enzymatic determination. In a 96-well ELISA plate, the standard and the sample to be tested were mixed with the working solution according to the volume shown in the table in the instructions. After reacting at 37°C for 10 min, the sample was detected at a wavelength of 570 nm using an ELISA reader. The data was analyzed using Excel, and the triglyceride content was corrected per mg protein concentration in combination with the protein concentration.

[0060] (6) H&E staining of liver tissue

[0061] Fresh liver tissue was taken, washed with pre-cooled saline, fixed with 4% paraformaldehyde for more than 24 hours, dehydrated in an automatic dehydrator, and then embedded in paraffin and sliced. The slices were placed in a 60°C drying machine for 2 hours before staining. Dewaxed with xylene, dehydrated with gradient alcohol, stained with hematoxylin for 5-15 minutes, rinsed with running water, and the excess stain on the slide was washed off; 1× PBS solution was used to turn blue, 1% hydrochloric acid alcohol was used for color separation for 1-3s, and rinsed with running water for 15-30 minutes; washed with distilled water for 2s; stained with 0.1-0.5% eosin for 1-5 minutes, and washed with distilled water for 2s. Dehydrated with gradient alcohol, xylene was transparent, neutral resin was added, and coverslips were added for sealing. After drying naturally, the slides were observed under a microscope.

[0062] (7) Sirius red staining of liver tissue

[0063] The liver tissue was fixed, dehydrated, paraffin-embedded, and cut into 4-5 micron thick sections. Then, the sections were dewaxed and hydrated, and then immersed in 0.1% Sirius red staining solution for 30-60 minutes. After staining, the sections were rinsed, dehydrated, transparentized, and sealed. Finally, the birefringence of collagen fibers was observed under a polarizing microscope to assess the degree of liver fibrosis.

[0064] According to Figure 1 The evaluation results shown in the figure showed that mice fed with WDSW + high-sugar drinking water for 24 weeks showed significant NASH symptoms: the mice's hair became more shiny, their movements became slower, and their weight increased significantly ( Figure 1 A); liver and serum TG levels in model mice were significantly higher than those in SCD mice ( Figure 1 B, 1C); The serum ALT and AST levels of model mice were significantly higher than those of SCD mice, indicating liver damage ( Figure 1 D, 1E); GTT test results showed that the glucose tolerance of the model group mice was weakened and they had insulin resistance ( Figure 1 F); H&E sections under light microscopy showed diffuse hepatocyte fatty degeneration in the model mice, mixed fatty degeneration with mainly vesicular fatty degeneration, and hepatocyte inflammatory manifestations ( Figure 1 G); Oil red O staining of frozen sections showed that NASH mice had a large amount of lipid deposition ( Figure 1 H); Sirius red staining showed that NASH mice had a large amount of fiber deposition ( Figure 1 I). Compared with WDSW feeding + high-sugar drinking water for 24 weeks, mice fed with 16 weeks did not develop significant fatty liver changes; mice fed with 32 weeks had excessive liver steatosis and inflammation, and severe liver damage, which affected the survival of the mice and was not conducive to the experiment. This was also different from the common human fatty liver state.

[0065] In summary, mice fed WDSW for 24 weeks showed significant NASH manifestations that were closer to human non-alcoholic fatty liver disease. A stable NASH model was successfully constructed, and this model construction method was used in subsequent studies.

[0066] Step 2-1: Design the mouse APP gene CRISPR target and select a highly active gRNA target.

[0067] According to the protein conserved region and genomic structure of the target gene APP, the CRISPR target was designed on exon2 or exon3 of the transcription product APP-201. See the schematic diagram for details. Figure 2 , transcript available at Figure 3 .

[0068] According to the target, the CRISPR target sequence of the corresponding Cas9 is designed as follows:

[0069] sequence name sequence PAM APP-e2gRNA1 TACTATAGTTTTGGATGGTGC(SEQ ID NO.1) AGG APP-e3gRNA1 ATCATAGTCAGCCACCTGTG(SEQ ID NO.2) GGG

[0070] The saCas9 / gRNA target efficiency detection kit was used to detect the gRNA target activity of OFM4. The kit was purchased from Beijing Weishanglide Biotechnology Co., Ltd., catalog number: VK012. Figure 4 As shown, according to the activity results of DNA shearing, the gRNA with the highest activity was selected, namely the gRNA targeting APP-e2gRNA1, TACTATAGTTTGGATGGTGC (SEQ ID NO.1).

[0071] Step 2-2: Construction of App gene knockout mice by microinjection

[0072] The selected gRNA was used to construct the corresponding gRNA plasmid, which was transcribed into RNA in vitro and injected into mouse fertilized eggs together with Cas mRNA. The embryos were then transferred to a culture dish containing M16 culture medium and recovered in a 37°C, 5% carbon dioxide incubator for 1 hour before being transferred to recipient mice.

[0073] Step 2-3: Obtain F0 generation App gene knockout mice.

[0074] F0 mice were born about 20 days after transplantation. Genotype analysis and identification were performed on the F0 mice after 2 weeks of age to obtain F0 App gene knockout mice.

[0075] Step 2-4: F0 positive mice are mated with wild-type mice to obtain F1 heterozygous mice that are positive for PCR and sequencing:

[0076] Gene identification methods such as Figure 5 :

[0077] Wild type: ①PCR reaction obtains a single WT band; ②PCR reaction obtains a single WT band.

[0078] Heterozygote: ①PCR reaction obtains one WT band and one KO band; ②PCR reaction obtains one WT band.

[0079] Homozygous: ① One KO band is obtained by PCR reaction; ② No band is obtained by PCR reaction.

[0080]

[0081] Step 2-5: Select F1 mice with the same genotype from the same F0 mouse, and mate them after reaching sexual maturity to obtain F2 mice. Perform the above PCR identification on the obtained F2 mice, and 25% of the F2 mice are homozygous, 50% are heterozygous, and 25% are wild mice. Perform claw clipping identification at 2 weeks of age, and only retain homozygous F2 male and female mice. Mate them after sexual maturity to obtain APP gene knockout homozygous mouse strains.

[0082] Step 3-1: Grouping.

[0083] Eight-week-old wild-type C57BL / 6J mice and APP(- / -) knockout homozygous mice were randomly divided into the following groups:

[0084] Normal control group (WT SCD): wild-type C57BL / 6J mice, normal drinking water, normal diet

[0085] Western diet group (WT WDSW): Wild-type C57BL / 6J mice, high-sugar drinking water, for 24 weeks

[0086] Western diet group (KO WDSW): APP(- / -) mice, high-sugar drinking water, for 24 weeks

[0087] Preparation of high-sugar drinking water: 23.1g fructose + 18.9g glucose dissolved in 1L ultrapure water.

[0088] Western diet feed formula: purchased from Harlan Company, USA, item number 120528, the feed contains 21.1% fat, 41% sucrose and 1.25% cholesterol.

[0089] Step 3-2: Divide the groups into groups according to the steps 2-6, feed each group with different feeds and then evaluate after 24 weeks of feeding.

[0090] Step 4-1: APP gene knockout animal model verification

[0091] Liver tissue samples of APP gene knockout homozygous mice and wild-type C57BL / 6J mice were taken, tissue RNA was extracted, and PCR was used to detect the APP content in the liver. The primer sequences required for the detection were as follows: F (SEQ ID NO.7): TCCGAGAGGTGTGCTCTGAA, R (SEQ ID NO.8): CCACATCCGCCGTAAAAGAATG The results were as follows Figure 6 As shown. APP was successfully knocked out in the liver of APP(- / -) gene knockout homozygous mice, and the gene knockout did not affect the survival status of the mice. The strain was stable and inherited, and the APP gene knockout animal model was successfully constructed.

[0092] Step 4-2: Assessment of liver steatosis. The assessment method is as described in step 1-2, and the results are as follows: Figure 7 The results showed that after 24 weeks of WDSW feeding + high-sugar drinking water, the body weight of the WDSW feeding + high-sugar drinking water group increased significantly compared with the normal diet, and the body weight of the KO WDSW feeding + high-sugar drinking water group increased more slowly than that of the WT WDSW feeding + high-sugar drinking water group ( Figure 7 A);

[0093] The TG content in the liver of KO WDSW-fed + high-sugar drinking water mice increased more slowly than that of WT WDSW-fed + high-sugar drinking water mice ( Figure 7 B); The serum ALT and AST levels of KO WDSW-fed + high-sugar drinking water mice were significantly lower than those of WT WDSW-fed + high-sugar drinking water mice, indicating that APP knockout alleviated liver damage ( Figure 7 C, 7D); GTT experimental results showed that compared with the WT WDSW-fed + high-sugar drinking water group mice, the KO WDSW-fed + high-sugar drinking water group mice had stronger glucose tolerance ( Figure 7 E); H&E staining and oil red staining results showed that WT WDSW-fed + high-sugar drinking water mice had more obvious lipid deposition ( Figure 7 F).

[0094] The above results show that the NAFLD model based on the APP gene deletion background was successfully established. In NAFLD, APP gene knockout alleviates liver steatosis and damage induced by Western diet. The specific mechanism can be studied in depth through this model. It can be seen that the construction of a non-alcoholic fatty liver animal model based on the APP gene deletion background plays an important role in the treatment and mechanism research of NAFLD, and provides a new direction for the study of the role of APP.

[0095] Example 2: Application of APP as a target for NASH detection.

[0096] Step 1: After 24 weeks of high WDSW feeding + high sugar drinking water, C57BL / 6J mice in step 1 of Example 1 were subjected to extraction of liver tissue RNA, and qPCR was used to detect the expression of APP mRNA in mouse liver. The primer sequences required for the detection were as described in SEQ ID NO.7 and SEQ ID NO.8. The results are shown in Figure 8 As shown in A, the expression of APP in the liver of mice fed WDSW + high-glucose drinking water was significantly upregulated at the transcriptional level.

[0097] Step 2: Mouse liver cell line AML12 cells (purchased from Shanghai Cell Bank, Chinese Academy of Sciences) were subcultured in DME / F12 medium (purchased from Gibco, USA) containing 10% calf serum and 1% penicillin-streptomycin until the cells reached 70% to 80% confluence.

[0098] Step 3: Stimulate cells with palmitic acid (PA) to construct a NASH cell model. The preparation method of palmitic acid is as follows: PA and fetal bovine serum albumin are ultrasonically dissolved in a ratio of 3:1 (v / v), sterile filtered, and added to DME / F12 culture medium. Use Oil Red O staining or detect TG content to evaluate the model construction. Palmitic acid was purchased from Sigma-Aldrich, USA.

[0099] Step 4: After 24 hours, cells were collected, cell RNA was extracted, and qPCR was used to detect the expression level of APP mRNA in AML12 cells. The primer sequences required for the detection were as described in SEQ ID NO.7 and SEQ ID NO.8. The results are shown in Figure 8 As shown in B, in the NASH cell model established by stimulating mouse liver cell line AML12 cells with palmitic acid for 24 hours, the expression of APP mRNA was significantly increased compared with the control cells.

[0100] Step 5: In order to confirm the expression changes of APP in metabolic diseases, the present invention uses the Gene expression Omnibus dataset to evaluate its expression level in human liver samples. The present invention compares the expression of differentially expressed genes in liver biopsy samples of healthy people and patients with type 2 diabetes (GSE23343). The chip data results show that the expression level of APP in the liver of patients with type 2 diabetes is significantly higher than that of healthy people ( Fig. 9 A). In addition, the present invention also analyzed the differences in gene expression in liver biopsy specimens of healthy people and patients with NAFLD at different stages (GSE48452). Their chip data more directly showed that the expression level of APP in the liver of NAFLD patients was significantly higher than that of the control group ( Fig. 9 B).

[0101] The above results show that APP is upregulated in the liver of NASH mouse model and mouse hepatocyte NASH model, and may be related to human obesity and metabolic diseases, suggesting that changes in APP expression are related to NASH. Including the APP sequence as a detection target in the NASH detection reagent is helpful for the detection of NASH.

[0102] Example 3: Application of APP in the preparation of NASH therapeutic drugs

[0103] Step 1: Construct APP small interfering siRNA, including APP gene sequence, SEQ ID NO.9: GATTCAAGATGAAGTCGAT.

[0104] Step 2: Take AML12 cells cultured in DME / F12 medium, spread them on a 6-well plate, and culture the cells overnight until each well grows to about 50%-60%;

[0105] Step 3: Prepare the transfection solution according to the instructions of the lipo3000 transfection kit, and transfect APP small interfering siRNA and negative control into the experimental and control AML12 cells respectively. Change to normal culture medium 6 hours after transfection, and change to 200uM PA working solution 24 hours later for stimulation for 24 hours.

[0106] Step 4: After 24 hours, cells were collected and cell RNA was extracted. qPCR was used to detect the expression level of APP mRNA in AML12 cells. The primer sequences required for the detection were as described in SEQ ID NO.7 and SEQ ID NO.8. The results were as follows: Fig.10 As shown in A.

[0107] Step 5: Collect cells after 24 hours for cell TG detection. Use a TG determination kit (purchased from Beijing Pulilai Co., Ltd.) and a spectrophotometer to detect intracellular TG concentration according to the GPO Trinder enzymatic reaction principle. First, add different concentrations of TG standards in the kit to the TG working solution, and then use spectrophotometry to detect the absorbance value at 570nm (OD570) and draw a TG concentration standard curve. Add triglyceride detection lysate to the cells to be tested, 100μL for each sample, ice bath for 20 minutes, take half of the lysate for protein concentration determination, and the remaining lysate is bathed in 70℃ water for 10 minutes, centrifuged at 2000 rpm at room temperature for 5 minutes, take the supernatant and add TG working solution to detect the OD570 value, and obtain the TG concentration according to the standard curve. The sample protein content is used to calibrate the TG content in the test. The results are as follows: Fig.10 As shown in B.

[0108] Step 6: After 24 hours of PA stimulation, cells were collected and stained with Oil Red O. The cells were stained with diluted Oil Red O dye solution (stock solution: ddH20 = 5:2, filtered) for 15 minutes and washed with distilled water for 15 to 30 seconds. Hematoxylin staining was performed for 5 minutes and washed with water for 30 to 60 seconds. After sealing, the cells were observed under a microscope. The results were as follows: Fig.10 As shown in C.

[0109] like Fig.10 The results show that downregulating APP expression with small interfering siRNA can significantly reduce PA-induced fatty degeneration in AML12 cells. The above results suggest that changes in APP expression have a regulatory effect on NASH. If the therapeutic drug contains an APP small interfering siRNA sequence, it can downregulate liver APP expression and alleviate NASH liver fatty degeneration.

Claims

1. Application of APP in the preparation of NASH detection reagents, characterized in that: The NASH detection reagent uses APP as a detection target.

2. The use according to claim 1, characterized in that: The NASH detection reagent comprises the sequences shown in SEQ ID NO.7 and SEQ ID NO.

8.

3. The use of APP in the preparation of NASH therapeutic drugs, characterized in that: The NASH therapeutic drug comprises APP small interfering siRNA, which is used to downregulate the expression level of APP.

4. The use according to claim 3, characterized in that: The NASH therapeutic drug comprises the sequence shown in SEQ ID NO.

9.

5. A method for constructing a NASH animal model, characterized in that: The APP gene was knocked out in this animal model.

6. The method for constructing an animal model according to claim 5, characterized in that: The knockout position of the APP gene is the position of the second exon.

7. The method for constructing an animal model according to claim 6, characterized in that: Gene knockout was achieved by targeting the second exon of the APP gene using specific sgRNA.

8. The method for constructing an animal model according to claim 7, characterized in that: The specific sgRNA targeting sequence is shown in SEQ ID NO.

1.

9. The method for constructing an animal model according to claim 5, characterized in that: The detection primer sequences near the target site of the second exon are shown in SEQ ID NO.3-6.

Images