A non-glutamate-dependent poly-γ-glutamate high-yielding strain of Bacillus paralicheniformis and its application

Abstract

The present invention uses gene knockout technology to construct a high-yield poly (γ-glutamic acid) (γ-PGA) engineered strain of Bacillus paralicheniformis that is independent of exogenous glutamate addition. By seamlessly knocking out the carbon metabolism repressor protein A gene on the genome of Bacillus paralicheniformis 285-3, which regulates carbon metabolism, ccpA , enabling the strain to enhance carbon metabolism pathways, increase the synthesis of the substrate glutamate, and ultimately enhance the synthesis of γ-PGA. The engineered Bacillus paralicheniformis strain constructed using this technology significantly increased γ-PGA production, paving the way for the subsequent use of this engineered strain to produce γ-PGA in a manner independent of exogenous glutamate addition. Compared to the starting strain 285-3, its γ-PGA production rate is higher, effectively saving costs such as labor, energy, and equipment usage and loss, thereby further reducing the production cost of γ-PGA.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and particularly relates to an engineered bacterium of a non-glutamate-dependent poly-gamma-glutamate high-yielding strain Bacillus paralicheniformis and application thereof. Background Art

[0002] Poly-γ-glutamic acid (γ-PGA) is formed by the condensation of glutamic acid monomers through α-amino and γ-carboxyl groups. The molecule can form numerous hydrogen bonds, resulting in excellent water solubility. Furthermore, it contains a large number of free carboxyl groups. Safety evaluations have shown that poly-γ-glutamic acid is non-toxic and has good biocompatibility. In vivo, γ-PGA is synthesized non-ribosomally and is resistant to common proteases. However, the amide bonds are easily degraded by γ-PGA-degrading enzymes into short peptides or glutamic acid, making it biodegradable. γ-PGA is a water-soluble anionic polymer with properties such as moisture retention, film-forming properties, high water absorption, biodegradability, fiber-forming properties, biocompatibility, edibility, and strong adsorption. It holds significant application potential and value in agriculture, food, medicine, cosmetics, and environmental protection.

[0003] Microbial fermentation is the primary method for producing γ-PGA, and the strains used in production are all Bacillus strains. Microorganisms that synthesize γ-PGA are categorized as either glutamate-dependent or glutamate-independent, depending on whether they rely on exogenous monosodium glutamate. The former requires the addition of high concentrations of monosodium glutamate to the culture medium, but this is expensive. The latter does not require exogenous monosodium glutamate, but γ-PGA yields are low, and few glutamate-independent strains have been reported. Glutamate-independent γ-PGA-producing strains rely on their ability to synthesize glutamate de novo. De novo glutamate synthesis generally refers to the formation of glutamate from a carbohydrate carbon source, such as glucose. Glucose undergoes the glycolysis pathway (EMP pathway) to produce pyruvate. Pyruvate then forms acetyl-CoA, which enters the tricarboxylic acid cycle (TCA cycle) to produce α-ketoglutarate. α-ketoglutarate is then converted to glutamate through the catalysis of aminotransferases or glutamate dehydrogenase / glutamate synthetase. The synthesized glutamate is polymerized and transported by the γ-polyglutamate synthetase multienzyme system, ultimately forming γ-PGA. The TCA cycle is crucial for glutamate synthesis because it provides sufficient ATP, reducing power, and α-ketoglutarate.

[0004] Central carbon metabolism primarily consists of the glycolysis pathway and the TCA cycle. Enhancing central carbon metabolism can increase γ-PGA yield, thereby boosting γ-PGA production. Central carbon metabolism, from the EMP pathway to the TCA cycle, is regulated by multiple regulatory proteins, such as CcpA, which in turn influences the synthesis of glutamate and γ-PGA. CcpA (catabolite control protein A) is a global regulator of carbon catabolism. Through carbon catabolism repression (CCR) and activation (CCA), it balances carbon metabolism with energy metabolism to maximize carbon utilization. In the presence of a preferred carbon source, such as glucose, Bacillus has both CcpA-dependent and CcpA-independent carbon catabolism pathways. The CcpA-dependent carbon catabolism pathway operates through a complex formed by the seryl-phosphorylated HPr protein and CcpA protein, binding to the catabolite response element (cre) of the target operon. Studies have shown that CcpA protein promotes glycolysis but inhibits the flow of carbon metabolism to the TCA cycle, which reduces the synthesis rate of intracellular glutamate and the production of γ-PGA. When glucose is present, CcpA can activate the expression of operons such as glm and espA-O, thereby promoting the synthesis of polysaccharides. In order to convert more substrates into the required γ-PGA, ccpA Gene knockout is an effective approach.

[0005] γ-PGA, a high-molecular-weight polymer of glutamate, is an emerging green bioproduct with broad application prospects in numerous areas of production and life. However, the current high cost of producing γ-PGA by microbial fermentation has been a major factor limiting its widespread application. Bacillus paralicheniformis is a new species isolated from the genus Bacillus in 2015. This invention uses the glutamate-independent Bacillus paralicheniformis 285-3, which has the potential to produce high γ-PGA, as a starting strain. This strain is modified from the perspective of central carbon metabolism, aiming to redirect central carbon metabolism toward γ-PGA synthesis, thereby increasing the yield and efficiency of poly-γ-PGA and effectively reducing production costs, laying the foundation for the industrialized production and application of γ-PGA. The starting strain used was the glutamate-independent γ-PGA high-producing strain Bacillus pseudolicheniformis 285-3, which was screened from the arid soil of the Loess Plateau in Luliang, Shanxi Province, as mentioned in the article "Screening of γ-polyglutamic acid high-yielding strains and study on the effect of improving acidified tobacco-growing soil". Summary of the Invention

[0006] The purpose of the present invention is to construct an engineered strain of Bacillus paralicheniformis that produces high γ-PGA without relying on exogenous addition of glutamate substrate. ccpA The knockout strain was named 285-3Δ ccpA strains.

[0007] Strain 285-3Δ ccpA After 36 h of shake flask fermentation in a fermentation medium without glutamate, the γ-PGA yield was 46.43 g / L, while the γ-PGA yield of the starting strain 285-3 was 38.63 g / L. ccpA The γ-PGA yield of 285-3 was 20.19% higher than that of 285-3. In a 10 L fermenter, the stirring speed was 500 rpm, the fermentation temperature was 37℃, the ventilation volume was 8 L / min, the initial pH of the fermentation was 7.0, the fermentation system was 7 L, and the inoculation size was 3%. Under these conditions, 285-3Δ ccpA The γ-PGA production of the strain in glutamate-free fermentation medium was 63.86 g / L after 41 h.

[0008] In order to solve the above-mentioned technical problems, the purpose of the present invention is achieved as follows:

[0009] The present invention relates to a non-glutamate-dependent poly-γ-glutamate high-yielding strain of Bacillus paralicheniformis engineered bacteria, which knocks out the ccpA gene, named 285-3Δ ccpA , deposited in China Center for Type Culture Collection, with the deposit number CCTCC M 20242408, and the deposit date is October 31, 2024;

[0010] The engineered bacillus paralicheniformis bacteria produces poly-gamma-glutamic acid by fermentation in a culture medium without exogenous glutamic acid.

[0011] The present invention also relates to the use of an engineered strain of non-glutamate-dependent poly-gamma-glutamate high-yielding strain Bacillus paralicheniformis in the production of poly-gamma-glutamate by fermentation in a culture medium without exogenous glutamate.

[0012] By homologous recombination technology, the gene involved in carbon metabolism regulation in the genome of Bacillus paralicheniformis 285-3 strain was transformed into ccpA Gene knockout was performed to obtain the corresponding engineered strain.

[0013] Homologous recombination gene knockout technology includes the following steps:

[0014] 1) Cultivate the 285-3 strain and extract genomic DNA from the cells;

[0015] 2) PCR amplify the two homology arms of the gene to be knocked out and fuse them by SOE PCR;

[0016] 3) The fusion DNA fragment obtained by step 2) is amplified by endonuclease BamH I and Xba After enzyme digestion, the BamH I and Xba I enzyme digested T2 plasmid to construct a knockout plasmid for homologous recombination;

[0017] 4) The knockout plasmid was transformed into Bacillus paralicheniformis 285-3 by electroporation, and positive transformants were screened by kanamycin resistance (20 μg / mL) and PCR.

[0018] 5) Incubate positive transformants at 45°C for 5 h, then dilute and plate the transformed cells, and screen for single-crossover colonies by PCR.

[0019] 6) Incubate the colonies verified to have undergone a single crossover in non-resistant culture medium at 37°C for 24 h, then dilute and spread on plates and incubate overnight in a 37°C incubator until single colonies grow. Pick single colonies and spot them on resistant LB plates (20 μg / mL kanamycin) and non-resistant LB plates, incubate at 37°C for 12 h, and then select single colonies that grow on the non-resistant LB plates but not on the resistant LB plates. Verify the single colonies that cannot grow on the resistant plates by colony PCR to screen for colonies that have successfully undergone a double crossover. Sequence and compare the colony PCR products to further confirm the deletion of the target gene.

[0020] The amplification method of the homology arm SOE fragment in step 2) is:

[0021] References in NCBI Bacillus paralicheniformis The whole genome sequence of CBMAI 1303 was used to find the CDS region of the target gene and extend it to the 5' and 3' ends by about 1000 bp respectively as the design region of the homology arms;

[0022] Primer pairs were designed and screened using Primer 5.0 software and then synthesized by Sangon Biotech (Shanghai) Co., Ltd.;

[0023] Temperature gradient PCR was performed to verify the optimal annealing temperature of the primer pair, with a central temperature of 50°C and a temperature gradient of ±6°C. 46°C, 48°C, 50°C, 52°C, 54°C, and 56°C were selected for temperature gradient PCR;

[0024] Based on the above optimized conditions, PCR was performed with a high-fidelity enzyme at the optimal annealing temperature. The band size was verified by agarose gel electrophoresis, and then purified using a PCR purification kit.

[0025] The purified homology arm L arm and R arm were used as mixed templates, the 5' end primer of the L arm and the 3' end primer of the R arm were used as primer pairs, and PCR was performed at the optimal annealing temperature. The obtained amplified fragment was verified by agarose gel electrophoresis to be of correct band size and then purified using a PCR purification kit.

[0026] Primers used:

[0027] ccpA-LF: 5'CGGGATCCTTTCTGTGCCTTTCTT3'

[0028] ccpA-LR: 5'TGTACCCAGTTGCATCGCATTGAA 3'

[0029] ccpA-RF: 5'TTCAATGCCGATGCAACTGGGTACA 3'

[0030] ccpA-RR: 5'GCTCTAGAATGTCACAGGGCAATG 3'

[0031] The knockout plasmid construction method in step 3) is:

[0032] Plasmid extraction: E. coli containing the T2 plasmid described in "Deletion of meso-2,3-butanediol dehydrogenase gene budC for enhanced D-2,3-butanediol production in Bacillus licheniformis" was inoculated into LB liquid medium (containing 20 μg / mL kanamycin), and the plasmid was extracted using a plasmid extraction kit.

[0033] Enzyme digestion: The SOE fragment and T2 plasmid prepared above were BamH Ⅰ and Xba Ⅰ Double digestion was performed with two nucleases, and the fragment was purified using a purification kit. The size of the bands was then verified by agarose gel electrophoresis.

[0034] Enzyme ligation: The SOE fragment and T2 plasmid after enzyme digestion were ligated using T4 DNA ligase.

[0035] The electrotransformation method of Bacillus paralicheniformis in step 4) is:

[0036] Preparation of electroporation competent cells of Bacillus paralicheniformis 285-3: Inoculate a single colony of 283-3 into 5 mL of LB liquid medium and activate overnight at 37°C and 180 rpm in a shaker; take 500 μL of the activated bacterial liquid and inoculate it into 50 mL of GM growth medium (LB + 0.5 M sorbitol) and culture it at 37°C and 180 rpm in a shaker until the OD 600 The pH value was between 0.95 and 0.97. After centrifugation at 8000 rpm at 4°C for 6 min, the supernatant was discarded and the cells were resuspended and washed with 10 mL of pre-chilled ETM washing buffer (0.5 M sorbitol, 0.5 M mannitol, 10% glycerol). Repeat the operation twice. After centrifugation at 8000 rpm at 4°C for 6 min, the supernatant was discarded and the cells were resuspended with 800 μL of ETM washing buffer to obtain 285-3 electroporation competent cells. The cells were kept on ice until use.

[0037] Knockout plasmid electroporation of Bacillus paralicheniformis 285-3: The knockout plasmid constructed in step 3) was extracted using a plasmid extraction kit; a 0.2 cm electroporation cuvette and RM recovery medium (LB + 0.5 M sorbitol + 0.38 M mannitol) were pre-cooled on ice, and then 10 μL of the constructed knockout plasmid was gently mixed with 100 μL of 285-3 competent cells, added to the electroporation cuvette, and quickly electroporated once at 2.5 KV. Then, the cells were gently mixed in 1 mL of pre-cooled RM recovery medium and recovered in a shaker at 37°C and 180 rpm for 3 h; after centrifugation at 8000 rpm for 5 minutes, the supernatant was discarded, and the cells were resuspended in 100 μL of RM recovery medium and spread on LB plates (containing 20 μg / mL kanamycin) and cultured in a 37°C incubator for 24 h. h; Pick all single colonies on the plate for colony PCR verification; verify the band size by agarose gel electrophoresis, and sequence the PCR bands. The sequencing results are compared with the designed fragment sequences by Blast in NCBI to screen 285-3 positive transformants.

[0038] Primers used for colony PCR:

[0039] ccpA-LF: 5'CGGGATCCTTTCTGTGCCTTTCTT3'

[0040] ccpA-RR: 5'GCTCTAGAATGTCACAGGGCAATG 3'

[0041] The single exchange verification method in step 5) is:

[0042] A single colony of a positive transformant was inoculated into 5 mL of LB liquid (containing 20 μg / mL kanamycin) medium and activated overnight in a shaker at 37°C and 180 rpm. 50 μL of the bacterial solution was transferred to fresh 5 mL of LB liquid (containing 20 μg / mL kanamycin) medium and cultured at 42°C and 180 rpm for 5 h. After 10-fold serial dilution with sterile water, 100 μL of each dilution was spread on an LB plate (containing 20 μg / mL kanamycin) and cultured overnight in a 37°C bacterial incubator until a single colony grew. Several single colonies were randomly selected for colony PCR verification of single exchange.

[0043] Primers used for colony PCR:

[0044] ccpA-dan-LF:5'ATCATGACGAGTCCGACAAG 3'

[0045] ccpA-dan-RR:5'TCGAGCCTTAAAAGCCGCC 3'

[0046] The double exchange method of step 6) is:

[0047] The strain that successfully underwent single exchange was inoculated into 5 mL of non-resistant LB liquid medium and cultured at 28 °C for 24 h; after 10-fold gradient dilution with sterile water, 100 μL of the diluted bacterial solution was spread on LB plates (containing 20 μg / mL kanamycin) and cultured overnight in a 37 °C incubator until a single colony grew; single colonies were picked and spotted on LB plates containing 20 μg / mL kanamycin and LB plates without resistance, respectively, and cultured at 37 °C for 12 h; single colonies that grew on LB plates without resistance but could not grow on LB plates containing 20 μg / mL kanamycin were selected for colony PCR to verify the occurrence of double exchange; according to the results of PCR amplification, PCR products that met the target band size were selected, sequenced, and NCBI Blast alignment was performed based on the sequencing results to verify whether the target gene had been knocked out.

[0048] Primers used for colony PCR:

[0049] ccpA-LF: 5'CGGGATCCTTTCTGTGCCTTTCTT3'

[0050] ccpA-RR: 5'GCTCTAGAATGTCACAGGGCAATG 3'

[0051] The main advantages of the present invention are:

[0052] 1. Currently, the strains used in γ-PGA fermentation production all rely on the addition of exogenous glutamate. Due to the high price of glutamate, the raw material cost of γ-PGA fermentation production has increased significantly, which has limited the promotion and application of γ-PGA, especially its large-scale application in the agricultural field. ccpA The engineered strain of Bacillus paralicheniformis 285-3 obtained by gene knockout has a γ-PGA yield of over 60 g / L in a culture medium without the addition of exogenous glutamate, greatly reducing the fermentation production cost of γ-PGA.

[0053] 2. The engineered strain 285-3Δ provided by the present invention ccpA Compared with the starting strain 285-3, its γ-PGA production rate is higher, which can effectively save costs such as labor, energy, equipment occupancy and loss, thereby further reducing the production cost of γ-PGA. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] Figure 1 : It is the homologous recombination knockout of the gene in the present invention, and the PCR amplification of the L arm and R arm of the target gene; L1-L6 are the amplified L arms, and R1-R6 are the amplified R arms.

[0055] Figure 2 : PCR verification of electroporation of knockout plasmid into Bacillus paralicheniformis 285-3; Lane 6 shows the positive transformant, with a size of about 1000 bp.

[0056] Figure 3 :Blast alignment of sequencing results of double-exchange PCR amplified fragments, the missing part in the middle is the knockout ccpA Gene sequence.

[0057] Figure 4 :It is the knockout strain 285-3Δ that enhances the central carbon metabolism pathway in the present invention ccpA γ-PGA production in shake flask cultures in basal medium.

[0058] Figure 5 :It is the knockout strain 285-3Δ that enhances the central carbon metabolism pathway in the present invention ccpA γ-PGA production in shake flask fermentation medium.

[0059] Figure 6 :It is the knockout strain 285-3Δ that enhances the central carbon metabolism pathway in the present invention ccpA γ-PGA yields from 10 L fermentor cultures in fermentation medium. DETAILED DESCRIPTION

[0060] The present invention will be further described below with reference to the accompanying drawings and specific embodiments.

[0061] Example 1

[0062] 1. Gene Knockout

[0063] Extraction of genomic DNA from Bacillus paralicheniformis 285-3: A single colony of 285-3 was inoculated into 5 mL of LB liquid medium and activated overnight in a shaker at 37°C and 180 rpm. 1 mL of the activated bacterial solution was transferred to a 1.5 mL centrifuge tube and centrifuged at 12,000 rpm for 1 min. The supernatant was discarded and the cells were resuspended in 500 µL of ultrapure water. The tube was incubated in a boiling water bath for 10 min and centrifuged at 12,000 rpm for 1 min. The supernatant, which was the total genomic DNA of Bacillus paralicheniformis, was stored at 4°C.

[0064] PCR amplify the homologous L and R arms of the target gene: refer to NCBI Bacillus paralicheniformis The whole genome sequence of CBMAI 1303 was used to find the CDS region of the target gene, and the region was extended by approximately 1000 bp to the 5' and 3' ends, respectively, as the design region of the homology arms. Primers were designed and screened using Primer 5.0 software. The optimal annealing temperature of the primers was verified by temperature gradient PCR, with a central temperature of 50°C and a temperature gradient of ±6°C. Temperature gradient PCR was performed at 46°C, 48°C, 50°C, 52°C, 54°C, and 56°C. Based on the above optimized conditions, PCR was performed at the optimal annealing temperature using a high-fidelity enzyme. The band size was verified by agarose gel electrophoresis, and the DNA fragments amplified by PCR were purified using a PCR purification kit.

[0065] SOE-PCR fragment amplification: Use the purified homology arm L arm and R arm as a mixed template, the 5' end primer of the L arm and the 3' end primer of the R arm as the primer pair, and perform PCR at the optimal annealing temperature. The obtained amplified fragment is verified by agarose gel electrophoresis to be of correct band size and then purified using a PCR purification kit.

[0066] Extract the T2 plasmid vector: Inoculate a single colony of E. coli containing the T2 plasmid into 5 mL of LB medium (containing 20 µg / mL kanamycin) and activate the culture overnight at 37°C and 180 rpm in a shaker. Extract the plasmid from the activated bacterial suspension using a plasmid extraction kit, and verify the correct band size by agarose gel electrophoresis.

[0067] Double enzyme digestion: SOE-PCR fragment and T2 plasmid were digested with BamH Ⅰ and Xba Ⅰ Perform double enzyme digestion; after enzyme digestion, purify with PCR purification kit, and then verify whether the band size is correct by agarose gel electrophoresis.

[0068] Enzyme ligation: The fragments after the above enzyme digestion are ligated with T4 DNA ligase to obtain the recombinant plasmid used for gene knockout.

[0069] Prepare DH5α competent cells: inoculate a single DH5α colony into 5 mL LB liquid medium and activate the culture overnight at 37°C and 180 rpm in a shaker; take 50 μL of the activated bacterial solution and inoculate it into 5 mL fresh LB liquid medium and incubate it at 37°C and 180 rpm in a shaker until the OD 600 ≈ 0.48; take 1 mL of bacterial solution into a 1.5 mL centrifuge tube, centrifuge at 4°C and 5000 rpm for 5 min, and discard the supernatant; gently resuspend the bacteria in 1 mL of ice-cold sterile CaCl2 solution (0.1 mol / L), centrifuge at 4°C and 5000 rpm for 5 min, discard the supernatant, and repeat this operation twice; gently resuspend the bacteria in pre-cooled CaCl2 solution to obtain DH5α competent cells, and keep them on ice until use.

[0070] Knockout plasmid transformation into DH5α: Gently mix 10 µL of the above enzyme-linked product with 100 µL of DH5α competent cells; let it stand on ice for 20 min, then place it in a 42°C water bath for 90 s, and then quickly let it stand on ice for 3 min. Add 800 µL of fresh LB liquid medium and resuscitate the culture in a shaker at 37°C and 180 rpm for 45 min, then centrifuge at 4000 rpm for 5 min. Discard part of the supernatant and save approximately 100 µL of the resuspended cells. Spread the plate on an LB plate (containing 20 µg / mL kanamycin) and place it in a 37°C bacterial incubator until a single colony grows. Randomly select a single colony for colony PCR verification. After confirming the correct band size by agarose gel electrophoresis, sequence the fragment and perform Blast comparison with the designed fragment sequence in NCBI to verify the successful transformation of the recombinant plasmid.

[0071] Preparation of competent cells of Bacillus paralicheniformis 285-3: Inoculate a single colony of 285-3 into 5 mL of LB liquid medium and activate overnight at 37°C and 180 rpm in a shaker; take 500 μL of the activated bacterial liquid and inoculate it into 50 mL of GM growth medium and culture it at 37°C and 180 rpm in a shaker until the OD 600 = 0.95 - 0.97, dispense into two pre-sterilized and pre-chilled 50 mL centrifuge tubes, 20 mL per tube, and incubate on ice for 30 min; centrifuge at 4°C, 8000 rpm for 6 min, discard the supernatant, resuspend and wash with 10 mL of pre-chilled ETM wash buffer, repeat this operation twice; centrifuge at 4°C, 8000 rpm for 6 min, discard the supernatant, resuspend with 800 µL of ETM wash buffer to obtain 285-3 electroporation competent cells, and incubate on ice until use.

[0072] Electroporation of knockout plasmid into Bacillus paralicheniformis 285-3: The knockout plasmid constructed above was extracted using a plasmid extraction kit. A 0.2 cm electroporation cuvette and RM recovery medium were pre-chilled on ice. 10 µL of the recombinant plasmid and 100 µL of competent cells were gently mixed and added to the cuvette. The cells were quickly electroporated once at 2.5 kV and then gently mixed in 1 mL of pre-chilled RM recovery medium. The cells were recovered in a shaker at 37°C and 180 rpm for 3 h. The supernatant was discarded after centrifugation at 8000 rpm for 5 min. The cells were resuspended in 100 µL of RM recovery medium and plated on LB plates (containing 20 µg / mL kanamycin). The cells were incubated in a 37°C incubator for 24 h. Single colonies on the plates were selected for colony PCR verification. Band sizes were verified by agarose gel electrophoresis and sequencing was performed. Sequencing results were then compared with the designed fragment sequences in NCBI Blast to screen for positive transformants.

[0073] Single exchange: Inoculate a single colony of a positive transformant into 5 mL of LB liquid (containing 20 µg / mL kanamycin) medium and activate the culture overnight at 37°C and 180 rpm. Transfer 50 µL of the bacterial solution into fresh 5 mL of LB liquid (containing 20 µg / mL kanamycin) medium and culture at 42°C and 180 rpm for 5 h. Dilute the culture to 10 with sterile water in a 10-fold gradient. -5 , 10 -6 , 100 μL was spread on LB plates (containing 20 μg / mL kanamycin) and cultured overnight in a 37°C bacterial incubator until single colonies grew; single colonies were randomly selected for colony PCR verification of single exchange.

[0074] Double exchange: The strain that successfully underwent single exchange was inoculated into 5 mL of LB liquid medium without resistance and cultured at 28 °C for 20-24 h; the strain was diluted with sterile water in a 10-fold gradient to 10 -5 , 10 -6 , 100 μL was spread on LB plates (containing 20 μg / mL kanamycin) and cultured overnight in a 37°C bacterial incubator until single colonies grew; single colonies were picked and spotted on LB plates containing 20 μg / mL kanamycin and LB plates without resistance, respectively, and cultured at 37°C for about 12 h. Single colonies that grew on LB plates without resistance but could not grow on LB plates containing 20 μg / mL kanamycin were selected for colony PCR to verify the occurrence of double crossover; according to the results of PCR amplification, PCR products that met the target band size were selected for sequencing, and NCBI Blast comparison was performed based on the sequencing results to verify whether the target gene had been knocked out.

[0075] Primers used for amplification of homology arms and SOE-PCR:

[0076] ccpA-LF: 5'CGGGATCCTTTCTGTGCCTTTCTT3'

[0077] ccpA-LR: 5'TGTACCCAGTTGCATCGCATTGAA 3'

[0078] ccpA-RF: 5'TTCAATGCCGATGCAACTGGGTACA 3'

[0079] ccpA-RR: 5'GCTCTAGAATGTCACAGGGCAATG 3'

[0080] Primers used for screening positive transformant colonies of Bacillus paralicheniformis:

[0081] ccpA-LF: 5'CGGGATCCTTTCTGTGCCTTTCTT3'

[0082] ccpA-RR: 5'GCTCTAGAATGTCACAGGGCAATG 3'

[0083] Primers used for single crossover colony PCR:

[0084] ccpA-dan-LF:5'ATCATGACGAGTCCGACAAG 3'

[0085] ccpA-dan-RR:5'TCGAGCCTTAAAAGCCGCC 3'

[0086] Primers used for double-crossover colony PCR:

[0087] ccpA-LF: 5'CGGGATCCTTTCTGTGCCTTTCTT3'

[0088] ccpA-RR: 5'GCTCTAGAATGTCACAGGGCAATG 3'

[0089] Example 2

[0090] 1. Shake flask fermentation

[0091] Activation of bacterial strains: Pick a freshly cultured single colony from the LB plate, inoculate it into 5 mL of LB liquid medium, and culture it overnight in a shaker at 37°C and 180 rpm for 12 h.

[0092] Seed solution preparation: 50 μL of bacterial solution was transferred to 5 mL of new LB liquid medium and cultured in a shaker at 37°C and 180 rpm for 10 h as the fermentation seed solution.

[0093] Shake flask fermentation: 1.5 mL of seed solution was inoculated into a 250 mL shake flask containing 50 mL of basal medium. Fermentation was incubated at 37°C and 180 rpm for 36 h. Basal medium formulation (1 L): 30 g industrial sodium citrate, 12 g industrial sodium nitrate, 8 g ammonium chloride, 0.5 g dipotassium hydrogen phosphate trihydrate, 1 g magnesium sulfate heptahydrate, 0.08 g ferric chloride hexahydrate, 0.3 g anhydrous calcium chloride, and 0.05 g manganese sulfate monohydrate. The volume was made up to 800 mL with distilled water, the pH was adjusted to 7.40, and the flask was sterilized at 115°C for 30 minutes. 70 g of food-grade glucose was fully dissolved in 200 mL of distilled water and sterilized separately at 115°C for 30 minutes.

[0094] 2. Fermentation tank culture

[0095] Activation of bacteria: Pick a freshly cultured single colony from the LB plate, inoculate it into 25 mL of LB liquid medium, and activate it overnight in a shaker at 37°C and 180 rpm for 16 h.

[0096] Preparation of seed solution: Transfer 2.1 mL of the above bacterial solution to 210 mL of fresh LB liquid medium and culture in a shaker at 37°C and 180 rpm for 10 h to obtain fermentation seed solution.

[0097] Fermentation culture in a fermenter: 210 mL of seed solution was inoculated into a 10-L fermenter containing 7 L of fermentation medium. Fermentation was carried out at 37°C, 500 rpm, and 8 L / min aeration for 41 h. The fermentation medium formulation (1 L) included: 45 g industrial sodium citrate, 21 g industrial sodium nitrate, 12 g ammonium chloride, 0.5 g dipotassium hydrogen phosphate trihydrate, 1 g magnesium sulfate heptahydrate, 0.08 g ferric chloride hexahydrate, 0.3 g anhydrous calcium chloride, and 0.05 g manganese sulfate monohydrate. The volume was made up to 800 mL with distilled water, the pH was adjusted to 7.40, and the medium was sterilized at 115°C for 30 minutes. 87.5 g food-grade glucose was fully dissolved in 200 mL of distilled water and sterilized separately at 115°C for 30 minutes.

[0098] Example 3

[0099] 1. Drawing of γ-PGA standard curve

[0100] (1) Accurately weigh 0.25 g of γ-PGA standard, dissolve it fully in distilled water, and then dilute it to volume in a 250 mL volumetric flask to obtain a 1 g / L γ-PGA standard solution;

[0101] (2) Take 25 mL of the above solution and dilute it to volume again in a 250 mL volumetric flask with distilled water to obtain a 100 mg / L γ-PGA standard solution;

[0102] (3) Accurately measure 8 mL, 16 mL, 24 mL, 32 mL, and 40 mL of the above solution and dilute to volume with distilled water in a 100 mL volumetric flask to obtain 8 µg / mL, 16 µg / mL, 24 µg / mL, 32 µg / mL, and 40 µg / mL γ-PGA standard solutions, respectively.

[0103] (4) Take 2 mL of γ-PGA standard solution of different concentrations, add 2 mL of CTAB reagent (5 g / L) and start timing; slowly invert and mix for 30 seconds (try to minimize foaming), let it stand for 6 minutes and 30 seconds, and read the A value using a UV spectrophotometer. 250 For the blank control, 2 mL of γ-PGA standard solution was replaced with 2 mL of distilled water, and other operations remained unchanged;

[0104] (5) With the concentration of γ-PGA standard solution as the horizontal axis, A 250 The numerical value is the vertical coordinate, a scatter plot is obtained, and linear regression fitting is performed to obtain the linear regression equation.

[0105] 2. Quantitative detection of γ-PGA

[0106] The CTAB (cetyltrimethylammonium bromide) turbidimetric method is used. The specific steps are as follows:

[0107] (1) Take 2 mL of fermentation broth into a 2 mL centrifuge tube and centrifuge at 4°C and 12,000 rpm for 20 min;

[0108] (2) Take 500 μL of supernatant and add it to a 2 mL centrifuge tube. Then add 1.5 mL of anhydrous ethanol, shake vigorously, and place in a refrigerator at 4°C for more than 1 hour.

[0109] (3) Centrifuge at 12,000 rpm for 5 min at room temperature, discard the supernatant, and then place in an oven at 65°C for more than 3 h to constant weight;

[0110] (4) Add 1 mL of ultrapure water and let it stand at room temperature overnight to fully dissolve, and then dilute it with ultrapure water to an appropriate multiple as the test solution;

[0111] (5) Take 2 mL of the test solution, add 2 mL of CTAB (5 g / L) reagent, and start timing; slowly invert upside down to mix for 30 seconds (try to minimize foaming), let it stand for 6 minutes and 30 seconds, and read the A250 value using a UV spectrophotometer; for the blank control, replace 2 mL of the test solution with 2 mL of distilled water, and keep other operations unchanged;

[0112] (6) The measured sample A 250The value of γ-PGA in the sample was obtained by using the above standard curve.

[0113] The above describes in detail the preferred embodiments of the present invention. It should be understood that those skilled in the art can make numerous modifications and variations based on the concepts of the present invention without inventive effort. Therefore, any technical solutions that can be derived by those skilled in the art through logical analysis, reasoning, or limited experimentation based on the concepts of the present invention and the prior art should be within the scope of protection defined by the claims.

Claims

1. A non-glutamate-dependent poly-γ-glutamate high-producing strain of Bacillus paralicheniformis, characterized in that: Knockout of the Bacillus paralicheniformis 285-3 genome ccpA gene, named Bacillus sp. 285-3Δ ccpA , deposited in China Center for Type Culture Collection, with the deposit number CCTCC M 20242408, and the deposit date is October 31, 2024; The engineered bacillus paralicheniformis bacteria produces poly-gamma-glutamic acid by fermentation in a culture medium without exogenous glutamic acid.

2. Use of the engineered strain of Bacillus paralicheniformis, a non-glutamate-dependent poly-gamma-glutamate high-producing strain according to claim 1, in the fermentation production of poly-gamma-glutamate in a culture medium without exogenous glutamate.

Images