Engineered exosome of overexpressed protein ILK as well as preparation method and application of engineered exosome

Abstract

The invention provides an engineered exosome of overexpressed protein ILK as well as a preparation method and application of the engineered exosome. In particular to application of the engineered exosome of the overexpressed protein ILK in preparation of products for promoting osteogenic differentiation, the engineered exosome of the overexpressed protein ILK, a preparation method of the engineered exosome of the overexpressed protein ILK and a method for promoting osteogenic differentiation of human bone marrow mesenchymal stem cells. The protein molecule ILK is directly overexpressed on the basis of human-derived cells in a genetic engineering manner, so that the engineered exosome of endogenous enriched therapeutic active protein is generated, and the therapeutic activity for promoting bone regeneration is improved.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and specifically relates to engineered exosomes overexpressing the protein ILK, and a preparation method and application thereof. Background Art

[0002] Engineered exosomes refer to the engineering transformation of exosomes through genetic engineering and chemical methods, loading protein molecules, miRNAs, small molecule therapeutics, etc. into exosomes, and delivering them to specific types of cells or tissues. By modifying the parental genes through lentiviral transfection or electroporation, upregulating miRNAs, proteins, cytokines, etc., the exosomes produced after modification will carry these specific contents and play special roles. Engineered exosomes can not only transfer the encapsulated proteins and genetic information into recipient cells, but also act as information transmitters between cells.

[0003] At present, a large number of literatures have constructed engineered exosomes for basic research. For example, Fu Dehao et al. designed a bone-targeted engineered exosome to treat osteoporosis by delivering the target siRNA (PMID: 34901540). However, this method transfers exogenous siRNA into exosomes by physical methods, with low efficiency and low yield, and there are biosafety problems with exogenous compound siRNA, which is difficult to apply in clinical treatment in the future.

[0004] ILK is a key protein factor that links integrin and the cytoskeleton, and has three functional domains, including the C-terminal kinase catalytic domain, ankyrin repeat sequences, and a phosphatidylinositol-binding structure. It is a highly evolutionarily conserved intracellular protein, initially identified as an integrin-interacting protein, and its expression is crucial in embryonic development and tissue homeostasis. Summary of the Invention

[0005] The purpose of the present invention is to directly overexpress the protein molecule ILK through genetic engineering on the basis of human cells, thereby producing engineered exosomes endogenously enriched with therapeutic active proteins and improving the therapeutic activity of promoting bone regeneration.

[0006] In a first aspect, the present invention provides an application of engineered exosomes overexpressing the protein ILK in the preparation of products for promoting osteogenic differentiation.

[0007] In a specific embodiment, the engineered exosomes overexpressing the protein ILK are derived from human bone marrow mesenchymal stem cells.

[0008] In a specific embodiment, the engineered exosomes overexpressing the protein ILK are prepared by the following method:

[0009] Step (1): Transfect LV-ILK lentivirus into human bone marrow mesenchymal stem cells and culture them to obtain a culture product.

[0010] Step (2): Separate the supernatant from the culture product and extract exosomes from the supernatant to obtain engineered exosomes overexpressing protein ILK.

[0011] In a specific embodiment, the multiplicity of infection (MOI) of lentivirus transfection in step (1) is 50.

[0012] In a specific embodiment, the exosomes are extracted from the supernatant by using a kit method in step (2).

[0013] In a second aspect, the present invention provides engineered exosomes overexpressing protein ILK, and the engineered exosomes overexpressing protein ILK are derived from human bone marrow mesenchymal stem cells.

[0014] In a third aspect, the present invention provides a preparation method of engineered exosomes overexpressing protein ILK, and the preparation method includes the following steps:

[0015] Step (1): Transfect LV-ILK lentivirus into human bone marrow mesenchymal stem cells and culture them to obtain a culture product.

[0016] Step (2): Separate the supernatant from the culture product and extract exosomes from the supernatant to obtain engineered exosomes overexpressing protein ILK.

[0017] In a specific embodiment, the multiplicity of infection (MOI) of lentivirus transfection in step (1) is 50.

[0018] In a specific embodiment, the exosomes are extracted from the supernatant by using a kit method in step (2).

[0019] In a specific embodiment, step (2) is specifically as follows: When the BMSCs in the culture product grow and fuse to 80%, the first supernatant is obtained by the first centrifugation separation; the second supernatant is obtained by subjecting the first supernatant to the second centrifugation separation; the third supernatant is obtained by subjecting the second supernatant to the third centrifugation separation; the third supernatant is concentrated and mixed with the ExoQuick kit reagent at a ratio of (4-5):1 and left overnight at 4°C; the product obtained by mixing overnight is subjected to the fourth centrifugation separation to obtain the first precipitate; the first precipitate is added with PBS and then subjected to the fifth centrifugation separation to obtain the second precipitate; finally, the second precipitate is resuspended with PBS to obtain the engineered exosomes.

[0020] Preferably, the conditions for the first centrifugal separation include: centrifuging at 300 g and 4°C for 15 min; the conditions for the second centrifugal separation include: centrifuging at 4000 g and 4°C for 30 min; the conditions for the third centrifugal separation include: centrifuging at 10000 g and 4°C for 40 min; the conditions for concentration include: centrifuging at 4000 g and 4°C for 30 min; the conditions for the fourth centrifugal separation include: centrifuging at 500 g and 4°C for 30 min; the conditions for the fifth centrifugal separation include: centrifuging at 1500 g and 4°C for 5 min.

[0021] Fourthly, the present invention provides a method for promoting osteogenic differentiation of human bone marrow mesenchymal stem cells, the method comprising co-culturing the engineered exosomes overexpressing the protein ILK described above or the engineered exosomes overexpressing the protein ILK prepared by the preparation method described above with BMSCs of osteoporosis patients.

[0022] In a specific embodiment, the co-culture is specifically: inoculating BMSCs of osteoporosis patients in a culture dish, when the cell number covers 90% of the bottom of the culture dish, adding osteogenic induction medium for induction, and adding engineered exosomes overexpressing the protein ILK for intervention, and then continuing to place the culture dish in a cell culture incubator at 37°C and 5% CO 2 for dark culture, wherein the culture time is more than 7 days.

[0023] Preferably, the osteogenic induction medium is selected from one of the in vitro culture systems for inducing the differentiation of bone marrow mesenchymal stem cells into osteoblasts.

[0024] More preferably, the composition of the osteogenic induction medium is: dexamethasone 100 nM, ascorbic acid 50 μM, β-glycerophosphate 10 mM, 1% (v / v) penicillin-streptomycin, 10% (v / v) exosome-free fetal bovine serum, and 89% (v / v) low-glucose DMEM medium.

[0025] Preferably, the concentration of the engineered exosomes overexpressing the protein ILK is 100 μg / mL to 150 μg / mL.

[0026] The beneficial effects of the present invention at least include:

[0027] First, the present invention directly overexpresses the protein molecule ILK by genetic engineering on the basis of human-derived cells, thereby generating engineered exosomes endogenously enriched with the therapeutic active protein ILK. The engineered exosomes overexpressing the protein ILK can promote the proliferation and osteogenic differentiation of BMSCs of osteoporosis patients. Thus, it can be applied to the preparation of products for promoting osteogenic differentiation and products for promoting bone regeneration, and play a role in promoting bone regeneration.

[0028] II. The engineered exosomes overexpressing the protein ILK provided by the present invention are derived from human bone marrow mesenchymal stem cells. The therapeutic molecule of the engineered exosomes is a human-derived therapeutic protein, which will not cause ethical problems and will not undergo immune rejection, and has good application prospects. Description of the Drawings

[0029] Figure 1 It is a figure for identifying the culture of human-derived BMSCs, alizarin red staining for osteogenic induction, and oil red O staining for adipogenic induction. Among them, Figure 1 a in is the microscopic image of the primary cells extracted after culturing by the adherent method for 20 days, Figure 1 b in is the microscopic image of alizarin red staining of the 3rd generation BMSCs cells after osteogenic induction for 14 days, Figure 1 c in is the microscopic image of oil red O staining of the 3rd generation BMSCs cells after adipogenic induction for 21 days;

[0030] Figure 2 It is the result of identifying the expression of the negative marker CD14 of human-derived BMSCs by flow cytometry;

[0031] Figure 3 It is the result of identifying the expression of the negative marker CD34 of human-derived BMSCs by flow cytometry;

[0032] Figure 4 It is the result of identifying the expression of the positive marker CD105 of human-derived BMSCs by flow cytometry;

[0033] Figure 5 It is the microscopic cell fluorescence expression of the group of bone marrow mesenchymal stem cells transfected with LV-control empty lentivirus and the group of bone marrow mesenchymal stem cells transfected with LV-ILK lentivirus. Among them, Figure 5 a in is the cell condition of bone marrow mesenchymal stem cells transfected with LV-control empty lentivirus under natural light under the microscope, Figure 5 b in is the cell condition of bone marrow mesenchymal stem cells transfected with LV-ILK lentivirus under natural light under the microscope, Figure 5 c in is the cell condition of bone marrow mesenchymal stem cells transfected with LV-control empty lentivirus under blue light (exciting green fluorescence) under the microscope, Figure 5 d in is the cell condition of bone marrow mesenchymal stem cells transfected with LV-ILK lentivirus under blue light (exciting green fluorescence) under the microscope;

[0034] Figure 6 It is a comparative chart of the RT-qPCR results of the ILK expression levels of the group of bone marrow mesenchymal stem cells transfected with LV-control empty lentivirus and the group of bone marrow mesenchymal stem cells transfected with LV-ILK lentivirus;

[0035] Figure 7 Western blot corresponding band diagrams of ILK protein expression in the group of bone marrow mesenchymal stem cells transfected with LV-control empty lentivirus and the group of bone marrow mesenchymal stem cells transfected with LV-ILK lentivirus;

[0036] Figure 8 For engineered exosomes EXO Control group and EXO ILK group Western blot corresponding band diagrams of ILK-Flag, TSG101, and CD9 protein expression;

[0037] Figure 9 For the particle size distribution of exosomes extracted by differential centrifugation detected by dynamic light scattering (DLS) technology in the EXO Control group;

[0038] Figure 10 For the particle size distribution of exosomes extracted by differential centrifugation detected by dynamic light scattering (DLS) technology in the EXO ILK group;

[0039] Figure 11 For engineered exosomes EXO Control group and EXO ILK group transmission electron microscope images, where Figure 11 in (a) is the transmission electron microscope (TEM) image of the EXO Control group, Figure 11 in (b) is the transmission electron microscope (TEM) image of the EXO Control group;

[0040] Figure 12 For engineered exosomes EXO Control group and EXO ILK group after co-culture with BMSCs from osteoporosis patients, immunofluorescence staining results of BMSCs uptake of exosomes observed by laser confocal microscope, where Figure 12 in a is the laser microscope image of the EXO Control group stained with PKH67, Figure 12 in b is the laser microscope image of the EXO Control group stained with DAPI, Figure 12 in c is the laser microscope image of the EXO Control group stained with Merge, Figure 12 in d is the laser microscope image of the EXO ILK group stained with PKH67, Figure 12 in e is the laser microscope image of the EXO ILK group stained with DAPI, Figure 12 in f is the laser microscope image of the EXO ILKGroup Merge staining laser microscope image;

[0041] Figure 13 For engineered exosomes EXO Control Group and EXO ILK Comparison chart of cell proliferation activity after co - culturing the group with BMSCs derived from osteoporosis patients;

[0042] Figure 14 For the expression results of osteogenic genes Collagen I, RUNX2, and OCN detected by RT - qPCR after co - culturing engineered exosomes with BMSCs derived from osteoporotic patients and osteogenic induction for 7 days, where Figure 14 In (a) is EXO Control Group and EXO ILK Comparison chart of Collagen I gene expression levels in Group and EXO Figure 14 In (b) is EXO Control Group and EXO ILK Comparison chart of RUNX2 gene expression levels in Group and EXO Figure 14 In (c) is EXO Control Group and EXO ILK Comparison chart of OCN gene expression levels in Group and EXO;

[0043] Figure 15 For the results of ALP staining to detect alkaline phosphatase activity after co - culturing engineered exosomes with BMSCs derived from osteoporotic patients and osteogenic induction for 7 days, where Figure 15 In a is the macroscopic view of ALP staining in EXO Control Group, Figure 15 In b is the macroscopic view of ALP staining in EXO ILK Group, Figure 15 In c is the microscopic view of ALP staining in EXO Control Group, Figure 15 In d is the microscopic view of ALP staining in EXO ILK Group;

[0044] Figure 16 For the Western blot corresponding band images of the protein expressions of Collagen I, RUNX2, and GAPDH in the PBS group, EXO Control Group and EXO ILK Group. Detailed implementation manners

[0045] The present invention will be described in detail below in conjunction with the accompanying drawings and embodiments, but the present invention can be implemented in many different ways defined and covered by the claims.

[0046] For the experimental methods without specific conditions noted in the examples, they are generally carried out under conventional conditions or the conditions recommended by the manufacturer. For the materials, reagents, etc. used in the following examples, unless otherwise specified, they can all be obtained commercially. Specifically: fetal bovine serum, PBS, and basal medium were purchased from Gibco, ECL luminescent solution and PVDF membrane were purchased from Millipore, Trizol was purchased from Thermo Fisher, reverse transcription kit and SYBR Premix Ex Taq II were purchased from Takara Biotechnology, primers were all synthesized by Shanghai Sangon Biotech Co., Ltd., rabbit anti-TSG101 polyclonal antibody was purchased from Sigma, rabbit anti-CD9 monoclonal antibody was purchased from Invitrogen, rabbit anti-GAPDH polyclonal antibody was purchased from Proteintech, mouse anti-Runx2 monoclonal antibody was purchased from Abcam, rabbit anti-CollagenⅠ monoclonal antibody and rabbit anti-ILK polyclonal antibody were purchased from Proteintech, rabbit and mouse secondary antibodies were purchased from Proteintech, ILK lentivirus was synthesized by GeneChem, BCA kit was purchased from ComWin Biotech, exosome ExoQuick kit was purchased from SBI, and ultrafiltration tubes were purchased from Millipore.

[0047] Example 1

[0048] 1.1 Extraction, culture and differentiation of human bone marrow mesenchymal stem cells (BMSCs)

[0049] In this example, BMSCs were isolated and cultured from the vertebral bone marrow of donors diagnosed with lumbar spondylolisthesis who underwent spinal fusion surgery. First, the bone marrow was centrifuged at 1200 rpm for 5 min to obtain primary cells, and then the primary cells were suspended in low-glucose DMEM complete medium containing 10% FBS and 1% penicillin-streptomycin solution and placed in an incubator at 37°C and 5% CO 2 for culture. After culture, non-adherent cells were removed, and the 3rd or 4th generation BMSCs were taken for subsequent experiments.

[0050] When observing the third-generation BMSCs inoculated in a 3.5 cm culture dish under a microscope, the cell growth morphology was good. When the number covered about 90% of the bottom of the dish, the BMSCs were respectively subjected to osteogenic induction culture and adipogenic induction culture. The identification results of the induction culture are shown in detail in Figure 1 .

[0051] Among them, the osteogenic induction culture is specifically as follows: Culturing for 14 days in an osteogenic induction medium (containing 100 nM dexamethasone, 50 μM ascorbic acid, 10 mM β-glycerophosphate, 1% (v / v) penicillin-streptomycin, 10% (v / v) extracellular vesicle-free fetal bovine serum, 89% (v / v) low-glucose DMEM medium), and replacing the osteogenic induction medium every 3 - 4 days during osteogenic induction.

[0052] The adipogenic induction culture is specifically as follows: Culturing for 21 days in an induction medium (solution A) / maintenance medium (solution B). During adipogenic induction culture, solution A and solution B of the medium are alternately replaced every 3 - 4 days. The induction medium (solution A) contains a basal medium, dexamethasone, IBMX, insulin, rosiglitazone, double antibodies, and glutamine; the maintenance medium (solution B) contains a basal medium, insulin, double antibodies, and glutamine; and both solution A and solution B are added with 10% (v / v) extracellular vesicle-free fetal bovine serum.

[0053] Please refer to Figure 1 , Figure 1 , which is an identification diagram of the culture of human-derived BMSCs, osteogenic induction alizarin red staining, and adipogenic induction oil red O staining. Among them, Figure 1 a in Figure 1 is a microscopic image of the primary cells extracted and cultured by the adherent method after 20 days. It can be seen from Figure 1 a in Figure 1 that there are scattered adherent cells in a spindle and fusiform shape, and the cell state and activity are both good; Figure 1 b in Figure 1 is a microscopic image of alizarin red staining after 14 days of osteogenic induction of the third-generation cells. It can be seen from

[0054] 1.2 Identification of human-derived BMSCs

[0055] In the present invention, flow cytometry is used for identification. The specific method is as follows: Taking the third-generation BMSCs, digesting with 0.25% trypsin-EDTA, centrifuging at 1000 rpm for 5 min, washing twice with PBS, resuspending in 500 μL PBS, incubating with anti-CD14-FITC, CD34-PE, and CD105-APC at 4 °C for 30 minutes, and detecting with a FACSCalibur flow cytometer. The results are shown in detail in Figures 2 to 4 . Among them, Figures 2 to 4 the ordinate is the cell count, and the abscissa is the fluorescence intensity.

[0056] Please refer to Figures 2 to 4 , Figure 2The expression results of the negative marker CD14 of human-derived BMSCs identified by flow cytometry Figure 3 The expression results of the negative marker CD34 of human-derived BMSCs identified by flow cytometry Figure 4 The expression results of the positive marker CD105 of human-derived BMSCs identified by flow cytometry. According to Figures 2 to 4 knowledge, the surface antigens of the third-generation BMSCs were identified by flow cytometry, and the expressions of CD14 and CD34 were both less than 1%, while the expression of CD105 was greater than 99% (where CD14 was 0.59%, CD34 was 0.66%, and CD105 was 99.1%). This indicated that the experimental method for extracting BMSCs in this study could successfully extract BMSCs, and the purity met the requirements, making it available for further experiments.

[0057] Example 2

[0058] Preparation of a BMSCs cell line overexpressing the protein ILK

[0059] 2.1 Transfection method

[0060] The specific method was as follows: On the first day, the third-generation BMSCs with good status were selected and seeded into a six-well plate, with the cell density controlled at approximately 60 - 70%; on the second day, the cryopreserved LV-ILK lentivirus and LV-control empty lentivirus solution were thawed by standing on ice; based on a virus infection coefficient (MOI) of 50, the lentivirus was added to the complete medium (0.96 ml per well), and a certain concentration of infection enhancer (40 μl per well) was added. The above-prepared infection solution was added to the six-well plate, and the BMSCs were transfected for 16 hours and then replaced with fresh medium. After 72 hours, a medium containing puromycin (final concentration

[0061] 1.5 μg / mL) was used to screen for stably expressing cells for culture. After continuing to culture for 3 days, when the cells expressing green fluorescence reached more than 80% under a fluorescence microscope, the cells were collected for relevant experimental detection.

[0062] 2.2 Identification results of transfection efficiency

[0063] The fluorescence expression of bone marrow mesenchymal stem cells transfected with the LV-control empty lentivirus group and the LV-ILK lentivirus group under a microscope is shown in detail in Figure 5 as follows Figure 5 a in Figure 5 shows the cell condition of bone marrow mesenchymal stem cells transfected with the LV-control empty lentivirus under natural light under a microscope, Figure 5In [c], the cells of bone marrow mesenchymal stem cells transfected with LV-control empty lentivirus are shown under blue light (exciting green fluorescence) under the microscope. Figure 5 In [d], the cells of bone marrow mesenchymal stem cells transfected with LV-ILK lentivirus are shown under blue light (exciting green fluorescence) under the microscope.

[0064] From Figure 5 It can be seen that after transfecting bone marrow mesenchymal stem cells with LV-ILK lentivirus, green fluorescence is expressed in the cells, indicating that the lentivirus is successfully transfected, integrating the exogenous ILK gene into the genome of bone marrow mesenchymal stem cells and successfully expressing it.

[0065] 2.3 Verification of high expression of ILK in BMSCs by RT-qPCR

[0066] Total RNA of BMSCs transfected with virus for 3 days was extracted using reagents such as TRIzol and chloroform, and the RNA quality was detected using a Nanodrop 2000 spectrophotometer. RNA was reverse transcribed into cDNA using a Prime script RT kit and Mix-XTM miRNA first-strand synthesis reagent. RT-qPCR was performed on a Light Cycler 96 system (Roche) using the TB Green Premix Ex Taq protocol. The 2-ΔΔCt method was used to evaluate the relative change in gene expression, with GAPDH as an internal reference control.

[0067] The upstream primer for RT-qPCR detection of ILK is shown as SEQ ID NO.1, and the downstream primer is shown as SEQ ID NO.2, where SEQ ID NO.1: CCTGCACTATGCCTGTTTTTGG; SEQ ID NO.2:

[0068] TGTGTCCTTGTATGGAATACGGT.

[0069] The upstream primer for RT-qPCR detection of GAPDH is shown as SEQ ID NO.3, and the downstream primer is shown as SEQ ID NO.4, where SEQ ID NO.3: CAGGAGGCATTGCTGATGAT; SEQ ID NO.4: GAAGGCTGGGGCTCATTT.

[0070] The results of RT-qPCR detection of ILK expression level are shown in detail in Figure 6 as shown, where Figure 6The ordinate is the relative expression level normalized by GAPDH; LV-control on the abscissa represents the group of bone marrow mesenchymal stem cells transfected with LV-control empty lentivirus, and LV-ILK on the abscissa represents the group of bone marrow mesenchymal stem cells transfected with LV-ILK lentivirus.

[0071] From Figure 6 It can be seen that the mRNA expression level of ILK in the LV-ILK group is significantly higher than that in the LV-control group. The above indicates that transfection of BMSCs with the slow virus can significantly overexpress the ILK gene for subsequent extraction of exosomes.

[0072] 2.4 Verification of high expression of ILK in BMSCs by Western blot

[0073] Western blot detection method: Proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to a polyvinylidene difluoride membrane. After blocking with 5% skim milk, the membrane was incubated overnight at 4 °C with antibodies against GAPDH (1:2000) and ILK (1:1000). Then the membrane was washed 3 times with PBS for 10 minutes each time and incubated with the appropriate secondary antibody (1:4000) in 2% skim milk for 2 hours. The bands were processed using an enhanced chemiluminescence (ECL) kit, visualized using an Amersham Imager 600 imaging system (GE), and analyzed by densitometry.

[0074] Detection results: The results of detecting the protein expression level of ILI by Western blot are shown in Figure 7 As shown, from Figure 7 It can be seen that compared with the LV-control group, ILK is highly expressed in BMSCs after transfection with the LV-ILK lentivirus.

[0075] Example 3

[0076] Extraction and characterization of engineered exosomes

[0077] 3.1 Extraction of engineered exosomes

[0078] After overexpression of ILK in BMSCs, the cell supernatants of the LV-ILK group and the LV-control group were collected, and exosomes were extracted using a kit method. After overexpression of ILK in BMSCs, when BMSCs grew to 80% confluence, the cell supernatants of the LV-ILK group and the LV-control group were centrifuged and collected respectively, and exosomes were extracted using a kit method and divided into the EXO Control group and the EXO ILK group.

[0079] Specifically: When BMSCs grow and fuse to 80%, centrifuge at 300 g and 4°C for 15 min, and aspirate the supernatant for the first time; centrifuge the supernatant aspirated for the first time at 4000 g and 4°C for 30 min, and aspirate the supernatant for the second time; centrifuge the supernatant aspirated for the second time at 10000 g and 4°C for 40 min, and aspirate the supernatant for the third time; transfer the supernatant aspirated for the third time to an ultrafiltration tube, concentrate it by centrifuging at 4000 g and 4°C for 30 min, mix it with the reagent of the ExoQuick kit at a ratio of 4 - 5:1, incubate overnight at 4°C, centrifuge at 1500 g and 4°C for 30 min, pour out the supernatant and retain the precipitate, add PBS, centrifuge at 1500 g and 4°C for 5 min, retain the precipitate, add PBS again to resuspend it, and obtain engineered exosomes.

[0080] 3.2 Detection of the expression of ILK, TSG101, and CD9 in engineered exosomes by Western blot

[0081] After adding RIPA lysis buffer to the two groups of exosomes extracted for denaturation, perform Western blot experiments to detect the expression of ILK and the exosome positive markers TSG101 and CD9. The results are shown in Figure 8 as follows.

[0082] Please refer to Figure 8 , Figure 8 for the protein level expression of ILK, TSG101, and CD9 in engineered exosomes. As Figure 8 shown, both the EXO Control group and the EXO ILK group of exosomes expressed the positive markers CD9 and TSG101, while ILK-FLAG was only expressed in EXO ILK , indicating that the purity of the extracted engineered exosomes meets the requirements and ILK protein is enriched.

[0083] 3.3 Characterization of the particle size distribution of engineered exosomes by dynamic light scattering (DLS) technology

[0084] The specific method is as follows: Take 500 μL of the freshly extracted exosomes (1.0 - 2.0 μg / μL) on the same day and place them in a cuvette, then add 500 μL of PBS buffer to make up the liquid volume to 1 ml. During the operation, avoid generating bubbles. Slowly place the cuvette into the measurement cell, and use a Zetasizer Nano nanoparticle size analyzer for measurement and recording. The results are shown in Figure 9 and Figure 10 as follows.

[0085] Please refer to Figure 9 and Figure 10 , Figure 9 for the detection of EXO extracted by differential centrifugation by dynamic light scattering (DLS) technology ControlParticle size distribution of exosomes in the group Figure 10 It was the exosomes (EXO) extracted by differential centrifugation detected by dynamic light scattering (DLS) technology ILK Particle size distribution of exosomes in the group, from Figure 9 and Figure 10 It can be seen that for EXO Control group and EXO ILK group, the positions of the main peaks were 37.54 nm and 47.61 nm respectively, and these diameter sizes basically conformed to the diameter size of typical exosomes

[0086] It should be noted that Figure 9 and Figure 10 the abscissa is the particle size, with the unit of nanometer (nm), and the ordinate is the proportion of the light intensity corresponding to each particle size to the total scattered light intensity

[0087] 3.4 Observation of the physical morphology of engineered exosomes by transmission electron microscopy

[0088] The specific method was as follows: For the extracted exosomes (1.0 - 2.0 μg / μL), without freeze - thawing, take 10 - 20 μL of the exosome solution, drop it onto the copper grid, and fix it at room temperature for about 1 min. Use a clean filter paper to absorb the excess liquid. After the copper grid is completely dry, carefully drop 10 μL of uranyl acetate (concentration 2%) on the carbon grid and stain it at room temperature for about 1 min. After sucking dry the excess staining solution with a clean filter paper, bake it under a warm lamp for 5 min. Take pictures, observe, and record using a transmission electron microscope. Pay attention to avoiding light during observation. The results are shown in Figure 11 .

[0089] Please refer to Figure 11 , Figure 11 in which (a) is the transmission electron microscope (TEM) image of the EXO Control group, Figure 11 in which (b) is the transmission electron microscope (TEM) image of the EXO ILK group, Figure 11 The serum exosomes observed by transmission electron microscope (TEM) were shown to be a three - dimensional spherical structure with clear structure, which was the typical exosome morphology reported in the literature

[0090] Example 4

[0091] Explore the effects of engineered exosomes on the proliferation ability and osteogenic differentiation ability of BMSCs

[0092] 4.1 Observation of BMSCs uptake of exosomes by laser confocal microscopy

[0093] The specific method: Use PKH67 green fluorescent dye to label the EXO Control group and EXO ILKA group of purified exosomes was labeled. BMSCs were incubated with PKH67-labeled exosomes in a 37 °C incubator in the dark for 24 hours, fixed with 4% paraformaldehyde for 15 minutes, stained with DAPI for cell nuclei, and then the uptake signal of exosomes was observed using a laser confocal microscope (LSM 780, AxioObserver, Zeiss). The results are shown in Figure 12 .

[0094] Please refer to Figure 12 , Figure 12 For observing the uptake of human-derived BMSCs to exosomes by laser confocal microscopy, it can be seen that a large number of green fluorescent particles accumulate around the cell nuclei of BMSCs intervened with exosomes of the EXO Control group and the EXO ILK group, which proves that the engineered exosomes extracted in the present invention can be taken up by BMSCs.

[0095] 4.2 Cell proliferation experiment to detect the proliferation ability of BMSCs

[0096] Specific method: BMSCs (2000 cells per well) were seeded in a 96-well tissue culture plate. After 24 hours of cell culture, when BMSCs adhered completely, the medium was changed, and exosomes of the EXO Control group and the EXO ILK group were added for intervention, setting two intervention concentrations of 100 μg / mL and 150 μg / mL, and the total volume was 100 μL. At 1, 2, and 3 days after intervention, a mixed liquid prepared by mixing pre-made extracellular vesicle-free fetal bovine serum medium and CCK8 reagent at a ratio of 10:1 was added to the 96-well plate, placed in an incubator, and incubated in the dark for 4 hours. After the incubation ended, an enzyme-linked immunosorbent assay (ELISA) reader was used to detect the absorbance value (450 nm). After washing twice with PBS, the absorbance at 450 nm was measured. The results are shown in Figure 13 .

[0097] Please refer to Figure 13 , Figure 13 For the change in the proliferation ability of BMSCs detected by the CCK8 experiment after co-culture of engineered exosomes and BMSCs. The results show that at 1, 2, and 3 days, compared with the EXO Control group, the proliferation ability of the EXO ILK group increased significantly, and the proliferation-promoting ability of the 150 μg / mL group was significantly better than that of the 100 μg / mL group.

[0098] It should be noted that Figure 13 the abscissa is the number of days of time, and the ordinate is the absorbance value (450 nm).

[0099] 4.3RT-qPCR detection of the expression of osteogenic genes Collagen I and RUNX2

[0100] The engineered exosomes were co-cultured with BMSCs from osteoporosis patients. After 7 days of osteogenic induction, the expression of osteogenic genes Collagen I and RUNX2 was detected by RT-qPCR.

[0101] Specific method: The third generation BMSCs seeded in a 3.5 cm culture dish were observed under a microscope. When the cells had good growth morphology and covered about 90% of the bottom of the dish, osteogenic induction solution (containing 100 nM dexamethasone, 50 μM ascorbic acid, 10 mM sodium β-glycerophosphate, 1% (v / v) penicillin-streptomycin, 10% (v / v) fetal bovine serum without extracellular vesicles, and 89% (v / v) DMEM low-glucose medium) was added for induction. Control Group and EXO ILK Both groups were treated with 150 μg / mL engineered exosomes and kept in 37°C, 5% CO 2 In the cell culture box, the culture dish was wrapped with tin foil and cultured in the dark. After 7 days of osteogenic induction, the waste liquid was discarded and the residual culture medium was washed away with PBS buffer 3 times. Total cell RNA was extracted using TRIZOL, and real-time quantitative PCR experiments were performed after reversal to detect the changes in the mRNA levels of osteogenic marker genes Collagen I, RUNX2, and OCN after the intervention of engineered exosomes. The results are detailed in Figure 14 .

[0102] The upstream primer for RT-qPCR detection of Collagen I is shown in SEQ ID NO.5, and the downstream primer is shown in SEQ ID NO.6, wherein, SEQ ID NO.5: TGGCAAAGAAGGCGGCAAAGG; SEQ ID NO.6: AGGAGCACCAGCAGGACCATC.

[0103] The upstream primer for RT-qPCR detection of RUNX 2 is shown in SEQ ID NO.7, and the downstream primer is shown in SEQ ID NO.8, wherein, SEQ ID NO.7: AGGCAGTTCCCAAGCATTTCATCC; SEQ ID NO.8: TGGCAGGTAGGTGTGGTAGTGAG.

[0104] The upstream primer for RT-qPCR detection of OCN is shown in SEQ ID NO.9, and the downstream primer is shown in SEQ ID NO.10, wherein, SEQ ID NO.9: AGGGCAGCGAGGTAGTGAAGAG; SEQ ID NO.10: GGTCAGCCAACTCGTCACAGTC.

[0105] Please refer to Figure 14 , Figure 14 For the detection of the mRNA levels of osteogenic marker genes after osteogenic induction of BMSCs from osteoporosis patients intervened by engineered exosomes, compared with the EXO Control group, the expression levels of Collagen I, RUNX 2, and OCN in the EXO ILK group were significantly increased and statistically significant, which confirmed at the mRNA level that EXO ILK could promote the osteogenic differentiation of BMSCs from osteoporosis patients.

[0106] It should be noted that Figure 14 the ordinate is the relative expression level normalized by GAPDH.

[0107] 4.4 ALP staining for detecting alkaline phosphatase activity

[0108] The engineered exosomes were co-cultured with BMSCs from osteoporotic patients, and after 7 days of osteogenic induction, the alkaline phosphatase activity was detected by ALP staining.

[0109] Specific method: Observe the third-generation BMSCs inoculated in a 3.5 cm culture dish under a microscope. When the cell growth morphology is good and the number covers about 90% of the bottom of the dish, add osteogenic induction medium (containing 100 nM dexamethasone, 50 μM ascorbic acid, 10 mM β-glycerophosphate, 1% (v / v) penicillin-streptomycin, 10% (v / v) exosome-free fetal bovine serum, 89% (v / v) low-glucose DMEM medium) for induction. Both the EXO Control group and the EXO ILK group were intervened with 150 μg / mL engineered exosomes, and then continued to be placed in a 37 °C, 5% CO 2 cell incubator, and the culture dish was wrapped with tin foil and cultured in the dark. After 7 days of osteogenic induction, discard the waste liquid, wait for the PBS buffer to rinse 3 times to wash away the residual culture medium. Fix with 4% paraformaldehyde for 30 min and discard the fixative. Then perform alkaline phosphatase staining according to the ALP staining kit. After staining for 30 min, observe and photograph under an optical microscope, and the results are shown in detail in Figure 15 .

[0110] Please refer to Figure 15 , Figure 15 For the BMSCs from osteoporosis patients intervened by engineered exosomes, after osteogenic induction, the ALP staining results showed that compared with the EXO Control group, the alkaline phosphatase activity in the EXO ILK group increased.

[0111] 4.5 Detection of the expression of osteogenic genes Collagen I and RUNX2 by Western blot

[0112] The engineered exosomes were co-cultured with BMSCs from patients with osteoporosis. After osteogenic induction for 7 days, the expression of osteogenic genes Collagen I and RUNX2 was detected by Western blot.

[0113] Specific method: The third-generation BMSCs seeded in a 3.5 cm culture dish were observed under a microscope. When the cell growth morphology was good and the number covered about 90% of the bottom of the dish, osteogenic induction medium was added for induction. In the EXO Control group and the EXO ILK group, 150 μg / mL engineered exosomes were added for intervention, and an equal volume of PBS was used for intervention as a blank control. Then they were continued to be placed in a 37 °C, 5% CO 2 cell incubator, and the culture dish was wrapped with tin foil and cultured in the dark. After osteogenic induction for 7 days, the waste liquid was discarded, and the cells were rinsed 3 times with PBS buffer to wash away the residual medium. Total cell protein was extracted using RIPA lysis buffer. After protein denaturation, Western blot experiments were performed to detect the expression of osteogenic marker genes Collagen I and RUNX2. The results are shown in detail in Figure 16 .

[0114] Please refer to Figure 16 , Figure 16 For the detection of the protein levels of osteogenic marker genes after osteogenic induction of BMSCs from osteoporosis patients intervened with engineered exosomes. Compared with the EXO Control and PBS groups, the expression of Collagen I in the EXO ILK group was significantly up-regulated, which confirmed at the protein level that EXO ILK could promote the osteogenic differentiation of BMSCs from osteoporosis patients.

[0115] The above content is a further detailed description of the present invention in combination with specific preferred embodiments. It cannot be determined that the specific implementation of the present invention is only limited to these descriptions. For those of ordinary skill in the technical field to which the present invention belongs, without departing from the concept of the present invention, several simple deductions and substitutions can still be made, which should all be regarded as belonging to the protection scope of the present invention.

Claims

1. Application of engineered exosomes overexpressing protein ILK in the preparation of products promoting osteogenic differentiation.

2. The use according to claim 1, characterized in that: The engineered exosomes overexpressing the protein ILK are derived from human bone marrow mesenchymal stem cells.

3. The use according to claim 2, characterized in that: The engineered exosomes overexpressing the protein ILK are prepared by the following method: Step (1), transfecting the LV-ILK lentivirus into human bone marrow mesenchymal stem cells, and culturing them to obtain a culture product; Step (2), separating the culture product to obtain a supernatant, and extracting exosomes from the supernatant to obtain engineered exosomes that overexpress the protein ILK.

4. An engineered exosome overexpressing protein ILK, characterized in that: The engineered exosomes overexpressing the protein ILK are derived from human bone marrow mesenchymal stem cells.

5. A method for preparing engineered exosomes overexpressing protein ILK, characterized in that: The preparation method comprises the following steps: Step (1), transfecting the LV-ILK lentivirus into human bone marrow mesenchymal stem cells, and culturing them to obtain a culture product; Step (2), separating the culture product to obtain a supernatant, and extracting exosomes from the supernatant to obtain engineered exosomes that overexpress the protein ILK.

6. The preparation method according to claim 5, characterized in that: In the step (1), the MOI of lentiviral transfection is 50.

7. The preparation method according to claim 5, characterized in that: The step (2) specifically comprises: growing the BMSCs in the culture product to be fused to 80%, performing a first centrifugation to obtain a first supernatant; performing a second centrifugation on the first supernatant to obtain a second supernatant; The second supernatant was centrifuged for a third time to obtain a third supernatant; the third supernatant was concentrated and mixed with the ExoQuick kit reagent in a ratio of (4-5):1 and incubated at 4°C overnight; the product obtained by mixing overnight was centrifuged for a fourth time to obtain a first precipitate; PBS was added to the first precipitate, and then centrifuged for a fifth time to obtain a second precipitate; finally, the second precipitate was added to PBS and resuspended to obtain engineered exosomes.

8. The preparation method according to claim 7, characterized in that: The conditions for the first centrifugation include: 300g, 4°C centrifugation for 15 min; the conditions for the second centrifugation include: 4000g, 4°C centrifugation for 30 min; the conditions for the third centrifugation include: 10000g, 4°C centrifugation for 40 min; the conditions for concentration include: 4000g, 4°C centrifugation for 30 min; the conditions for the fourth centrifugation include: 500g, 4°C centrifugation for 30 min; the conditions for the fifth centrifugation include: 1500g, 4°C centrifugation for 5 min.

9. A method for promoting osteogenic differentiation of human bone marrow mesenchymal stem cells, characterized in that: The method comprises co-culturing the engineered exosomes overexpressing the ILK protein according to claim 4 or the engineered exosomes overexpressing the ILK protein prepared by the preparation method according to any one of claims 5 to 8 with BMSCs of osteoporosis patients.

10. The method for promoting osteogenic differentiation of human bone marrow mesenchymal stem cells according to claim 9, characterized in that: The co-culture is specifically as follows: BMSCs from osteoporosis patients are inoculated into a culture dish, and when the number of cells covers 90% of the bottom of the culture dish, osteogenic induction fluid is added for induction, and engineered exosomes overexpressing the protein ILK are added for intervention, and then the culture dish is continued to be placed in a cell culture incubator at 37°C and 5% CO2 for light-proof culture, wherein the culture time is more than 7 days.

Images