Fermentation method using acetic acid-producing carbon monoxide nutritional bacteria

Abstract

A process for producing at least one oxygen-containing product from a gaseous substrate comprising CO, CO2, and optionally H2 is disclosed. Also provided are methods of using fermentation broths lacking thiamine or thiazole-containing thiamine precursors as suitable screening tools for ethanol-producing acetogenic carbondotrophic bacteria strains, methods of operating syngas fermentation without the addition of thiamine and thiazole-containing thiamine precursors, methods of producing acetogenic carbondotrophic bacteria strains, methods of producing acetogenic carbondotrophic bacteria strains, methods of producing acetogenic carbondotrophic bacteria strains, methods of producing acetogenic carbondotrophic bacteria strains, methods of producing acetogenic carbondotrophic bacteria strains, and methods of producing acetogenic carbondotrophic bacteria strains. A method of controlling bacterial contamination in a bioreactor, and a method for preparing animal feed and fertilizer.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This patent application claims the benefit of co-pending U.S. Provisional Patent Application No. 63 / 369,683, filed on July 28, 2022, which is incorporated herein by reference in its entirety.

[0003] Incorporation by Reference of Electronically Submitted Materials

[0004] Incorporated herein by reference in its entirety is the computer-readable nucleotide / amino acid sequence listing filed concurrently and identified as follows: a 7,154-byte XML file named "766308.xml" created on January 5, 2023. Background Art

[0005] It is expected that bacteria will use fermentation to generate carbon monoxide (CO) and carbon dioxide (CO 2 ) and optionally hydrogen (H 2 ) gases, such as industrial waste gas or synthesis gas, into various products, such as fuels and chemicals. 2 and H 2 Acetogenic bacteria have been shown to require vitamin supplementation, including pantothenate (vitamin B5), thiamine (vitamin B1), and biotin (vitamin B7) to grow (Annan et al., Appl. Microbiol. Biotechnol., 103:4633-4648 (2019)). Providing vitamin supplements to the bacteria during large-scale fermentation can be expensive. Further, the removal of vitamin supplements reduces the chance of growth of contaminating microorganisms.

[0006] Therefore, there remains a need for methods to reduce the need for vitamin supplementation associated with continuous fermentation.Further, there is a need to reduce contamination in continuous fermentation. Summary of the invention

[0007] One embodiment of the present invention provides a method for preparing a composition comprising CO, CO 2 and optionally H 2 A method for producing at least one oxygen-containing product from a gaseous substrate, the method comprising: (a) providing to a bioreactor: (1) a gaseous substrate comprising CO, CO 2 and optionally H 2(a) providing conditions within the bioreactor such that the at least one acetogenic carboxydotrophic bacterium converts the gaseous substrate into at least one oxygen-containing product, wherein the at least one acetogenic carboxydotrophic bacterium comprises at least one gene selected from the group consisting of thiH, thiS, thiF, and thiG.

[0008] Another embodiment of the present invention provides a method for preparing a composition comprising CO, CO 2 and optionally H 2 A method for producing at least one oxygen-containing product from a gaseous substrate, the method comprising: (a) providing to a bioreactor: (1) a gaseous substrate comprising CO, CO 2 and optionally H 2 (a) providing conditions within the bioreactor such that the at least one acetogenic carboxydotrophic bacterium converts the gaseous substrate into at least one oxygenated product, wherein the at least one acetogenic carboxydotrophic bacterium does not require an exogenously supplied supply of thiamine or a thiazole-containing thiamine precursor.

[0009] Another embodiment of the present invention provides a method for operating a syngas fermentation without adding thiamine or a thiamine precursor containing thiazole, the method comprising: (a) providing to a bioreactor: (1) a syngas containing CO, CO 2 and optionally H 2 (a) providing conditions within the bioreactor such that the at least one acetogenic carboxydotrophic bacterium converts the gaseous substrate into at least one oxygenated product, wherein the conditions within the bioreactor produce a bioreactor fermentation broth and thiamine or a thiazole-containing thiamine precursor is not added to (i) the liquid nutrient medium or (ii) the bioreactor fermentation broth prior to or during syngas fermentation.

[0010] Another embodiment of the present invention provides a method for preparing a system comprising CO, CO 2 and optionally H 2 A method for producing at least one oxygen-containing product from a gaseous substrate, the method comprising: (a) providing to a bioreactor: (1) a gaseous substrate comprising CO, CO 2 and optionally H 2(a) providing conditions within the bioreactor such that the at least one acetogenic carboxydotrophic bacterium converts the gaseous substrate into at least one oxygen-containing product, wherein the at least one acetogenic carboxydotrophic bacterium comprises at least one gene (e.g., an exogenous gene) selected from the group consisting of thiH, thiS, thiF, and thiG.

[0011] Another embodiment of the present invention provides a method for using a fermentation broth lacking thiamine or a thiazole-containing thiamine precursor as a screening tool for suitable ethanologenic acetogenic carboxydotrophic bacterial strains, the method comprising: (a) providing to a bioreactor in the absence of thiamine or a thiazole-containing thiamine precursor: (1) a fermentation broth containing CO, CO 2 and optionally H 2 (a) providing conditions within the bioreactor such that the at least one acetogenic carboxydotrophic bacterium converts the gaseous substrate into at least one oxygenated product, wherein conversion of the gaseous substrate into at least one oxygenated product indicates the presence of a suitable ethanologenic acetogenic carboxydotrophic bacterial strain.

[0012] Another embodiment of the present invention provides a method for controlling bacterial contamination in a bioreactor, the method comprising: (a) providing to the bioreactor: (1) a mixture comprising CO, CO 2 and optionally H 2 (a) providing conditions within the bioreactor such that the at least one acetogenic carboxydotrophic bacterium converts the gaseous substrate into at least one oxygenated product, wherein the absence of an exogenously supplied thiamine or thiazole-containing thiamine precursor in the bioreactor prevents contamination of the bioreactor fermentation broth with undesirable acetogenic carboxydotrophic bacteria.

[0013] Additional aspects include methods for preparing animal feed and for preparing fertilizer. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 is a schematic diagram of the 11-step pathway involved in thiamine production.

[0015] Figure 2 Figure 2 shows the effect of acetogenic carboxydotrophic strain SB1 (one aspect of the invention) on H during fermentation after thiamine was removed from the growth medium. 2 , CO and CO 2The black arrow indicates when thiamine was removed from the growth medium.

[0016] Figure 3 is a graph showing ethanol and acetate titers produced by acetogenic carboxydotrophic bacteria strain SB1 during fermentation after thiamine was removed from the growth medium. The black arrow indicates when thiamine was removed from the growth medium.

[0017] Figure 4A is a schematic diagram of a plasmid construct for single crossover gene disruption according to one aspect of the present invention. The jagged regions to the left of thiS and to the right of thiF indicate that thiS and thiF lack the 5' and 3' regions, respectively.

[0018] Figure 4B is an image showing a close-up of colonies present on a representative plate showing robust growth of the colonies in medium containing thiamine in accordance with an aspect of the present invention.

[0019] Figure 4C is an image of a PCR gel showing the presence of integration in the thiHSFG region according to an aspect of the present invention. Numbers 1-5 represent the 5 colonies tested.

[0020] Figure 4D The graph on the right shows the OD values ​​of the culture grown in the absence of thiamine. In summary, Figures 4A-4D It was shown that inactivation of SEQ ID NO: 1 (thiH), SEQ ID NO: 2 (thiS), SEQ ID NO: 3 (thiF) and SEQ ID NO: 4 (thiG) resulted in thiamine auxotrophy when fructose was used as the carbon source.

[0021] Figure 5A are images showing the growth of cells in culture medium using syngas as carbon source in the absence "-" or presence "+" of thiamine. SB1::pKO31 represents cells with an integrated plasmid in the thiHSFG region.

[0022] Figure 5B is a graph showing cell density (OD600) values ​​of SB1 and SB1::pKO31 mutants grown in the absence of thiamine. Figure 5A and 5BIt was shown that inactivation of SEQ ID NO: 1 (thiH), SEQ ID NO: 2 (thiS), SEQ ID NO: 3 (thiF) and SEQ ID NO: 4 (thiG) resulted in thiamine auxotrophy when syngas was used as the carbon source.

[0023] Fig. 6A Is a graph showing the growth of SB1::pKO31 cells in a bioreactor containing syngas as a carbon source. The cells were cultured and allowed to reach steady state in the presence of thiamine. Thiamine was then removed from the culture medium at 185 hours (black arrows) and compared to growth in the companion reactor in the presence of added thiamine.

[0024] Figure 6B It is shown that Fig. 6A The ethanol production rate under the same conditions. Fig. 6A and 6B It is shown that inactivation of SEQ ID NO: 1 (thiH), SEQ ID NO: 2 (thiS), SEQ ID NO: 3 (thiF) and SEQ ID NO: 4 (thiG) during steady-state growth in a bioreactor on syngas results in thiamine mixotrophy. DETAILED DESCRIPTION

[0025] One aspect of the present invention provides a method for preparing a composition comprising CO, CO 2 and optionally H 2 A method for producing at least one oxygen-containing product from a gaseous substrate, the method comprising: (a) providing to a bioreactor: (1) a gaseous substrate comprising CO, CO 2 and optionally H 2 (a) providing a gaseous substrate in the bioreactor such that the at least one acetogenic carboxydotrophic bacterium converts CO, CO 2 and optionally H 2 The conditions within the bioreactor produce a bioreactor fermentation broth.

[0026] Thiamine can be produced in bacteria via an 11-step pathway (see Figure 1 ). It is previously known that CO, CO 2 and optionally H 2Bacteria converted to at least one oxygen-containing product require thiamine to survive and produce oxygen-containing products. U.S. Patent No. 10,415,043 discloses the transformation of ethanol-producing Clostridium (Clostridium autoethanogenum) with thiamine biosynthesis protein (ThiC) (EC4.1.99.17) derived from Clostridium ragsdalei. This transformation allows ethanol-producing Clostridium to grow in the absence of thiamine. The method claimed herein is unexpected because, in addition to thiC, Clostridria (Clostridria) generally lacks thiG and thiH required for the thiazole component of synthesizing thiamine (Annan et al., Applied Microbiology and Biotechnology, 103: 4633-4648 (2019)). Annan et al. believe that these results indicate "the presence of unknown genes or unknown pathways that replace thiG and ThiH" (ibid., 4646). However, it has been unexpectedly discovered that members of the thiGSH pathway are present in syngas-utilizing Clostridia and that these microorganisms do not require supplementation with exogenous thiamine or thiazole-containing thiamine precursors for growth if thiC is also present.

[0027] This unexpected discovery has several advantages. One advantage is that adding thiamine or thiazole-containing thiamine precursors to a fermentation can be expensive, and not adding thiamine or thiazole-containing thiamine precursors can therefore save costs. In addition, some vitamins are sensitive to chemicals and temperature, and their use is undesirable due to process considerations and required design modifications. In addition, the acidity of HCl thiamine (a common form) may make the vitamin solution less stable, depending on the other components of the fermentation.

[0028] In one aspect, the at least one acetogenic carboxydotrophic bacterium comprises a sequence that is at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 86%, 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identical to any one of SEQ ID NOs: 1-4.

[0029] Tyrosine lyase (thiH) is encoded by a thiH gene. In one aspect, the at least one acetogenic carboxydotrophic bacterium comprises a sequence having at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 86%, 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% identity to thiH. In one aspect, the at least one acetogenic carboxydotrophic bacterium comprises a sequence having at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 86%, 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% identity to thiH.

[0030]

[0031] The ThiS carrier protein (thiS) is encoded by the thiS gene. In one aspect, the at least one acetogenic carbon monoxide trophic bacteria comprises a sequence having at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 86%, 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% identity to thiS. In one aspect, the at least one acetogenic carbon monoxide trophic bacteria comprises a sequence having at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 86%, 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% identity to thiS.

[0032] (ATGATTGTAAATGGAGAAGAATTAAATTTTGAGAACGATATAACTGTATCTCAATTGC TGAACAAGTTAAATGTAAATGAAGAAACAGTTGTAGTTGAAGTTGACTTAGAAATAG TAGACAGAGATGTCTATAAAACAAAAAAACTTTCAAGCACTTCCAAAGTAGAAGTTA TCCGTTATGTTGGAGGTGGC) a sequence having at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 86%, 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identity.

[0033] ThiS adenylyltransferase (thiF) is encoded by a thiF gene. In one aspect, the at least one acetogenic carboxydotrophic bacterium comprises a sequence that is at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 86%, 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identical to thiF. In one aspect, the at least one acetogenic carboxydotrophic bacterium comprises a sequence that is at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 86%, 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identical to SEQ ID NO: 3. In one aspect, the at least one acetogenic carboxydotrophic bacterium does not comprise SEQ ID NO: 3.

[0034] (ATGCCATTGACAGATAAAGAGCGTGAAAAGTATGCAAGACACCTAGTATTAAAAGA).

[0035] Thiazole synthase (thiG) is encoded by the thiG gene. In one aspect, the at least one acetogenic carbon monoxide trophic bacteria comprises a sequence having at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 86%, 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% identity to thiG. In one aspect, the at least one acetogenic carbon monoxide trophic bacteria comprises a sequence having at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 86%, 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% identity to thiG.

[0036] (ATGGATGAACTTGTAATAGCAAATAAAAAAATAAAAAGCAGATTTTTCATTGGAACA ) has a sequence at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 86%, 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identity.

[0037] In one aspect, the at least one acetogenic carboxydotrophic bacterium comprises thiH and thiS. In one aspect, the at least one acetogenic carboxydotrophic bacterium comprises thiH and thiF. In one aspect, the at least one acetogenic carboxydotrophic bacterium comprises thiH and thiG. In one aspect, the at least one acetogenic carboxydotrophic bacterium comprises thiS and thiF. In one aspect, the at least one acetogenic carboxydotrophic bacterium comprises thiS and thiG. In one aspect, the at least one acetogenic carboxydotrophic bacterium comprises thiF and thiG.

[0038] In one aspect, the at least one acetogenic carboxydotrophic bacteria comprises thiH, thiS, and thiF. In one aspect, the at least one acetogenic carboxydotrophic bacteria comprises thiS, thiF, and thiG. In one aspect, the at least one acetogenic carboxydotrophic bacteria comprises thiH, thiS, and thiG. In one aspect, the at least one acetogenic carboxydotrophic bacteria comprises thiH, thiF, and thiG. In another aspect, the at least one acetogenic carboxydotrophic bacteria comprises thiH, thiS, thiF, and thiG.

[0039] In one aspect, thiH, thiS, thiF or thiG are endogenous genes. In one aspect, the at least one acetogenic carboxydotrophic bacterium is engineered (e.g., by adding an appropriate promoter) to have greater expression of endogenous thiH, thiS, thiF and / or thiG than a non-engineered acetogenic carboxydotrophic bacterium.

[0040] On the one hand, the at least one acetogenic carboxydotrophic bacterium is recombinant. On the one hand, the at least one acetogenic carboxydotrophic bacterium is engineered to include at least one gene selected from the group consisting of thiH, thiS, thiF and thiG. On the one hand, thiH, thiS, thiF or thiG are foreign genes." foreign genes "are genes derived from outside the acetogenic carboxydotrophic bacterium of introducing the gene. Foreign genes can be derived from any suitable source, including but not limited to the acetogenic carboxydotrophic bacterium (for example, the parental acetogenic carboxydotrophic bacterium from which the recombinant acetogenic carboxydotrophic bacterium is derived), the bacterial strain or species of the acetogenic carboxydotrophic bacterium different from the acetogenic carboxydotrophic bacterium to be introduced, or they can be artificial or recombinantly produced. On the one hand, foreign genes are introduced to increase the expression of specific genes or overexpress specific genes (for example, by increasing the copy number of the gene, or introducing strong promoters or constitutive promoters to increase expression). On the other hand, the exogenous gene represents a gene that does not naturally occur in the acetogenic carboxydotrophic bacteria, but the gene is introduced into the acetogenic carboxydotrophic bacteria, and the acetogenic carboxydotrophic bacteria allow the expression of products that do not naturally occur in the acetogenic carboxydotrophic bacteria or the increased expression of genes inherent to the acetogenic carboxydotrophic bacteria (for example, in the case of the introduction of regulatory elements such as promoters). The exogenous gene can be suitable for integration into the genome of the acetogenic carboxydotrophic bacteria into which the exogenous gene is to be introduced.

[0041] In one aspect, the at least one acetogenic carboxydotrophic bacterium is non-naturally occurring. As used herein, "non-naturally occurring" refers to an acetogenic carboxydotrophic bacterium that has been artificially modified and has at least one genetic modification that is not found in a naturally occurring strain of a reference species (i.e., not found in a wild-type strain of the reference species).

[0042] In one aspect, the at least one acetogenic carboxydotrophic bacterium is a Clostridium bacterium.

[0043] One aspect of the present invention provides a method for preparing a composition comprising CO, CO 2 and optionally H 2 A method for producing at least one oxygen-containing product from a gaseous substrate, the method comprising: (a) providing to a bioreactor: (1) a gaseous substrate comprising CO, CO 2 and optionally H 2(a) providing conditions within the bioreactor such that the at least one acetogenic carboxydotrophic bacterium converts the gaseous substrate into at least one oxygenated product, wherein the at least one acetogenic carboxydotrophic bacterium does not require thiamine or a thiazole-containing thiamine precursor, and wherein the conditions within the bioreactor produce a bioreactor fermentation broth.

[0044] As used herein, "thiamine or a thiazole-containing thiamine precursor" includes compounds containing a thiazole moiety.

[0045] As used herein, "thiazole-containing thiamine precursor" refers to a thiazole compound that serves as a precursor in the biosynthesis of thiamine.

[0046] One aspect of the present invention provides a method for operating a syngas fermentation without adding thiamine or a thiamine precursor containing thiazole, the method comprising: (a) providing to a bioreactor: (1) a thiamine containing CO, CO 2 and optionally H 2 (a) a gaseous substrate, (b) at least one acetogenic carboxydotrophic bacterium, and (c) a liquid nutrient medium without thiamine or a thiamine precursor containing thiazole; and (d) providing a liquid nutrient medium in the bioreactor such that the at least one acetogenic carboxydotrophic bacterium converts CO, CO 2 and optionally H 2 The invention relates to a bioreactor comprising: a bioreactor comprising: a syngas fermentation reactor, wherein the conditions within the bioreactor produce a bioreactor fermentation broth and thiamine or a thiazole-containing thiamine precursor is not added to (i) the liquid nutrient medium or (ii) the bioreactor fermentation broth prior to or during syngas fermentation.

[0047] As used herein, thiamine includes thiamine salts including thiamine hydrochloride, thiamine mononitrate, and thiamine nitrate.

[0048] One aspect of the present invention provides a method for preparing a composition comprising CO, CO 2 and optionally H 2 A method for producing at least one oxygen-containing product from a gaseous substrate, the method comprising: (a) providing to a bioreactor: (1) a gaseous substrate comprising CO, CO 2 and optionally H 2(a) providing conditions within the bioreactor such that the at least one acetogenic carboxydotrophic bacterium converts the gaseous substrate into at least one oxygen-containing product, wherein the at least one acetogenic carboxydotrophic bacterium comprises at least one gene (e.g., an exogenous gene) selected from the group consisting of thiH, thiS, thiF, and thiG.

[0049] One aspect of the present invention provides a method for using a fermentation broth lacking thiamine or a thiazole-containing thiamine precursor as a screening tool for suitable ethanologenic acetogenic carboxydotrophic bacterial strains, the method comprising: (a) providing to a bioreactor in the absence of thiamine or a thiazole-containing thiamine precursor: (1) a fermentation broth containing CO, CO 2 and optionally H 2 (a) providing conditions within the bioreactor such that the at least one acetogenic carboxydotrophic bacterium converts the gaseous substrate into at least one oxygen-containing product, wherein the CO, CO 2 and optionally H 2 Conversion to at least one oxygenated product indicates the presence of a suitable ethanologenic acetogenic carboxydotrophic bacterial strain.

[0050] One aspect of the present invention provides a method for controlling bacterial contamination in a bioreactor, the method comprising: (a) providing to the bioreactor in the absence of thiamine or a thiamine precursor containing thiazole: (1) a mixture containing CO, CO 2 and optionally H 2 (a) providing conditions within the bioreactor such that the at least one acetogenic carboxydotrophic bacterium converts the gaseous substrate into at least one oxygenated product, wherein the absence of an exogenously supplied thiamine or thiazole-containing thiamine precursor in the bioreactor prevents contamination of the bioreactor fermentation broth with undesirable acetogenic carboxydotrophic bacteria.

[0051] As used herein, "does not contain thiamine or thiazole-containing thiamine precursors" and "absence of thiamine or thiazole-containing thiamine precursors" means that less than 0.05 mg of thiamine or thiazole-containing thiamine precursors are present per 100 L of fermentation broth.

[0052] As used herein, "exogenously supplied thiamine or thiazole-containing thiamine precursor" means that thiamine and thiazole-containing thiamine precursor are not added to the fermentation broth, bioreactor or liquid nutrient medium.

[0053] In one aspect, no more than 0.05 mg of thiamine or thiazole-containing thiamine precursor is added per 100 L of bioreactor or fermentation broth. In this aspect, no more than about 0.05 mg, about 0.06 mg, about 0.07 mg, about 0.08 mg, about 0.09 mg, about 0.1 mg, about 0.2 mg, about 0.3 mg, or about 0.4 mg of thiamine is added per 100 L of bioreactor or fermentation broth.

[0054] In one aspect, no more than 0.05 mg of thiamine or a thiazole-containing thiamine precursor is added to the bioreactor or fermentation broth per 100 L. In this aspect, no more than about 0.05 mg, about 0.06 mg, about 0.07 mg, about 0.08 mg, about 0.09 mg, about 0.1 mg, about 0.2 mg, about 0.3 mg, or about 0.4 mg of a thiazole-containing compound is added to the bioreactor or fermentation broth per 100 L.

[0055] In one aspect, the oxygenated product is acetic acid ("acetic acid" and "acetate" are used interchangeably herein), butyrate, butanol, propionate, and propanol. In one aspect, the oxygenated product is ethanol.

[0056] On the one hand, including CO, CO 2 and optionally H 2 The gaseous substrate is a synthesis gas (syngas), such as that obtained by gasification of coal or refinery residues, gasification of biomass or lignocellulosic materials or reforming of natural gas. On the other hand, the synthesis gas can be obtained from the gasification of municipal solid waste or industrial solid waste.

[0057] The gaseous substrate may contain at least CO, such as about 1, about 2, about 5, about 10, about 20, about 30, about 40, about 50, about 60, about 70, about 80, about 90, or about 100 mol% CO. The gaseous substrate may contain a range of CO, such as about 20 to about 80, about 30 to about 70, or about 40 to about 60 mol% CO. Preferably, the substrate contains about 40 to about 70 mol% CO (e.g., steel mill or blast furnace gas), about 20 to about 30 mol% CO (e.g., basic oxygen furnace gas), or about 15 to about 45 mol% CO (e.g., synthesis gas). In some aspects, the gaseous substrate may contain relatively low amounts of CO, such as about 1 to about 10 or about 1 to about 20 mol% CO. In some aspects, the gaseous substrate contains no or substantially no (< about 1 mol%) CO.

[0058] The gaseous substrate may optionally contain H 2 For example, the gaseous substrate may contain about 1, about 2, about 5, about 10, about 15, about 20, or about 30 mol % H2 In some aspects, the gaseous substrate may contain a relatively high amount of H 2 , such as about 60, about 70, about 80, or about 90 mol % H 2 In another aspect, the gaseous substrate contains no or substantially no (< about 1 mol %) H 2 (e.g. when originating from steel mill gases). 2 can be derived from or generated by any suitable method, including using an electrode to form H 2 .

[0059] The gaseous substrate may comprise CO 2 For example, the gaseous substrate can comprise about 1 to about 80, about 1 to about 70, about 1 to about 60, about 1 to about 50, about 1 to about 40, about 1 to about 30, about 1 to about 25, about 1 to about 20, about 1 to about 15, about 1 to about 10, about 1 to about 5, about 1 to about 4, about 1 to about 3, or about 2 to about 3 mol % CO 2 In some aspects, the gaseous substrate can contain less than about 20, about 15, about 10, or about 5 mol % CO 2 In another aspect, the gaseous substrate contains no or substantially no (< about 1 mol %) CO 2 .

[0060] In one aspect, the at least one acetogenic carboxydotrophic bacteria is cultured in the bioreactor to produce an acetogenic carboxydotrophic bacteria culture. In one aspect, the acetogenic carboxydotrophic bacteria culture continuously produces at least one oxygenated product for more than about 24 hours, about 36 hours, about 48 hours, about 72 hours, about 96 hours, about 120 hours, about 144 hours, about 168 hours, about 192 hours, about 216 hours, about 250 hours, about 300 hours, about 400 hours, about 500 hours, about 600 hours, about 700 hours, about 800 hours, about 900 hours, about 1,000, 1,100 hours, about 1,200 hours, about 1,300 hours, about 1,400 hours, about 1,500 hours, about 1,600 hours, about 1,700 hours, about 1,800 hours, about 1,900 hours, about 2,000 hours, about 2,500 hours, or about 3,000 hours.

[0061] In one aspect, the acetogenic carboxydotrophic culture continuously produces at least about 0.1 g / L / day of the at least one oxygenated product (e.g., at least about 0.1 g / L / day, at least about 0.2 g / L / day, at least about 0.3 g / L / day, at least about 0.4 g / L / day, at least about 0.5 g / L / day, at least about 0.6 g / L / day, at least about 0.7 g / L / day, at least about 0.8 g / L / day, , at least about 0.9 g / L / day, at least about 1 g / L / day, at least about 1.1 g / L / day, at least about 1.2 g / L / day, at least about 1.3 g / L / day, at least about 1.4 g / L / day, at least about 1.5 g / L / day, at least about 1.6 g / L / day, at least about 1.7 g / L / day, at least about 1.8 g / L / day, at least about 1.9 g / L / day, or at least about 2.0 g / L / day).

[0062] In one aspect, the method of the invention further comprises wherein said conditions within said bioreactor produce a bioreactor fermentation broth.

[0063] In one aspect, the method of the invention further comprises removing the bioreactor fermentation broth from the bioreactor to produce removed fermentation broth.

[0064] On the one hand, the method of the present invention further comprises removing at least one oxygenated product from the removed fermented liquid to produce a removed fermented liquid depleted of oxygenated products. Any method or combination of methods known in the art can be used to separate or purify oxygenated products from the fermented liquid, including, for example, fractionation, evaporation, pervaporation, stripping, phase separation, and extractive fermentation (including, for example, liquid-liquid extraction). In some aspects, the target product is recovered from the fermented liquid by continuously removing a portion of the fermented liquid from the bioreactor, recovering one or more oxygenated products from the fermented liquid, and separating cells (and components thereof) from the fermented liquid (e.g., filtering). For example, ethanol can be recovered by distillation.

[0065] In one aspect, the method of the present invention further comprises removing the cells (and components thereof) of the culture from the removed fermentation broth and / or the removed fermentation broth depleted of oxygen-containing products. The removal of the cells (and components thereof) can be carried out in any suitable manner, such as by cyclone separation, filtration or centrifugation. In one aspect, most (i.e., greater than 50%) cells (and components thereof) of the non-naturally occurring acetogenic carboxydotrophic bacteria culture are removed. In one aspect, the removed cells (and components thereof) of the acetogenic carboxydotrophic bacteria culture are removed from the removed fermentation broth before recovering one or more oxygen-containing products from the fermentation broth. In one aspect, the removed cells (and components thereof) of the acetogenic carboxydotrophic bacteria culture are removed from the removed fermentation broth after recovering one or more oxygen-containing products from the fermentation broth.

[0066] In one aspect, the method of the invention further comprises providing the removed fermentation broth depleted of oxygenated products to the bioreactor. Additional nutrients (e.g., non-thiamine B vitamins and metals) may be added to the removed fermentation broth to replenish the removed fermentation broth depleted of oxygenated products before returning the removed fermentation broth depleted of oxygenated products to the bioreactor.

[0067] In one aspect, at least about 1 gram, at least about 2 grams, at least about 3 grams, at least about 4 grams, at least about 5 grams, at least about 6 grams, at least about 7 grams, at least about 8 grams, at least about 9 grams, at least about 10 grams, at least about 11 grams, at least about 12 grams, at least about 13 grams, at least about 14 grams, at least about 15 grams, or at least about 20 grams, or at least about 25 grams, or at least about 30 grams, or at least about 35 grams, or at least about 40 grams, or at least about 45 grams, or at least about 50 grams, or at least about 55 grams, or at least about 60 grams, or at least about 65 grams, or at least about 70 grams, or at least about 75 grams, or at least about 80 grams, or at least about 85 grams, or at least about 90 grams, or at least about 95 grams, or at least about 100 grams, or about 1 to about 100 grams, or about 16 to about 20 grams of the at least one oxygenated product per liter of fermentation broth removed.

[0068] In one aspect, more than about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% of the removed fermentation broth depleted of the oxygenated product is provided back to the bioreactor. In this regard, about 1% to about 100% of the removed fermentation broth depleted of the oxygenated product is provided back to the bioreactor, for example, about 1% to about 30%, about 1% to about 35%, about 1% to about 40%, about 1% to about 45%, about 1% to about 50%, about 1% to about 55%, about 1% to about 60%, about 1% to about 65%, about 1% to about 70%, about 1% to about 75%, or about 1% to about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% of the removed fermentation broth is provided back to the bioreactor. In alternative aspects, about 50% to about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% of the removed fermentation broth depleted of oxygenated product is provided back to the bioreactor.

[0069] In one aspect, the fermentation is a co-culture and includes at least one acetogenic carboxydotrophic bacterium and another bacterium. In one aspect, the other bacterium is an acetogenic carboxydotrophic bacterium. In another aspect, the other bacterium is not an acetogenic carboxydotrophic bacterium. In one aspect, the other bacterium is a butyrate-producing bacterium (see, e.g., U.S. Patent No. 9,469,860 B2, which is incorporated herein by reference). In one aspect, the other bacterium is a propionate-producing bacterium (see, e.g., U.S. Patent Application No. 2014 / 0273123 A1, which is incorporated herein by reference).

[0070] Typically, fermentation is carried out in a bioreactor. The term "bioreactor" includes a culture / fermentation device composed of one or more containers, towers or piping arrangements, such as a continuous stirred tank reactor (CSTR), an immobilized cell reactor (ICR), a trickle bed reactor (TBR), a bubble column, an airlift fermenter, a static mixer or other containers or other devices suitable for gas-liquid contact. In some aspects, a bioreactor may include a first growth reactor and a second culture / fermentation reactor. Substrate may be provided in one or both of these reactors. As used herein, the terms "culture" and "fermentation" are used interchangeably. These terms cover the growth phase and product biosynthesis of a culture / fermentation process.

[0071] As used herein, "bioreactor" refers to a bioreactor assembly. A bioreactor assembly is a set of one or more containers suitable for containing aqueous fermentation broth and acetogenic carboxydotrophic bacteria for bioconversion. The bioreactor assembly may contain associated equipment such as injectors, recirculation loops, and agitators.

[0072] Any suitable bioreactor assembly may be used in the method of the present invention. The bioreactor assembly used in the method of the present invention may be a bioreactor assembly for the bioconversion of syngas, or the bioreactor assembly used in the method of the present invention may be separate from the bioreactor assembly for the bioconversion of syngas. The bioreactor assembly used in the method of the present invention includes, but is not limited to, a column reactor; a bubble column; a jet loop reactor; a stirred tank reactor; a fluidized bed reactor; a trickle bed reactor; a biofilm reactor, including but not limited to a membrane bioreactor; and a static mixing reactor, including but not limited to a tubular reactor. One or more bioreactors may be used, and when two or more bioreactors are used, the bioreactors may be operated in parallel or sequentially. The bioreactor assembly may, but does not always need to, include a heat exchanger; a solid separation unit operation, such as a centrifuge, a settling tank, and a filter; a gas / liquid separation unit operation; a pump; and equipment for monitoring and controlling the bioreactor assembly.

[0073] If desired, a separate bioreactor assembly can be integrated into a facility for bioconverting syngas into oxygenated organic compounds. For example, where the facility contains a distillation assembly, the distillation assembly can be used to remove at least a portion of the oxygenated product and denature the aqueous fermentation broth.

[0074] As used herein, "biomass" refers to living or previously living (e.g., recently living) biological materials, including plants and animals, and containing at least hydrogen, oxygen and carbon. Biomass also typically contains nitrogen, phosphorus, sulfur, sodium, potassium and trace metals. The chemical composition of biomass may vary depending on the source, and may even vary within a source. The sources of biomass include, but are not limited to, collected plants, such as wood, grass clippings and yard waste, switchgrass, corn (including corn stalks), sorghum, sugarcane (including bagasse), etc., and wastes such as garbage and municipal solid waste. Biomass does not include fossil fuels such as coal, natural gas and oil.

[0075] Fossil carbonaceous materials or fossil fuels include, but are not limited to, natural gas; petroleum, including carbonaceous streams from petroleum refining or other processing including, but not limited to, petroleum coke, lignite, and coal.

[0076] As used herein, "aqueous broth" or "aqueous fermentation broth" refers to a liquid aqueous phase that may contain dissolved compounds including, but not limited to, hydrogen, carbon monoxide, and carbon dioxide.

[0077] Intermittently means from time to time and may be at regular or irregular time intervals.

[0078] Synthesis gas means a gas containing at least one of hydrogen and carbon monoxide, regardless of its source, and can and typically does contain carbon dioxide.

[0079] Synthesis gas can be made from many carbonaceous raw materials. These raw materials include sources of hydrocarbons, such as natural gas, biogas, biomass (particularly woody biomass), gases produced by reforming hydrocarbonaceous materials, peat, petroleum coke, coal, waste materials (such as waste materials from construction and demolition waste, etc.), municipal solid waste and landfill gas. Synthesis gas is usually produced by a gasifier or a reformer (steam, self-heating or partial oxidation). Any of the aforementioned biomass sources is suitable for producing synthesis gas. The synthesis gas thus produced will generally contain about 10 to about 60 mol % CO, at least about 1 mol % CO, and at least about 1 mol % CO. 2 , and preferably about 35 to about 65 mol % H 2 The synthesis gas may also contain N 2 and CH 4 As well as trace components such as H 2 S, COS, NH 3And HCN.Other sources of gaseous substrates include gases produced during oil and petrochemical processing and gases produced in industrial processes.These gases can have compositions significantly different from common synthesis gas, and can be substantially pure hydrogen or substantially pure carbon monoxide.The gaseous substrate can be obtained directly from gasification or from oil and petrochemical processing or industrial processes, or can be obtained by blending two or more streams.And, the gaseous substrate can be treated to remove or change the composition, including but not limited to removing components by chemical or physical adsorption, membrane separation and selective reaction.

[0080] The product oxygenated organic compounds produced in the methods of the present invention will depend on the acetogenic carboxydotrophic bacteria or combination of acetogenic carboxydotrophic bacteria used in the fermentation and the fermentation conditions.

[0081] The aqueous fermentation broth is maintained under anaerobic fermentation conditions, including a suitable temperature, for example, in the range of about 25° C. to about 60° C., or in the range of about 30° C. to about 40° C. The fermentation conditions, including the density of the acetogenic carboxydotrophic bacteria and the composition of the aqueous fermentation broth, are preferably sufficient to achieve the desired conversion efficiency of hydrogen and carbon monoxide. The pH of the aqueous fermentation broth is acidic, for example, between about 4 and about 6.5.

[0082] The rate of supplying the synthesis gas to the bioreactor under steady-state conditions preferably matches the rate at which carbon monoxide and hydrogen are transferred to the liquid phase with the rate at which carbon monoxide and hydrogen are bioconverted. The rate at which carbon monoxide and hydrogen are consumed will be affected by the properties of the acetogenic carboxytoxide-producing bacteria, the concentration of the acetogenic carboxytoxide-producing bacteria in the aqueous fermentation broth, and the fermentation conditions. Since the rate at which carbon monoxide and hydrogen are transferred to the aqueous fermentation broth is an operating parameter, conditions that affect the transfer rate, such as the interfacial surface area and the driving force between the gas phase and the liquid phase, are important. Preferably, the unstripped gas is introduced into the bioreactor in the form of microbubbles. Typically, the diameter of the microbubbles is in the range of about 0.01 to about 0.5 millimeters or about 0.02 to about 0.3 millimeters.

[0083] In another aspect, the present disclosure provides a method for preparing an animal feed. As used herein, the animal feed can be any suitable type of animal feed, for example, an aquatic culture (fish feed), poultry feed, cattle feed, pig feed, bird feed, etc. In one aspect, the at least one acetogenic carboxydotrophic bacteria and / or acetogenic carboxydotrophic bacteria culture can be effectively used as an animal feed. In another aspect, the present disclosure provides a method for preparing an animal feed, the method comprising: providing to a bioreactor: (1) a mixture containing CO, CO 2 and optionally H 2(1) a bioreactor containing at least one acetogenic carbon monoxide trophic bacterium, wherein the at least one acetogenic carbon monoxide trophic bacterium comprises at least one gene selected from the group consisting of thiH, thiS, thiF, and thiG, and (2) a gaseous substrate, (3) a liquid nutrient medium; providing conditions within the bioreactor such that the at least one acetogenic carbon monoxide trophic bacterium converts the gaseous substrate into at least one oxygen-containing product; and removing the at least one acetogenic carbon monoxide trophic bacterium from the bioreactor, wherein the at least one acetogenic carbon monoxide trophic bacterium is effective as an animal feed. In another aspect, the present disclosure provides a method for preparing an animal feed, the method comprising: providing to a bioreactor: (1) a bioreactor containing CO, CO in the absence of thiamine or a thiamine precursor containing thiazole. 2 and optionally H 2 The invention relates to a bioreactor comprising: a bioreactor comprising: (1) a gaseous substrate, (2) at least one acetogenic carboxydotrophic bacterium, and (3) a liquid nutrient medium; providing conditions within the bioreactor such that the at least one acetogenic carboxydotrophic bacterium converts the gaseous substrate into at least one oxygen-containing product; and removing the at least one acetogenic carboxydotrophic bacterium from the bioreactor, wherein the at least one acetogenic carboxydotrophic bacterium is effective as an animal feed.

[0084] In some embodiments, the methods of preparing animal feed can be used to produce an aquatic culture containing relatively low amounts of one or more toxic metals, such as mercury, iron, nickel, and the like.

[0085] In another aspect, the present disclosure provides a method for preparing fertilizer. In one aspect, the at least one acetogenic carboxydotrophic bacterium and / or the acetogenic carboxydotrophic bacterium culture can be effectively used as a fertilizer. In another aspect, the present disclosure provides a method for preparing fertilizer, the method comprising: providing to a bioreactor: (1) a mixture containing CO, CO 2 and optionally H 2 (a) providing a bioreactor containing at least one acetogenic carboxydotrophic bacterium, wherein the at least one acetogenic carboxydotrophic bacterium comprises at least one gene selected from the group consisting of thiH, thiS, thiF, and thiG, and (b) providing conditions within the bioreactor such that the at least one acetogenic carboxydotrophic bacterium converts the gaseous substrate into at least one oxygen-containing product; and (c) removing the at least one acetogenic carboxydotrophic bacterium from the bioreactor, wherein the at least one acetogenic carboxydotrophic bacterium is useful as a fertilizer. In another aspect, the present disclosure provides a method for preparing a fertilizer, the method comprising: providing to a bioreactor: (1) a nutrient medium comprising CO, CO , and a thiamine precursor comprising thiamine or thiazole in the absence of thiamine or thiamine precursor comprising thiazole. 2 and optionally H 2The invention relates to a bioreactor comprising: a bioreactor comprising: (1) a gaseous substrate, (2) at least one acetogenic carboxydotrophic bacterium, and (3) a liquid nutrient medium; providing conditions within the bioreactor such that the at least one acetogenic carboxydotrophic bacterium converts the gaseous substrate into at least one oxygen-containing product; and removing the at least one acetogenic carboxydotrophic bacterium from the bioreactor, wherein the at least one acetogenic carboxydotrophic bacterium is effective as a fertilizer.

[0086] In one aspect, the at least one acetogenic carboxydotrophic bacteria and / or the acetogenic carboxydotrophic bacteria culture can be effective as a fertilizer or animal feed for landfill applications or land applications. In one aspect, the at least one acetogenic carboxydotrophic bacteria and / or the acetogenic carboxydotrophic bacteria culture that can be used for fertilizer, animal feed, landfill applications and / or land applications contains protein, fat, carbohydrates and / or minerals, such as 86% protein, 2% fat, 2% minerals, 10% carbohydrates. The at least one acetogenic carboxydotrophic bacteria and / or the acetogenic carboxydotrophic bacteria culture can be effective as a fertilizer for landfill applications (e.g., for Class A solids), land applications or animal feed, such as aquatic cultures (fish feed), poultry feed, cattle feed, pig feed, etc. In the case of fish feed, advantageously, in some embodiments, the fish feed contains less total amount of toxic metals than conventional fish feed.

[0087] In some aspects, the at least one acetogenic carboxydotrophic bacteria and / or the acetogenic carboxydotrophic bacteria culture contains about 25 to about 50 wt.% solids, such as about 25 to about 40 wt.% solids. Such amounts of recovered solids are advantageous because they contain proteins, carbohydrates, minerals, and vitamins that are potentially of nutritional value to plants and animals.

[0088] The at least one acetogenic carboxytoxide-producing bacteria and / or the acetogenic carboxytoxide-producing bacteria culture can be used wet or dry. For example, in some aspects, the at least one acetogenic carboxytoxide-producing bacteria and / or the acetogenic carboxytoxide-producing bacteria culture can be effectively used as a wet fertilizer. In some aspects, the method further includes drying the at least one acetogenic carboxytoxide-producing bacteria and / or the acetogenic carboxytoxide-producing bacteria culture to form a "dried filter cake", and the resulting dried filter cake can be effectively used as a dry fertilizer, animal feed or fish feed or any combination thereof. The drying of the at least one acetogenic carboxytoxide-producing bacteria and / or the acetogenic carboxytoxide-producing bacteria culture can also be used as a means of concentrating the at least one acetogenic carboxytoxide-producing bacteria and / or the acetogenic carboxytoxide-producing bacteria culture. However, the removed at least one acetogenic carboxytoxide-producing bacteria and / or the acetogenic carboxytoxide-producing bacteria culture can be dried using any suitable means.

[0089] The corresponding compositions of the animal feed and fertilizer are roughly similar because they are mainly composed of microbial protein and / or carbohydrates. In some embodiments, animal feed and / or fertilizer contain protein (e.g., about 30wt.% to about 90wt.%, such as about 60wt.% to about 90wt.%), fat (e.g., about 1wt.% to about 12wt.%, such as about 1wt.% to about 3wt.%), carbohydrate (e.g., about 5wt.% to about 60wt.%, such as about 15wt.% to about 60wt.% or about 5wt.% to about 15wt.%) and / or minerals, such as sodium, potassium, copper, etc. (e.g., about 1wt.% to about 20wt.%, such as about 1wt.% to about 3wt.%). For example, animal feed and / or fertilizer can contain about 86% protein, about 2% fat, about 2% minerals and about 10% carbohydrates. Various aspects (including embodiments) of the subject matter described herein can be beneficial alone or in combination with one or more other aspects or embodiments. Without limiting the foregoing description, certain non-limiting aspects of the present disclosure are provided below, numbered 1-24. As will be apparent to one skilled in the art upon reading this disclosure, each individually numbered aspect may be used or combined with any preceding or following individually numbered aspect. This is intended to provide support for all such combinations of the aspects and is not limited to the combinations of aspects explicitly provided below:

[0090] (1) A method for preparing a composition comprising CO, CO 2 and optionally H 2 A method for producing at least one oxygen-containing product from a gaseous substrate comprising:

[0091] Provided to the bioreactor: (1) a mixture containing CO, CO 2 and optionally H 2 (2) at least one acetogenic carboxydotrophic bacterium, and (3) a liquid nutrient medium; and

[0092] providing conditions within the bioreactor such that the at least one acetogenic carboxydotrophic bacterium converts the gaseous substrate into at least one oxygen-containing product,

[0093] Wherein the at least one acetogenic carboxydotrophic bacterium comprises at least one gene selected from the group consisting of: thiH, thiS, thiF and thiG.

[0094] (2) The method according to aspect 1, wherein the at least one acetogenic carboxydotrophic bacterium comprises a sequence that is at least 90% identical to SEQ ID NO: 1 (thiH).

[0095] (3) The method according to aspect 1, wherein the at least one acetogenic carboxydotrophic bacterium comprises a sequence that is at least 90% identical to SEQ ID NO: 2 (thiS).

[0096] (4) The method according to aspect 1, wherein the at least one acetogenic carboxydotrophic bacterium comprises a sequence that is at least 90% identical to SEQ ID NO: 3 (thiF).

[0097] (5) The method according to aspect 1, wherein the at least one acetogenic carboxydotrophic bacterium comprises a sequence that is at least 90% identical to SEQ ID NO: 4 (thiG).

[0098] (6) The method according to aspect 1, wherein the at least one acetogenic carboxydotrophic bacterium comprises thiH, thiS, thiF and thiG.

[0099] (7) A method for preparing a composition comprising CO, CO 2 and optionally H 2 A method for producing at least one oxygen-containing product from a gaseous substrate comprising:

[0100] Provided to the bioreactor: (1) a mixture containing CO, CO 2 and optionally H 2 (2) at least one acetogenic carboxydotrophic bacterium, and (3) a liquid nutrient medium; and

[0101] providing conditions within the bioreactor such that the at least one acetogenic carboxydotrophic bacterium converts the gaseous substrate into at least one oxygen-containing product,

[0102] Wherein the at least one acetogenic carboxydotrophic bacterium does not require an exogenously supplied thiazole-containing compound.

[0103] (8) The method according to any one of aspects 1 to 7, wherein no more than 0.05 mg of thiamine or thiazole-containing thiamine precursor per 100 L is provided to the bioreactor.

[0104] (9) A method for operating a syngas fermentation without adding thiamine or a thiamine precursor containing thiazole, the method comprising:

[0105] Provided to the bioreactor: (1) a mixture containing CO, CO 2 and optionally H 2 (2) at least one acetogenic carboxydotrophic bacterium, and (3) a liquid nutrient medium that does not contain thiamine or a thiamine precursor containing thiazole; and

[0106] providing conditions within the bioreactor such that the at least one acetogenic carboxydotrophic bacterium converts the gaseous substrate into at least one oxygen-containing product,

[0107] wherein the conditions within the bioreactor produce a bioreactor fermentation broth, and no thiamine or thiazole-containing thiamine precursor is added to (i) the liquid nutrient medium or (ii) the bioreactor fermentation broth prior to or during syngas fermentation.

[0108] (10) The method according to any one of aspects 1 to 9, wherein the at least one acetogenic carboxydotrophic bacterium is cultured in the bioreactor to produce an acetogenic carboxydotrophic bacterial culture.

[0109] (11) The method according to aspect 10, wherein the acetogenic carboxydotrophic bacterial culture continuously produces at least one oxygen-containing product for more than about 24 hours.

[0110] (12) The method according to any one of aspects 1 to 11, wherein the conditions within the bioreactor produce a bioreactor fermentation broth, and the at least one oxygen-containing product is extracted from the bioreactor fermentation broth.

[0111] (13) The method according to any one of aspects 1 to 12, wherein the at least one oxygen-containing product is ethanol.

[0112] (14) The method according to any one of aspects 1 to 13, wherein the at least one acetogenic carboxydotrophic bacterium is recombinant.

[0113] (15) The method according to aspect 14, wherein the at least one acetogenic carboxydotrophic bacterium is engineered to contain at least one gene selected from the group consisting of: thiH, thiS, thiF and thiG.

[0114] (16) A method for preparing a composition comprising CO, CO 2 and optionally H 2 A method for producing at least one oxygen-containing product from a gaseous substrate comprising:

[0115] (a) providing to a bioreactor: (1) a mixture containing CO, CO 2 and optionally H 2 (2) at least one acetogenic carboxydotrophic bacterium, and (3) a liquid nutrient medium; and

[0116] (b) providing conditions within the bioreactor such that the at least one acetogenic carboxydotrophic bacterium converts the gaseous substrate into at least one oxygen-containing product,

[0117] The at least one acetogenic carboxydotrophic bacterium comprises at least one exogenous gene selected from the group consisting of: thiH, thiS, thiF and thiG.

[0118] (17) A method for using a fermentation broth lacking thiamine or a thiazole-containing thiamine precursor as a screening tool for suitable ethanologenic acetogenic carboxydotrophic bacterial strains, the method comprising:

[0119] (a) providing to a bioreactor in the absence of thiamine or a thiamine precursor containing thiazole: (1) a mixture comprising CO, CO 2 and optionally H 2 (2) at least one acetogenic carboxydotrophic bacterium, and (3) a liquid nutrient medium; and

[0120] (b) providing conditions within the bioreactor such that the at least one acetogenic carboxydotrophic bacterium converts the gaseous substrate into at least one oxygen-containing product,

[0121] Wherein conversion of the gaseous substrate to at least one oxygenated product indicates the presence of a suitable ethanologenic acetogenic carboxydotrophic bacterial strain.

[0122] (18) A method for controlling bacterial contamination in a bioreactor, the method comprising:

[0123] (a) providing to a bioreactor in the absence of thiamine or a thiamine precursor containing thiazole: (1) a mixture comprising CO, CO 2 and optionally H 2 (2) at least one acetogenic carboxydotrophic bacterium, and (3) a liquid nutrient medium; and

[0124] (b) providing conditions within the bioreactor such that the at least one acetogenic carboxydotrophic bacterium converts the gaseous substrate into at least one oxygen-containing product,

[0125] The absence of exogenously supplied thiamine or thiazole-containing thiamine precursors in the bioreactor prevents contamination of the bioreactor fermentation broth with undesirable acetogenic carboxydotrophic bacteria.

[0126] (19) The method according to any one of aspects 1 to 18, wherein the at least one acetogenic carboxydotrophic bacterium is effective for use as animal feed.

[0127] (20) The method according to any one of aspects 1 to 18, wherein the at least one acetogenic carboxydotrophic bacterium is effective as a fertilizer.

[0128] (21) A method for preparing animal feed, the method comprising:

[0129] (a) providing to a bioreactor: (1) a mixture containing CO, CO 2 and optionally H 2 a gaseous substrate, (2) at least one acetogenic carboxydotrophic bacterium, wherein the at least one acetogenic carboxydotrophic bacterium comprises at least one gene selected from the group consisting of: thiH, thiS, thiF, and thiG, and (3) a liquid nutrient medium;

[0130] (b) providing conditions within the bioreactor such that the at least one acetogenic carboxydotrophic bacteria converts the gaseous substrate into at least one oxygenated product; and

[0131] (c) removing the at least one acetogenic carboxydotrophic bacterium from the bioreactor,

[0132] wherein the at least one acetogenic carboxydotrophic bacterium is effective for use as an animal feed.

[0133] (22) A method for preparing a fertilizer, the method comprising:

[0134] (a) providing to a bioreactor: (1) a mixture containing CO, CO 2 and optionally H 2 (2) at least one acetogenic carboxydotrophic bacterium, wherein the at least one acetogenic carboxydotrophic bacterium comprises at least one gene selected from the group consisting of: thiH, thiS, thiF, and thiG, and (3) a liquid nutrient medium;

[0135] (b) providing conditions within the bioreactor such that the at least one acetogenic carboxydotrophic bacteria converts the gaseous substrate into at least one oxygenated product; and

[0136] (c) removing the at least one acetogenic carboxydotrophic bacterium from the bioreactor,

[0137] wherein the at least one acetogenic carboxydotrophic bacterium is effective as a fertilizer.

[0138] (23) A method for preparing animal feed, the method comprising:

[0139] (a) providing to a bioreactor in the absence of thiamine or a thiamine precursor containing thiazole: (1) a mixture comprising CO, CO 2 and optionally H 2 a gaseous substrate, (2) at least one acetogenic carboxydotrophic bacterium, and (3) a liquid nutrient medium;

[0140] (b) providing conditions within the bioreactor such that the at least one acetogenic carboxydotrophic bacteria converts the gaseous substrate into at least one oxygenated product; and

[0141] (c) removing the at least one acetogenic carboxydotrophic bacterium from the bioreactor,

[0142] wherein the at least one acetogenic carboxydotrophic bacterium is effective for use as an animal feed.

[0143] (24) A method for preparing a fertilizer, the method comprising:

[0144] (a) providing to a bioreactor in the absence of thiamine or a thiamine precursor containing thiazole: (1) a mixture comprising CO, CO 2 and optionally H 2 a gaseous substrate, (2) at least one acetogenic carboxydotrophic bacterium, and (3) a liquid nutrient medium;

[0145] (b) providing conditions within the bioreactor such that the at least one acetogenic carboxydotrophic bacteria converts the gaseous substrate into at least one oxygenated product; and

[0146] (c) removing the at least one acetogenic carboxydotrophic bacterium from the bioreactor,

[0147] wherein the at least one acetogenic carboxydotrophic bacterium is effective as a fertilizer.

[0148] Example 1

[0149] This example demonstrates that the acetogenic carboxydotrophic bacteria strain SB1 produces acetate and ethanol during fermentation in a growth medium without thiamine or a thiazole-containing thiamine precursor.

[0150] In the presence of syngas (59% H 2 , 25% CO, 2.7% CO 2 and 12.5% ​​CH 4 ) was fermented using the acetogenic carboxydotrophic strain SB1. At 473 hours, thiamine was removed from the growth medium. Growth continued for an additional 327 hours, with H 2 , CO or CO 2 There was no change in the uptake ( Figure 2 ), and no reduction in ethanol or acetate production ( Figure 3 ). Figure 2 and 3 The black arrow in the graph indicates 473 hours (when thiamine was removed). These results indicate that strain SB1 can grow on syngas without the addition of thiamine or thiamine precursors.

[0151] Example 2

[0152] This example demonstrates that the gene sequences SEQ ID NO: 1 (thiH), SEQ ID NO: 2 (thiS), SEQ ID NO: 3 (thiF), and SEQ ID NO: 4 (thiG) are required for the thiamine prototrophy of strain SB1. Mutants predicted to disrupt the function of SEQ ID NO: 1 (thiH), SEQ ID NO: 2 (thiS), SEQ ID NO: 3 (thiF), and SEQ ID NO: 4 (thiG) were constructed by single crossover. A fragment containing a 3,508 bp fragment spanning the region from nucleotide 3 of SEQ ID NO: 2 (thiS) to nucleotide 562 of SEQ ID NO: 3 (thiF) was amplified by PCR. The fragment was cloned into a derivative of plasmid pMTL84151 (Heap et al., Journal of Microbiological Methods, 78(1): 79-85 (2009)) to form plasmid pKO31 ( Figure 4A ). Following single-crossover recombination between the plasmid and the corresponding gene on the chromosome, the plasmid is expected to integrate into the chromosome, resulting in the disruption of the predicted thiHSFG thiazole biosynthesis gene.

[0153] Plasmid pKO31 was introduced by conjugation and selected for single crossover integration using 2ug / ml thiamphenicol and counter-selected against the E. coli donor strain using 10ug / ml trimethoprim. After conjugation, multiple antibiotic-resistant colonies were isolated ( Figure 4B The colonies were then screened for plasmid integration ( Figure 4C ) and to demonstrate that the resulting colonies were not generated by tandem duplication of the entire region (data not shown).

[0154] Cells containing pKO31 integrated in the predicted thiamine gene region were then grown in Balch tubes in fructose medium (Mock et al., J. Bacteriol., 197(18):2965-2980 (2015)) and washed to remove any thiamine in the medium. The cells were then grown in the same medium in the presence or absence of thiamine. For strain SB1 carrying the pKO31 integration, robust growth was observed only in the presence of thiamine ( Figure 4D ; referred to as SB1::pKO31). Strain SB1 lacking the pKO31 insert grew well in the absence of thiamine ( Figure 2 and 3 ). The results showed that disruption of a predicted thiazole biosynthesis gene resulted in an inability to grow in medium lacking thiamine.

[0155] Example 3

[0156] This example shows that the gene sequences SEQ ID NO: 1 (thiH), SEQ ID NO: 2 (thiS), SEQ ID NO: 3 (thiF) and SEQ ID NO: 4 (thiG) are essential for the thiamine prototrophy of strain SB 1. As described in Example 2, a mutant (SB1::pKO31) was constructed by single crossover that was expected to disrupt the function of SEQ ID NO: 1 (thiH), SEQ ID NO: 2 (thiS), SEQ ID NO: 3 (thiF) and SEQ ID NO: 4 (thiG).

[0157] SB::pKO31 cells were then grown in flasks in fructose medium (Mock et al., Journal of Bacteriology, 197(18):2965-2980 (2015)) and the cells were washed to remove any thiamine in the medium. The cells were then grown in the same medium containing syngas in the presence or absence of thiamine ( Figure 5A and 5B ). Growth of SB1::pKO31 in syngas and thiamine was superior to growth in syngas medium lacking thiamine. Strain SB1 showed robust growth in syngas medium in the presence and absence of thiamine. These results indicate that disruption of predicted thiazole biosynthetic genes results in an inability to grow in medium lacking thiamine when syngas is used as a carbon source.

[0158] Example 4

[0159] This example shows that the gene sequences SEQ ID NO: 1 (thiH), SEQ ID NO: 2 (thiS), SEQ ID NO: 3 (thiF) and SEQ ID NO: 4 (thiG) are essential for the thiamine prototrophy of strain SB 1. As described in Example 2, a mutant SB1::pKO31 was constructed by single crossover, which is expected to disrupt the function of SEQ ID NO: 1 (thiH), SEQ ID NO: 2 (thiS), SEQ ID NO: 3 (thiF) and SEQ ID NO: 4 (thiG).

[0160] Cells containing SB1::pKO31 were then grown in fructose medium (Mock et al., Journal of Bacteriology, 197(18):2965-2980 (2015)) and used to inoculate the syngas reactor. The reactor was then allowed to reach steady state as described in Example 1 and 5 ug / ml thiamphenicol was added (to select for maintenance of the integrated plasmid). At 185 hours (arrow), thiamine was removed from the medium. Removal of thiamine from the medium feed resulted in an optical density (OD600) of ( Fig. 6A ) and ethanol production ( Figure 6B ). The results indicate that disruption of predicted thiazole biosynthetic genes results in a reduced ability to grow in medium lacking thiamine during steady-state continuous fermentation in syngas. Removal of thiamine did not affect the growth or productivity of strain SB1 lacking an integrated plasmid in the predicted thiazole biosynthetic genes (see Examples 1 and 2).

[0161] Although a decrease in growth and ethanol productivity was observed after thiamine was removed from the medium, this effect was less pronounced than that observed in tube / bottle experiments with fructose or syngas as carbon source. The reasons for this are unclear but may be related to the nature of the constructed mutations (which may retain low levels of thiFGSH function) and the slow growth associated with steady-state growth in the bioreactor (e.g., in fructose, the bacteria grew faster and therefore the changes in growth rate were observed to be faster).

[0162] All references, including publications, patent applications, and patents, cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein.

[0163] Unless otherwise indicated herein or clearly contradicted by the context, in the context of describing the present invention (especially in the context of the following claims), the use of the terms "a / an" and "the" and "at least one" and similar indicators should be interpreted as covering both the singular and the plural. Unless otherwise indicated herein or clearly contradicted by the context, the term "at least one" (e.g., "at least one of A and B") used after a list of one or more items should be interpreted as meaning one item (A or B) selected from the listed items or any combination of two or more items in the listed items (A and B). Unless otherwise stated, the terms "comprising", "having", "including" and "containing" should be interpreted as open terms (i.e., meaning "including but not limited to"). Unless otherwise indicated herein, the description of the range of values ​​herein is intended only to serve as a shorthand method of individually referring to each individual value falling within the range, and each individual value is incorporated into the specification as if it were individually described herein. Unless otherwise indicated herein or clearly contradicted by the context, all methods described herein can be performed in any suitable order. The use of any and all examples or exemplary language (e.g., "such as") provided herein is intended only to better describe the present invention and does not limit the scope of the present invention unless otherwise stated. Any language in this specification should not be construed as indicating any unclaimed element as necessary to practice the present invention.

[0164] Preferred embodiments and aspects of the present invention are described herein, including the best mode known to the inventor for implementing the present invention. After reading the foregoing description, changes in those preferred embodiments may become apparent to those of ordinary skill in the art. The inventor expects that the technician will adopt these changes when appropriate, and the inventor intends to practice the present invention in a manner different from the manner specifically described herein. Therefore, where applicable law permits, the present invention includes all modifications and equivalent forms to the subject matter recited in the appended claims. In addition, the present invention encompasses any combination of the above-mentioned elements in the case of all possible changes thereof, unless otherwise stated herein or otherwise clearly contradictory to the context.

Claims

1. A method comprising: comprising CO, CO 2 and optionally H 2 A method for producing at least one oxygen-containing product from a gaseous substrate include: (a) providing to a bioreactor: (1) a mixture containing CO, CO 2 and optionally H 2 (2) at least one acetogenic carboxydotrophic bacterium, and (3) a liquid nutrient medium; and (b) providing conditions within the bioreactor such that the at least one acetogenic carboxydotrophic bacterium converts the gaseous substrate into at least one oxygen-containing product, Wherein the at least one acetogenic carboxydotrophic bacterium comprises at least one gene selected from the group consisting of: thiH, thiS, thiF and thiG.

2. The method of claim 1, wherein the at least one acetogenic carboxydotrophic bacterium comprises a sequence that is at least 90% identical to SEQ ID NO: 1 (thiH).

3. The method of claim 1, wherein the at least one acetogenic carboxydotrophic bacterium comprises a sequence that is at least 90% identical to SEQ ID NO: 2 (thiS).

4. The method of claim 1, wherein the at least one acetogenic carboxydotrophic bacterium comprises a sequence having at least 90% identity to SEQ ID NO: 3 (thiF).

5. The method of claim 1, wherein the at least one acetogenic carboxydotrophic bacterium comprises a sequence at least 90% identical to SEQ ID NO: 4 (thiG).

6. The method of claim 1, wherein the at least one acetogenic carboxydotrophic bacterium comprises thiH, thiS, thiF, and thiG.

7. A method for preparing a product comprising CO, CO 2 and optionally H 2 A method for producing at least one oxygen-containing product from a gaseous substrate include: (a) providing to a bioreactor: (1) a mixture containing CO, CO 2 and optionally H 2 (2) at least one acetogenic carboxydotrophic bacterium, and (3) a liquid nutrient medium; and (b) providing conditions within the bioreactor such that the at least one acetogenic carboxydotrophic bacterium converts the gaseous substrate into at least one oxygen-containing product, Wherein the at least one acetogenic carboxydotrophic bacterium does not require exogenously supplied thiamine or thiazole-containing thiamine precursors.

8. The method according to any one of claims 1 to 7, wherein no more than 0.05 mg of thiamine or thiazole-containing thiamine precursor per 100 L is provided to the bioreactor.

9. A method for operating a syngas fermentation without adding thiamine or a thiamine precursor containing thiazole, said method include: (a) providing to a bioreactor: (1) a mixture containing CO, CO 2 and optionally H 2 (2) at least one acetogenic carboxydotrophic bacterium, and (3) a liquid nutrient medium that does not contain thiamine or a thiamine precursor containing thiazole; and (b) providing conditions within the bioreactor such that the at least one acetogenic carboxydotrophic bacterium converts the gaseous substrate into at least one oxygen-containing product, wherein the conditions within the bioreactor produce a bioreactor fermentation broth, and no thiamine or thiazole-containing thiamine precursor is added to (i) the liquid nutrient medium or (ii) the bioreactor fermentation broth prior to or during syngas fermentation.

10. The method according to any one of claims 1 to 9, wherein the at least one acetogenic carboxydotrophic bacterium is cultured in the bioreactor to produce an acetogenic carboxydotrophic bacterial culture.

11. The method of claim 10, wherein the acetogenic carboxydotrophic bacterial culture continuously produces at least one oxygenated product for more than about 24 hours.

12. The method of any one of claims 1 to 11, wherein the conditions within the bioreactor produce a bioreactor fermentation broth, and the at least one oxygenated product is extracted from the bioreactor fermentation broth.

13. The process according to any one of claims 1 to 12, wherein the at least one oxygenated product is ethanol.

14. The method of any one of claims 1 to 13, wherein the at least one acetogenic carboxydotrophic bacterium is recombinant.

15. The method of claim 14, wherein the at least one acetogenic carboxydotrophic bacterium is engineered to comprise at least one gene selected from the group consisting of: thiH, thiS, thiF, and thiG.

16. A method for preparing a product comprising CO, CO 2 and optionally H 2 A method for producing at least one oxygen-containing product from a gaseous substrate include: (a) providing to a bioreactor: (1) a mixture containing CO, CO 2 and optionally H 2 (2) at least one acetogenic carboxydotrophic bacterium, and (3) a liquid nutrient medium; and (b) providing conditions within the bioreactor such that the at least one acetogenic carboxydotrophic bacterium converts the gaseous substrate into at least one oxygen-containing product, Wherein the at least one acetogenic carboxydotrophic bacterium comprises at least one exogenous gene selected from the group consisting of: thiH, thiS, thiF and thiG.

17. A method of using a fermentation broth lacking thiamine or a thiazole-containing thiamine precursor as a screening tool for suitable ethanologenic acetogenic carboxydotrophic bacterial strains, the method include: (a) providing to a bioreactor in the absence of thiamine or a thiamine precursor containing thiazole: (1) a mixture comprising CO, CO 2 and optionally H 2 (2) at least one acetogenic carboxydotrophic bacterium, and (3) a liquid nutrient medium; and (b) providing conditions within the bioreactor such that the at least one acetogenic carboxydotrophic bacterium converts the gaseous substrate into at least one oxygen-containing product, Wherein conversion of the gaseous substrate to at least one oxygenated product indicates the presence of a suitable ethanologenic acetogenic carboxydotrophic bacterial strain.

18. A method for controlling bacterial contamination in a bioreactor, the method include: (a) providing to a bioreactor in the absence of thiamine or a thiamine precursor containing thiazole: (1) a mixture comprising CO, CO 2 and optionally H 2 (2) at least one acetogenic carboxydotrophic bacterium, and (3) a liquid nutrient medium; and (b) providing conditions within the bioreactor such that the at least one acetogenic carboxydotrophic bacterium converts the gaseous substrate into at least one oxygen-containing product, The absence of exogenously supplied thiamine or thiazole-containing thiamine precursors in the bioreactor prevents contamination of the bioreactor fermentation broth with undesirable acetogenic carboxydotrophic bacteria.

19. The method of any one of claims 1 to 18, wherein the at least one acetogenic carboxydotrophic bacterium is effective for use as animal feed.

20. The method of any one of claims 1 to 18, wherein the at least one acetogenic carboxydotrophic bacterium is effective as a fertilizer.

21. A method for preparing animal feed, the method include: (a) providing to a bioreactor: (1) a mixture containing CO, CO 2 and optionally H 2 (2) at least one acetogenic carboxydotrophic bacterium, wherein the at least one acetogenic carboxydotrophic bacterium comprises at least one gene selected from the group consisting of: thiH, thiS, thiF, and thiG, and (3) a liquid nutrient medium; (b) providing conditions within the bioreactor such that the at least one acetogenic carboxydotrophic bacterium converts the gaseous substrate into at least one oxygenated product; as well as (c) removing the at least one acetogenic carboxydotrophic bacterium from the bioreactor, wherein the at least one acetogenic carboxydotrophic bacterium is effective for use as an animal feed.

22. A method for preparing fertilizer, the method include: (a) providing to a bioreactor: (1) a mixture containing CO, CO 2 and optionally H 2 (2) at least one acetogenic carboxydotrophic bacterium, wherein the at least one acetogenic carboxydotrophic bacterium comprises at least one gene selected from the group consisting of: thiH, thiS, thiF, and thiG, and (3) a liquid nutrient medium; (b) providing conditions within the bioreactor such that the at least one acetogenic carboxydotrophic bacterium converts the gaseous substrate into at least one oxygenated product; as well as (c) removing the at least one acetogenic carboxydotrophic bacterium from the bioreactor, wherein the at least one acetogenic carboxydotrophic bacterium is effective as a fertilizer.

23. A method for preparing animal feed, the method include: (a) providing to a bioreactor in the absence of thiamine or a thiamine precursor containing thiazole: (1) a mixture comprising CO, CO 2 and optionally H 2 a gaseous substrate, (2) at least one acetogenic carboxydotrophic bacterium, and (3) a liquid nutrient medium; (b) providing conditions within the bioreactor such that the at least one acetogenic carboxydotrophic bacterium converts the gaseous substrate into at least one oxygenated product; as well as (c) removing the at least one acetogenic carboxydotrophic bacterium from the bioreactor, wherein the at least one acetogenic carboxydotrophic bacterium is effective for use as an animal feed.

24. A method for preparing fertilizer, the method include: (a) providing to a bioreactor in the absence of thiamine or a thiamine precursor containing thiazole: (1) a mixture comprising CO, CO 2 and optionally H 2 a gaseous substrate, (2) at least one acetogenic carboxydotrophic bacterium, and (3) a liquid nutrient medium; (b) providing conditions within the bioreactor such that the at least one acetogenic carboxydotrophic bacterium converts the gaseous substrate into at least one oxygenated product; as well as (c) removing the at least one acetogenic carboxydotrophic bacterium from the bioreactor, wherein the at least one acetogenic carboxydotrophic bacterium is effective as a fertilizer.

Images