Propionic acid engineering bacterium as well as construction method and application thereof

Abstract

The invention provides a propionic acid engineering bacterium as well as a construction method and application thereof. The strain is obtained by taking escherichia coli E.coli W3110 as an original strain through a gene modification method: a Lac l repressor protein gene lacl, a succinate dehydrogenase gene sdhA and an isocitrate lyase inhibitory factor gene iclR are knocked out from a genome, and the escherichia coli E.coli W3110 is obtained through a gene modification method. The method comprises the following steps of: replacing a promoter of methylmalonyl-coenzyme A carboxylase scpA on a genome with a Ptrc promoter, overexpressing a pTrc99a-RM25-1795-1792 plasmid in a constructed strain, knocking out a propionate-coenzyme A synthetase gene prpE, knocking out acs and prpC genes, and carrying out gene knockout; the operation for producing propionic acid by fermentation of the strain is simple, propionic acid can be directly synthesized by using a cheap carbon source, the yield reaches 8.53 g / L after 24 hours through fermentation culture in a 500mL shake flask, and the strain has a very good industrial application prospect.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to a propionic acid engineering bacterium, a construction method thereof, and an application thereof. Background Art

[0002] Propionic acid, also known as propanoic acid, is a short-chain saturated fatty acid. It is an important platform chemical and the main raw material for food preservatives and mold inhibitors. It can also be used in the production of beer, the preparation of nickel plating solutions, as well as microbial antibacterial agents, preservatives, artificial flavors, and drug precursors.

[0003] At present, industrial production of propionic acid is mainly through chemical synthesis methods, most of which use petrochemical products as raw materials and synthesize propionic acid through catalytic synthesis under heating and pressure. However, due to the non-renewability of petroleum raw materials, the development of propionic acid synthesis methods based on bio-based raw materials has received extensive attention.

[0004] The microbial fermentation method is the most commonly used method for biosynthesizing propionic acid. Using Propionibacterium as the main production strain, and using bio-based carbon sources such as glucose, glycerol, and lactic acid as substrates, propionic acid is synthesized through an anaerobic fermentation process. Although the research and industrial production of propionic acid fermentation have a long history, there are still the following technical problems in using Propionibacterium to produce propionic acid: (1) The end product propionic acid has a strong inhibitory effect on the fermentation strain, resulting in the difficulty of reaching the ideal level of propionic acid production; (2) Propionibacterium is an anaerobic bacterium. During anaerobic fermentation, due to insufficient energy supply, the growth rate of the bacteria is slow, resulting in a long fermentation cycle and ultimately affecting the production intensity of propionic acid; (3) The propionic acid fermentation broth contains by-products such as lactic acid, acetic acid, and succinic acid, resulting in low purity of the end product. Restricted by the lack of efficient genetic manipulation tools for Propionibacterium at present, the research on improving propionic acid production by genetic engineering transformation of Propionibacterium has progressed slowly.

[0005] In recent years, with the development of synthetic biology technology, scholars at home and abroad have carried out research on propionic acid synthesis from aspects such as reconstructing fermentation synthesis pathways in heterologous hosts and constructing new catalytic synthesis pathways, which has promoted the development of propionic acid biosynthesis technology. By studying the propionic acid metabolic pathways existing in nature, identifying and selecting key pathways, and reconstructing these pathways into selected host microorganisms (such as Escherichia coli and yeast) to achieve efficient production of propionic acid. In this process, optimizing the metabolic flux towards propionic acid production and reducing the generation of by-products are the keys to improving propionic acid production and production efficiency. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to provide a propionic acid engineering bacterium.

[0007] Another technical problem to be solved by the present invention is to provide a method for constructing the above-mentioned propionic acid engineering bacteria.

[0008] Another technical problem to be solved by the present invention is to provide the application of the above-mentioned propionic acid engineering bacteria.

[0009] To solve the above technical problems, the technical solution of the present invention is as follows:

[0010] A propionic acid engineering bacterium, which is strain PA8, is obtained by genetic modification using Escherichia coli W3110 as the starting strain: the lac repressor gene lacI is knocked out on the genome of E. coli W3110, the succinate dehydrogenase gene sdhA and the isocitrate lyase inhibitor gene iclR are knocked out, and the promoter of methylmalonyl-CoA carboxylase scpA in the methylmalonyl-CoA mutase (sbm) operon is replaced with the P trc promoter on the genome, the oxaloacetate decarboxylase transferase operon RM_25-1795-1792 from Propionibacterium freudenreichii subsp. Freudenreichii is expressed on the pTrc99a plasmid, the pTrc99a-RM_25-1795-1792 plasmid is overexpressed in the constructed strain, the propionyl-CoA synthetase gene prpE is knocked out, and the acs and prpC genes are knocked out.

[0011] The above-mentioned engineered propionic acid bacteria have the succinate dehydrogenase gene sdhA and the isocitrate lyase inhibitor gene iclR knocked out, which are used to block the pathway from the TCA cycle to succinic acid, thereby blocking the further metabolism of succinic acid in this cycle, and activating the glyoxylate cycle, so as to achieve the purpose of accumulating succinic acid through the dual pathways of the TCA cycle and the glyoxylate cycle, and providing precursors for the dual pathways of the sbm cycle and the wood werkman cycle; replacing the self-promoter of methylmalonyl-CoA carboxylase scpA in the methylmalonyl-CoA mutase (sbm) operon on the genome with the Trc promoter, which is used to activate the sbm pathway of the E. coli strain itself; expressing the oxaloacetate decarboxylase transferase operon RM_25-1795-1792 from the Propionibacterium freudenreichii subsp. Freudenreichii strain on the pTrc99a plasmid, and overexpressing the pTrc99a-RM_25-1795-1792 plasmid in the constructed strain, so that on the basis of activating the sbm pathway of the strain itself, the wood werkman pathway can be further expressed in the strain; knocking out the propionyl-CoA synthetase gene prpE to weaken the degradation of propionic acid, and knocking out the acs and prpC genes to block the branch metabolism of the strain to propionyl-CoA, so that more of it flows to the synthesis pathway of propionic acid.

[0012] Preferably, for the above-mentioned engineered propionic acid bacteria, each gene and plasmid has been registered in GenBank, and those skilled in the art can obtain these genes through PCR. Specifically, the lacI gene is GenBank:945007, the sdhA gene is GenBank:945402, the iclR gene is GenBank:948524, the acs gene is GenBank:948572, the scpA gene is GenBank:945576, the prpE gene is GenBank:946891, the prpC gene is GenBank:947528, the RM25_1795-1792 protein gene is GenBank:AJQ91499 (AJQ91498, AJQ91497, AJQ91496), and the Ptrc99a plasmid is GenBank:M22744 (U13872, A13038).

[0013] Preferably, for the above-mentioned engineered propionic acid bacteria, the nucleotide sequence of the scpA self-promoter is as shown in SEQ ID NO.1, and the nucleotide sequence of the P trc promoter is as shown in SEQ ID NO.2.

[0014] The construction method of the above-mentioned propionic acid engineered bacterium uses the CRISPR / Cas9-mediated gene editing technology to gradually transform the wild-type Escherichia coli strain. The specific steps are as follows:

[0015] (1) Knock out the lac repressor gene lacI to obtain strain PA1;

[0016] (2) Knock out the succinate dehydrogenase gene sdhA to obtain strain PA2;

[0017] (3) Knock out the isocitrate lyase inhibitor gene iclR to obtain strain PA3;

[0018] (4) Replace the native promoter of methylmalonyl-CoA carboxylase scpA with the P trc promoter to obtain strain PA4;

[0019] (5) Knock out the propionyl-CoA synthetase gene prpE to obtain strain PA5;

[0020] (6) Knock out the acetyl-CoA synthetase gene acs to obtain strain PA6;

[0021] (7) Knock out the 2-methylcitrate synthase gene prpC to obtain strain PA7;

[0022] (8) Construct the oxaloacetate decarboxylase transferase operon RM25_1795-1792 on the Ptrc99a plasmid to obtain the pTrc99a-RM25_1795-1792 plasmid, and introduce it into strain PA7 to obtain strain PA8.

[0023] The above CRISPR / Cas9-mediated gene editing technology includes constructing a recombinant fragment and a pGRB plasmid, co-transforming the pGRB plasmid and the recombinant fragment into electrocompetent cells containing pREDCas9, and the step of plasmid curing to obtain a recombinant genetically engineered strain. Among them, the construction of the pGRB plasmid includes: designing a target sequence, preparing a DNA fragment containing the target sequence, and recombining the DNA fragment containing the target sequence with a linearized vector fragment; the target sequence is 5’-NGG-3’.

[0024] Preferably, in the construction method of the above-mentioned propionic acid engineered bacterium, the construction of the recombinant fragment includes constructing a recombinant fragment for gene integration or a recombinant fragment for gene knockout; among them, the steps of constructing a recombinant fragment for gene integration include: using the genome of the starting strain as a template, designing upstream and downstream homologous arm primers according to the upstream and downstream sequences of the intended insertion site of the target gene, and designing primers according to the target genome, amplifying the target gene fragment, and then obtaining the recombinant fragment through PCR overlap technology.

[0025] Application of the above-mentioned engineered bacteria for propionic acid in the production of propionic acid.

[0026] Preferably, for the application of the above-mentioned engineered bacteria for propionic acid, propionic acid is produced by a fermentation culture method.

[0027] Preferably, for the application of the above-mentioned engineered bacteria for propionic acid, the fermentation culture includes shake flask fermentation or fermenter fermentation.

[0028] Preferably, for the application of the above-mentioned engineered bacteria for propionic acid, propionic acid is produced by shake flask fermentation: The engineered bacteria for propionic acid are contacted with a fermentation medium and subjected to fermentation culture to prepare propionic acid. Among them, the inoculation amount during shake flask fermentation is 10%-15%, the temperature is maintained at 37°C ± 0.2, and the culture is shaken at 220 r / min. During the fermentation process, the pH is maintained at 7.0 by adding a 300 g / L NaOH solution; a 60% glucose solution is added to supplement the carbon source required by the bacteria.

[0029] The above shake flask fermentation is carried out in a 500 mL baffled flask for 24 h, and the concentration of propionic acid in the fermentation broth can reach 8.53 g / L.

[0030] Preferably, the specific steps for the application of the above-mentioned engineered bacteria for propionic acid using shake flask fermentation are as follows:

[0031] (1) Strain activation: The engineered bacteria for propionic acid are transferred from a glycerol tube to an LB shake tube for activation culture for 11-13 h; the culture temperature is 37°C;

[0032] (2) Seed culture: Take a 500 ml round-bottom flask, prepare a seed medium solution, suck 26 ml of the seed medium into the round-bottom flask, sterilize it in a high-temperature sterilizer at 121°C for 20 min; add 3 ml of the bacterial solution cultured in the LB shake tube and 1 ml of a 60% glucose solution; during the culture process, the pH is maintained at 7.0 ± 0.1, the temperature is maintained at 37 ± 0.2°C, and when the OD reaches 10-15, it is transferred to the fermentation medium for fermentation culture;

[0033] (3) Fermentation culture: Take a 500 ml baffled flask, prepare a fermentation medium solution, suck 26 ml of the fermentation medium into the round-bottom flask, sterilize it in a high-temperature sterilizer at 121°C for 20 min, inoculate the seed liquid into the fermentation medium at an inoculation amount of 20% and add 1 ml of a 60% glucose solution for fermentation culture; the fermentation pH is maintained at 7.0 ± 0.1, and the temperature is maintained at 37 ± 0.2°C; during the culture process, the carbon source required by the bacteria during the fermentation process is maintained by adding a 60% glucose solution, and the pH is adjusted by adding a 300 g / L NaOH solution during this period.

[0034] Preferably, for the application of the above-mentioned propionic acid engineering bacteria, the seed culture medium used is: glucose 25 - 30 g / L, Nacl 10 g / L, yeast powder 5 g / L, peptone 10 g / L, 2% (v / v) phenol red indicator, 2 drops of antifoaming agent, and the pH is adjusted to 6.8 - 7.0.

[0035] Preferably, for the application of the above-mentioned propionic acid engineering bacteria, the fermentation culture medium used is: glucose 20 g / L, betaine 0.5 g / L, citric acid 1 g / L, KH 2 PO 4 3.0 g / L, MgSO 4 ·7H 2 O 2.0 g / L, yeast powder 5.0 g / L, peptone 5.0 g / L, trace elements (Na 2 MoO 4 ·2H 2 O 2.5 g / L, Al 2 (SO 4 ) 2 ·18H 2 O 1.25 g / L, NiCl 2 ·6H 2 O 1.6 g / L, CaCl 2 ·2H 2 O 1.0 g / L, CuSO 4 ·5H 2 O 0.4 g / L, CoCl 2 ·6H 2 O 1.8 g / L, ZnSO 4 ·2H 2 O 0.5 g / L, H 3 PO 3 0.14 g / L) 2 ml / L, FeSO4·7H 2 O 20 mg / L, MnSO 4 ·H 2 O 10 mg / L, VH 2.0 g / L, V B1 、V B3 、V B5 、V B12 、V H Each 2.0 mg / L, 2% (v / v) phenol red indicator, 2 drops of antifoaming agent, and the pH is adjusted to 6.8 - 7.0.

[0036] The above media can all be prepared by standard methods.

[0037] Beneficial effects:

[0038] The above-mentioned engineered propionic acid bacterium knocks out sdhA to block the TCA cycle and simultaneously knocks out iclR to activate the glyoxylate cycle, thereby supplying the precursor succinic acid for synthesizing propionic acid through both the TCA cycle and the glyoxylate cycle; through the trc P promoter to activate the dormant sbm pathway and simultaneously express the key genes of the WoodWerkman pathway, thereby realizing the co-synthesis of propionic acid through both the sbm pathway and the Wood Werkman pathway. By modifying the strain, the resulting strain has simple operation for fermentative production of propionic acid, can directly and efficiently synthesize propionic acid from inexpensive carbon sources. Through fermentation culture in a 500-ml shake flask, the yield reaches 8.53 g / L after 24 h, having good industrial application prospects and laying a foundation for subsequent fermentative production of propionic acid. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 It is a propionic acid metabolic map, in which the dark green lines are part of the wood workman cycle; the yellow lines are part of the sbm cycle; the yellow-green lines are the common pathways of the wood workman cycle and the sbm cycle.

[0040] Figure 2 It is the shake flask fermentation yield map of propionic acid PA3, PA4 and PA8 strains. DETAILED DESCRIPTION OF THE INVENTION

[0041] In order to enable those skilled in the art to better understand the technical solutions of the present invention, the technical solutions of the present invention will be further described in detail below in conjunction with the specific embodiments.

[0042] The original pGRB plasmid used in the following examples can be referred to https: / / www.addgene.org / 71539 / , Plasmid#71539; the pREDCas9 plasmid can be referred to

[0043] https: / / www.addgene.org / search / catalog / plasmids / ?q=pREDCas9, Plasmid#71541. The primers used in the construction of the strains involved are shown in Table 1, and the promoters are shown in the sequence listing.

[0044] Table 1 Primers involved in the construction of strains

[0045]

[0046]

[0047]

[0048]

[0049] Example 1

[0050] As Figure 1 shown, this example aims to illustrate the specific construction steps of strain PA8.

[0051] 1.1 lacI gene knockout

[0052] According to the upstream and downstream sequences of the lacI gene, the upstream homologous arm primers UP-lacI-S (SEQ ID NO.3), UP-lacI-A (SEQ ID NO.4) and the downstream homologous arm primers DN-lacI-S (SEQ ID NO.5), DN-lacI-A (SEQ ID NO.6) were designed. Using the genome of strain E. coli W3110 as a template, the upstream and downstream homologous arms were amplified by PCR technology, and the gene knockout fragment (upstream homologous arm - downstream homologous arm) was obtained by recombinant PCR. A DNA fragment containing the target sequence of the gene of interest was prepared by annealing the primers gRNA-lacI-S (SEQ ID NO.7) and gRNA-lacI-A (SEQ ID NO.8), and recombinant pGRB-lacI was obtained after recombination with the linearized pGRB vector. The integration fragment and pGRB-lacI were electrotransformed into the competent cells of E. coli PA1 containing the pREDCas9 plasmid, and single colonies were obtained after resuscitation culture. Positive recombinants were obtained by PCR colony verification, and then pGRB-lacI used for gene editing was eliminated, namely strain E. coli PA1.

[0053] 1.2 sdhA gene knockout

[0054] According to the upstream and downstream sequences of the sdhA gene, the upstream homologous arm primers UP-sdhA-S (SEQ ID NO.9), UP-sdhA-A (SEQ ID NO.10) and the downstream homologous arm primers DN-sdhA-S (SEQ ID NO.11), DN-sdhA-A (SEQ ID NO.12) were designed. Using the genome of strain E. coli W3110 as a template, the upstream and downstream homologous arms were amplified by PCR technology, and the gene knockout fragment (upstream homologous arm - downstream homologous arm) was obtained by recombinant PCR. The DNA fragment containing the target sequence of the gene of interest was prepared by annealing the primers gRNA-sdhA-S (SEQ ID NO.13) and gRNA-sdhA-A (SEQ ID NO.14), and the recombinant pGRB-sdhA was obtained after recombination with the linearized pGRB vector. The integration fragment and pGRB-sdhA were electrotransformed into the competent cells of E. coli PA1 containing the pREDCas9 plasmid, and single colonies were obtained after resuscitation culture. Positive recombinants were obtained by PCR colony verification, and then the pGRB-sdhA used for gene editing was eliminated, namely strain E. coli PA2.

[0055] 1.3 iclR gene knockout

[0056] According to the upstream and downstream sequences of the iclR gene, the upstream homologous arm primers UP-ic lR-S (SEQ ID NO.15), UP-i clR-A (SEQ ID NO.16) and the downstream homologous arm primers DN-iclR-S (SEQ ID NO.17), DN-i clR-A (SEQ ID NO.18) were designed. Using the genome of strain E. coli W3110 as a template, the upstream and downstream homologous arms were amplified by PCR technology, and the gene knockout fragment (upstream homologous arm - downstream homologous arm) was obtained by recombinant PCR. The DNA fragment containing the target sequence of the gene of interest was prepared by annealing the primers gRNA-ic lR-S (SEQ ID NO.19) and gRNA-ic lR-A (SEQ ID NO.20), and the recombinant pGRB-ic lR was obtained after recombination with the linearized pGRB vector. The integration fragment and pGRB-i clR were electrotransformed into the competent cells of E. coli PA2 containing the pREDCas9 plasmid, and single colonies were obtained after resuscitation culture. Positive recombinants were obtained by PCR colony verification, and then the pGRB-i clR used for gene editing was eliminated, namely strain E. coli PA3.

[0057] 1.4 Replace the self-promoter of the scpA gene with P trc Promoter

[0058] According to the upstream and downstream sequences of the scpA gene, the upstream homologous arm primers UP-scpA-S (SEQ ID NO.21), UP-Ptrc-scpA-A (SEQ ID NO.22) and the downstream homologous arm primers DN-Ptrc-scpA-S (SEQ ID NO.23), DN-scpA-A (SEQ ID NO.24) were designed. Using the genome of strain E. coli W3110 as a template, the upstream and downstream homologous arms were amplified by PCR technology, and the overlapping fragment (upstream homologous arm - downstream homologous arm) of the gene was obtained by recombinant PCR. The DNA fragment containing the target sequence of the gene of interest was prepared by annealing the primers gRNA-scpA-S (SEQ ID NO.25) and gRNA-scpA-A (SEQ ID NO.26), and the recombinant pGRB-scpA was obtained after recombination with the linearized pGRB vector. The integration fragment and pGRB-scpA were electrotransformed into the competent cells of E. coli PA3 containing the pREDCas9 plasmid, and single colonies were obtained by resuscitation culture. Positive recombinants were obtained by PCR colony verification, and then the pGRB-scpA used for gene editing was eliminated, namely strain E. coli PA4.

[0059] 1.5 Knockout of prpE gene

[0060] According to the upstream and downstream sequences of the prpE gene, the upstream homologous arm primers UP-prpE-S (SEQ ID NO.27), UP-prpE-A (SEQ ID NO.28) and the downstream homologous arm primers DN-prpE-S (SEQ ID NO.29), DN-prpE-A (SEQ ID NO.30) were designed. Using the genome of strain E. coli W3110 as a template, the upstream and downstream homologous arms were amplified by PCR technology, and the knockout fragment (upstream homologous arm - downstream homologous arm) of the gene was obtained by recombinant PCR. The DNA fragment containing the target sequence of the gene of interest was prepared by annealing the primers gRNA-prpE-S (SEQ ID NO.31) and gRNA-prpE-A (SEQ ID NO.32), and the recombinant pGRB-prpE was obtained after recombination with the linearized pGRB vector. The integration fragment and pGRB-prpE were electrotransformed into the competent cells of E. coli PA4 containing the pREDCas9 plasmid, and single colonies were obtained by resuscitation culture. Positive recombinants were obtained by PCR colony verification, and then the pGRB-prpE used for gene editing was eliminated, namely strain E. coli PA5.

[0061] 1.6 Knockout of acs gene

[0062] According to the upstream and downstream sequences of the acs gene, the upstream homologous arm primers UP-acs-S (SEQ ID NO.33), UP-acs-A (SEQ ID NO.34) and the downstream homologous arm primers DN-acs-S (SEQ ID NO.35), DN-acs-A (SEQ ID NO.36) were designed. Using the genome of strain E. coli W3110 as a template, the upstream and downstream homologous arms were amplified by PCR technology, and the gene knockout fragment (upstream homologous arm - downstream homologous arm) was obtained by recombinant PCR. The DNA fragment containing the target sequence of the gene of interest was prepared by annealing the primers gRNA-acs-S (SEQ ID NO.37) and gRNA-acs-A (SEQ ID NO.38), and the recombinant pGRB-acs was obtained after recombination with the linearized pGRB vector. The integration fragment and pGRB-acs were electrotransformed into the competent cells of E. coli PA5 containing the pREDCas9 plasmid, and single colonies were obtained after resuscitation culture. Positive recombinants were obtained by PCR colony verification, and then the pGRB-acs used for gene editing was eliminated, namely strain E. coli PA6.

[0063] 1.7 Knockout of the prpC gene

[0064] According to the upstream and downstream sequences of the prpC gene, the upstream homologous arm primers UP-prpC-S (SEQ ID NO.39), UP-prpC-A (SEQ ID NO.40) and the downstream homologous arm primers DN-prpC-S (SEQ ID NO.41), DN-prpC-A (SEQ ID NO.42) were designed. Using the genome of strain E. coli W3110 as a template, the upstream and downstream homologous arms were amplified by PCR technology, and the gene knockout fragment (upstream homologous arm - downstream homologous arm) was obtained by recombinant PCR. The DNA fragment containing the target sequence of the gene of interest was prepared by annealing the primers gRNA-prpC-S (SEQ ID NO.43) and gRNA-prpC-A (SEQ ID NO.44), and the recombinant pGRB-prpC was obtained after recombination with the linearized pGRB vector. The integration fragment and pGRB-prpC were electrotransformed into the competent cells of E. coli PA6 containing the pREDCas9 plasmid, and single colonies were obtained after resuscitation culture. Positive recombinants were obtained by PCR colony verification, and then the pGRB-prpC used for gene editing was eliminated, namely strain E. coli PA7.

[0065] 1.8 The oxaloacetate decarboxylase transferase operon RM25_1795-1792 was constructed on the Ptrc99a plasmid to obtain the pTrc99a-RM25_1795-1792 plasmid and introduced it into the above strain

[0066] According to the upstream and downstream sequences of the RM25_1795-1792 gene, gene fragment primers UP-RM25_1795-1792-S (SEQ ID NO.45) and UP-RM25_1795-1792-A (SEQ ID NO.46) for constructing plasmids were designed. Using the genome of Propionibacterium freudenreichii subsp. Freudenreichii as a template, upstream and downstream homologous arms were amplified by PCR technology, and the gene fragment for constructing the plasmid was obtained by recombinant PCR. According to the upstream and downstream sequences of the pTrc99a gene, linearized vector fragment primers UP-pTrc99a-S (SEQ ID NO.47) and UP-pTrc99a-A (SEQ ID NO.48) for constructing plasmids were designed. Using the linearized vector obtained after digesting the pTrc99a plasmid as a template, upstream and downstream homologous arms were amplified by PCR technology, and the linearized vector fragment for constructing the plasmid was obtained by recombinant PCR. A reaction system was prepared with the linearized vector and the gene amplification product for recombinant reaction to achieve in vitro circularization. The pREDCas9 plasmid of E. coli PA7 was eliminated to obtain an antibiotic-free strain, and then the constructed pTrc99a-RM25_1795-1792 plasmid was electrotransformed into the antibiotic-free competent cells of E. coli PA7. After recovery culture, single colonies were obtained, and positive strains were obtained by PCR colony verification, namely strain E. coli PA8.

[0067] Example 2

[0068] The construction and detection methods of the pGRB and pREDCas9 plasmids described in Example 1 are as follows:

[0069] 2.1 Gene editing method

[0070] CRISPR / Cas9 is a precise and efficient new gene targeting modification technology. The two plasmids used in this method are pGRB and pREDCas9 respectively. The pREDCas9 plasmid is a temperature-sensitive plasmid, carrying an elimination system for the gRNA plasmid, the Red recombination system of λ phage and the Cas9 protein expression system, with resistance to spectinomycin (working concentration: 100 mg / L), and the suitable culture temperature is 32 °C; the pGRB plasmid, with pUC18 as the backbone, contains the promoter J23100, the gRNA-Cas9 binding region sequence and the terminator sequence, with resistance to ampicillin (working concentration: 100 mg / L), and the suitable culture temperature is 37 °C.

[0071] The specific steps of this method are as follows:

[0072] 2.2 Construction of pGRB plasmid

[0073] The purpose of constructing plasmid pGRB is to transcribe the corresponding gRNA, which forms a complex with Cas9 protein, and identify the target site of the target gene through base pairing and PAM, thereby realizing double-strand break of the target DNA. The pGRB plasmid was constructed by recombining a DNA fragment containing the target sequence with a linearized vector fragment.

[0074] 2.2.1 Target sequence design

[0075] The target sequence was designed using CRISPR RGEN Tools (PAM: 5'-NGG-3').

[0076] 2.2.2 Preparation of DNA fragment containing the target sequence

[0077] Primers were designed: 5'-linearized vector end sequence (15bp)-restriction enzyme site-target sequence (excluding PAM sequence)-linearized vector end sequence (15bp)-3' and its reverse complementary primer (pGRB identification primer: pGRB-Test-S: GTCTCATGAGCGGATACATATTTG; pGRB-Test-A: ATGAGAAAGCGCCACGCT). The DNA fragment containing the target sequence was prepared by annealing single-stranded DNA. Reaction conditions: pre-denaturation at 95°C for 5 min; annealing at 50°C for 1 min; incubation at 4°C. The annealing system is shown in Table 2 below:

[0078] Table 2 Annealing system

[0079]

[0080] 2.2.3 Preparation of linear vector

[0081] The vector was linearized by inverse PCR amplification.

[0082] 2.2.4 Recombination reaction

[0083] The recombination system is shown in Table 3 below. All recombination enzymes used were from the IIOne Step Cloning Kit series, and the recombination conditions were: 37°C for 30 min.

[0084] Table 3 Recombination system

[0085]

[0086] 2.2.5 Plasmid transformation

[0087] Take 20 μL of the above reaction solution, i.e., the solution after plasmid recombination reaction, and add it to 100 mL of DH5α chemically competent cells. Gently mix and incubate on ice for 20 min, heat shock at 42 °C for 42 s, immediately incubate on ice for 2 - 3 min, add 900 μL of SOC, and recover at 37 °C for 1 h. Centrifuge at 8000 rpm for 2 min, discard part of the supernatant, leave about 200 μL, resuspend the bacteria, and spread them on a plate containing 100 mg / L ampicillin. Invert the plate and culture overnight at 37 °C. After single colonies grow on the plate, identify them by colony PCR and select positive recombinants.

[0088] 2.3 Preparation of Recombinant DNA Fragments

[0089] The recombinant fragment for knockout consists of upstream and downstream homologous arms of the gene to be knocked out (upstream homologous arm - downstream homologous arm); the recombinant fragment for integration consists of upstream and downstream homologous arms of the integration site and the gene fragment to be integrated (upstream homologous arm - target gene - downstream homologous arm). Using the primer design software Oligo 7, design upstream and downstream homologous arm primers (amplification length is about 300 - 500 bp) with the upstream and downstream sequences of the gene to be knocked out or the integration site as templates; design amplification primers for the integration gene with the gene to be integrated as a template. After amplifying the upstream and downstream homologous arms and the target gene fragment by PCR respectively, then prepare the recombinant fragment through overlap PCR. The PCR system and method are as shown in Table 4 below:

[0090] Table 4 PCR Amplification System

[0091]

[0092] The system of overlap PCR is as shown in Table 5 below:

[0093] Table 5 Overlap PCR Amplification System

[0094]

[0095] PCR reaction conditions (Easy FastTaq Master Mix (quick load) 2×): pre - denaturation (98 °C) for 10 min; denaturation (98 °C) for 10 s, annealing (60 °C) for 10 - 30 s, extension at 72 °C, cycle 30 times; continue extension at 72 °C for 10 min; keep warm (4 °C).

[0096] 2.4 Transformation of Plasmid and Recombinant DNA Fragments

[0097] 2.4.1 Transformation of pREDCas9

[0098] The pREDCas9 plasmid was electrotransformed into the electrocompetent cells of W3110 by electroporation. After the cells were resuscitated and cultured, they were spread on an LB plate containing spectinomycin and cultured overnight at 32°C. Single colonies growing on the resistant plate were subjected to colony PCR using identification primers to screen for positive recombinants.

[0099] 2.4.2 Preparation of electrocompetent cells of the target strain containing pREDCas9

[0100] Cultured at 32°C until the OD 600 reached 0.1, IPTG with a final concentration of 0.1 mM was added, and the culture was continued until the OD 600 reached 0.2 - 0.3 for the preparation of electrocompetent cells. The purpose of adding IPTG was to induce the expression of the recombinase on the pREDCas9 plasmid. The medium required for the preparation of electrocompetent cells and the preparation process followed the conventional standard operation.

[0101] 2.4.3 Transformation of pGRB and recombinant DNA fragments

[0102] pGRB and the recombinant DNA fragment were simultaneously electrotransformed into the electrocompetent cells containing pREDCas9. The cells resuscitated and cultured after electroporation were spread on an LB plate containing 100 μg / mL ampicillin and spectinomycin resistance and cultured overnight at 32°C. Colony PCR verification was performed using the upstream primer of the upstream homologous arm and the downstream primer of the downstream homologous arm, or specifically designed identification primers, to screen for positive recombinants and preserve the bacteria.

[0103] 2.5 Elimination of plasmids

[0104] 2.5.1 Elimination of pGRB

[0105] The positive recombinants were cultured overnight in an LB medium containing 20 mmol / L arabinose, appropriately diluted and then spread on an LB plate containing 100 μg / mL spectinomycin resistance and cultured overnight at 32°C. Single colonies were separately transferred to an LB plate containing 100 μg / mL ampicillin and spectinomycin resistance, and the single colonies that did not grow on the ampicillin plate but grew on the spectinomycin resistance plate were preserved.

[0106] 2.5.2 Elimination of pREDCas9 plasmid

[0107] The positive recombinants were transferred to a non-resistant LB liquid medium and cultured overnight at 42°C, appropriately diluted and then spread on a non-resistant LB plate and cultured overnight at 37°C. For the LB plates with and without spectinomycin resistance, the single colonies that did not grow on the spectinomycin resistance plate but grew on the non-resistant plate were preserved.

[0108] Example 3

[0109] First, strains PA3 that block part of the TCA cycle and activate the glyoxylate pathway described in Example 1, strain PA4 that activates the sbm pathway on this basis, and strain PA8 that activates the Wood-Werkman cycle and eliminates the propionate branch metabolism were used for shake flask culture. After 24 h of shake flask fermentation, as Figure 2 shown, the propionate content in the fermentation broth was 0.41 g / L for PA3, 7.75 g / L for PA4, and 8.53 g / L for PA8; it can be known from the shake flask fermentation data that the activation of the sbm pathway has a positive effect on the production of propionate by Escherichia coli. On this basis, the introduction of the Wood-Werkman cycle pathway further increases the yield of propionate. The specific method for producing propionate by the above shake flask culture is as follows:

[0110] 3.1 Strain activation: The strain was transferred from the glycerol tube to an LB shake tube for activation culture for 12 h; culture temperature: 37 °C;

[0111] 3.2 Seed culture: 26 ml of seed medium was prepared in a 500 ml round-bottom flask. 3 ml of the bacterial liquid cultured in the LB shake tube was pipetted into the seed flask, and 1 ml of 60% glucose solution was added. During the culture process, the pH was maintained at 7.0 ± 0.1, and the temperature was maintained at 37 ± 0.2 °C. When the OD reached 10, it was transferred to the fermentation flask for fermentation culture;

[0112] 3.3 Fermentation culture: 26 ml of fermentation medium was prepared in a 500 ml baffled flask. The seed liquid was inoculated into the fermentation medium at an inoculation amount of 10% for fermentation culture. The fermentation pH was maintained at 7.0 ± 0.1, and the temperature was maintained at 37 ± 0.2 °C; during the culture process, the carbon source required by the cells during the fermentation process was maintained by feeding 60% glucose solution, and the pH was adjusted by adding 300 g / L NaOH solution. Among them,

[0113] The seed medium used was: glucose 28 g / L, NaCl 10 g / L, yeast powder 5 g / L, peptone 10 g / L, 2% (v / v) phenol red indicator, 2 drops of antifoaming agent, and the pH was adjusted to 6.8 - 7.0;

[0114] The fermentation medium used was: glucose 20 g / L, betaine 0.5 g / L, citric acid 1 g / L, KH 2 PO 4 3.0 g / L, MgSO 4 ·7H 2 O 2.0 g / L, yeast powder 5.0 g / L, peptone 5.0 g / L, trace elements (Na 2 MoO 4 ·2H 2 O 2.5 g / L, Al 2 (SO 4 )2 ·18H 2 O 1.25 g / L, NiCl 2 ·6H 2 O 1.6 g / L, CaCl 2 ·2H 2 O 1.0 g / L, CuSO 4 ·5H 2 O 0.4 g / L, CoCl 2 ·6H 2 O 1.8 g / L, ZnSO 4 ·2H 2 O 0.5 g / L, H 3 PO 3 0.14 g / L) 2 ml / L, FeSO4·7H 2 O 20 mg / L, MnSO 4 ·H 2 O 10 mg / L, VH 2.0 g / L, V B1 、V B3 、V B5 、V B12 、V H Each 2.0 mg / L, 2% (v / v) phenol red indicator, 2 drops of antifoaming agent, adjust the pH to 6.8 - 7.0.

[0115] In summary, for the above-mentioned propionic acid engineering bacteria, by analyzing the propionic acid metabolism-related pathways of wild-type Escherichia coli (E. coli) and Propionibacterium freudenreichii subsp. Freudenreichii, and supplying succinic acid through the incomplete TCA cycle and glyoxylate cycle in the chassis microorganism wild-type Escherichia coli (E. coli) W3110. On this basis, the methylmalonyl-CoA carboxylase scpA of the methylmalonyl-CoA mutase (sbm) operon is introduced to activate the sbm pathway of Escherichia coli itself, enabling the strain to produce propionic acid through succinic acid; on this basis, the exogenous oxaloacetate decarboxylase transferase operon RM25_1795 - 1792 of the Wood Werkman cycle partial pathway is introduced. The sbm pathway and the Wood Werkman cycle are similar, and their main difference lies in the decarboxylation pathway of propionyl-CoA. The specific metabolic pathway can be referred to Figure 1, pyruvate generates oxaloacetate through the Wood Werkman pathway to achieve the regeneration of oxaloacetate, and uses the combined pathway of both the sbm and Wood Werkman cycles to jointly produce propionic acid; and knockout the anaplerotic pathway of propionic acid metabolism and the key branching pathway to relieve the key feedback inhibition, and perform related molecular modifications such as knocking out the propionic acid decomposition pathway. Thus, a genetically engineered bacterium PA8 for de novo synthesis of propionic acid is successfully constructed, which has the advantages of clear genetic background and sustainable modification. The fermentation of this strain to produce propionic acid is simple in operation and can directly synthesize propionic acid from inexpensive carbon sources, showing good industrial application prospects.

[0116] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and retouches can be made. The improvements and retouches such as strain modification by those skilled in the art using the method of the present invention or based on this method are regarded as the protection scope of the present invention.

Claims

1. A propionic acid engineering bacterium, characterized in that: The invention is obtained by genetic modification using Escherichia coli W3110 as the starting strain: the Lacl repressor gene lac1, the succinate dehydrogenase gene sdhA and the isocitrate lyase inhibitor gene icIR are knocked out in the genome of E. coli W3110, and the promoter of the methylmalonyl-CoA carboxylase scpA of the methylmalonyl-CoA mutase operon is replaced with P trc Promoter, express the oxaloacetate decarboxylase transferase operon RM_25-1795-1792 from Propionibacterium freudenreichii subsp. shermanii strain on the pTrc99a plasmid, overexpress the pTrc99a-RM_25-1795-1792 plasmid in the constructed strain, knock out the propionate CoA synthetase gene prpE, and knock out the acs and prpC genes.

2. The propionic acid engineering bacteria according to claim 1, characterized in that: The nucleotide sequence of the scpA promoter is shown in SEQ ID NO.

1. trc The nucleotide sequence of the promoter is shown in SEQ ID NO.

2.

3. The method for constructing the propionic acid engineering bacteria according to claim 1 or 2, characterized in that: CRISPR / Cas9-mediated gene editing technology was used to gradually transform the wild-type E. coli strain. The specific steps are as follows: (1) Knock out the lac repressor gene lac / to obtain strain PA1; (2) knocking out the succinate dehydrogenase gene sdhA to obtain strain PA2; (3) knocking out the isocitrate lyase inhibitor gene iclR to obtain strain PA3; (4) Replace the methylmalonyl-CoA carboxylase scpA promoter with P trc promoter, resulting in strain PA4; (5) knocking out the propionate-CoA synthetase gene prpE to obtain strain PA5; (6) knocking out the acetyl-CoA synthetase gene acs to obtain strain PA6; (7) knocking out the 2-methylcitrate synthase gene prpC to obtain strain PA7; (8) The oxaloacetate decarboxylase transferase operon RM25-7795-1792 was constructed on the Ptrc99a plasmid to obtain the pTrc99a-RM25_1795-1792 plasmid, and it was introduced into strain PA7 to obtain strain PA8.

4. Use of the propionic acid engineering bacteria according to claim 1 or 2 in producing propionic acid.

5. The use according to claim 4, characterized in that: Propionic acid is produced by fermentation culture.

6. The use according to claim 4 or 5, characterized in that: Propionic acid is produced by shake flask fermentation: propionic acid engineering bacteria are contacted with fermentation medium and fermented to prepare propionic acid, wherein the inoculation amount during shake flask fermentation is 10%-15%, the temperature is maintained at 37°C±0.2, and the shaking culture is carried out at 220r / min. During the fermentation process, 300g / L NaOH solution is added to maintain the pH at 7.0; and 60% glucose solution is added to supplement the carbon source required by the bacteria.

7. The use according to claim 6, characterized in that: The specific steps of shake flask fermentation are as follows: (1) Activation of strains: Transfer the propionic acid engineered bacteria from the glycerol tube to the LB shaking tube for activation and culture for 11-13 hours at 37°C. (2) Seed culture: The seed culture medium was sterilized in a high temperature autoclave at 121°C for 20 min; 3 ml of LB shake tube culture solution and 1 ml of 60% glucose solution were added to every 26 ml of seed culture medium; the pH was maintained at 7.0±0.1 and the temperature was maintained at 37±0.2°C during the culture process; when the OD was 10-15, the culture medium was transferred to the fermentation medium for fermentation culture; (3) Fermentation culture: Each 26 ml fermentation medium was sterilized in a high temperature autoclave at 121°C for 20 min, and the seed liquid was inoculated into the fermentation medium at a 20% inoculation rate and 1 ml of 60% glucose solution was added for fermentation culture; the fermentation pH was maintained at 7.0±0.1 and the temperature was maintained at 37±0.2°C; during the culture process, glucose solution was fed to maintain the carbon source required by the fermentation process, and the pH was adjusted by adding NaOH solution.

8. The use according to claim 7, characterized in that: The seed culture medium used is: glucose 25-30 g / L, NaCl 10 g / L, yeast powder 5 g / L, peptone 10 g / L, 2% (v / v) phenol red indicator, 2 drops of defoaming agent, and the pH is adjusted to 6.8-7.

0.

9. The use according to claim 7, characterized in that: The fermentation medium used was: glucose 20 g / L, betaine 0.5 g / L, citric acid 1 g / L, KH2PO4 3.0 g / L, MgSO4·7H2O 2.0 g / L, yeast powder 5.0 g / L, peptone 5.0 g / L, trace elements (Na2MoO4·2H2O 2.5 g / L, Al2(SO4)2·18H2O 1.25 g / L, NiCl2·6H2O 1.6 g / L, CaCl2·2H2O 1.0 g / L, CuSO4·5H2O 0.4 g / L, CoCl2·6H2O 1.8 g / L, ZnSO4·2H2O 0.5 g / L, H3PO3 0.14 g / L) 2 ml / L, FeSO4·7H2O 20 mg / L, MnSO4·H2O 10mg / L,VH 2.0g / L,V B1 、V B3 、V B5 、V B12 、V H 2.0 mg / L each, 2% (v / v) phenol red indicator, 2 drops of defoaming agent, adjust pH to 6.8-7.0.

Images