Kit and detection method for detecting tomato brown crinkled fruit virus based on enzyme-mediated dual-amplification nucleic acid amplification

Abstract

The invention discloses a kit for detecting tomato brown crinkled fruit virus based on enzyme-mediated dual-amplification nucleic acid amplification and a detection method. The detection system comprises a primer pair DNA (deoxyribonucleic acid) upstream primer (F5) and a DNA downstream primer (R6) for amplifying the tomato brown crinkled fruit virus movement protein gene, a probe (RNA primer (RNA1)) for detecting the MP gene, a nucleic acid amplification group enzyme system (recombinase, single-chain binding protein, polymerase and ATP (adenosine triphosphate) energy regeneration enzyme), a signal amplification group enzyme system (positioning enzyme and cutting enzyme), activating enzyme NTP, a buffer solution and RNase-free Water. The system composed of the freeze-drying protective agent is prepared into the pre-subpackaged freeze-dried balls. The kit disclosed by the invention can realize DNA detection of aM concentration, and besides rapid qualitative detection of the tomato brown crinkled fruit virus, early screening of the tomato brown crinkled fruit virus can also be realized due to high detection sensitivity.

Description

Technical Field

[0001] The present invention relates to the technical field of viral nucleic acid molecule diagnosis. Specifically, it relates to a kit and a detection method for detecting tomato brown rugose fruit virus based on enzyme-mediated dual amplification nucleic acid amplification. Background Art

[0002] Tomato brown rugose fruit virus (ToBRFV) is a new species of the genus Tobamovirus. Tomato brown rugose fruit virus (ToBRFV) is closely related to tobacco mosaic virus (TMV) and tomato mosaic virus (ToMV). Its original hosts are tomatoes and peppers. Tomato brown rugose fruit virus has occurred successively in many countries such as Turkey, the United Kingdom, the United States, and Mexico, and its scope has spread throughout Europe, the Americas, and Asia, seriously threatening the production of solanaceous vegetables such as tomatoes and peppers.

[0003] Currently, the technology for highly sensitive molecular detection mainly relies on fluorescence quantitative PCR (polymerase chain reaction). After more than 20 years of development, this technology has become very mature and is widely used in molecular detection in various scenarios. However, this technology requires expensive and inconveniently portable instruments to achieve detection, and the detection time usually exceeds 40 minutes. These disadvantages have greatly limited the application of this technology in the field of POCT (Point-of-care test). To address the deficiencies of fluorescence quantitative PCR in rapid nucleic acid detection, various technologies for rapid nucleic acid amplification under isothermal conditions have become the focus of research in recent years. The main technologies include the following: Transcription-mediated amplification and its derivative technologies have a long overall detection time and certain limitations in sensitivity due to the constraints of the reaction mechanism, and cannot achieve highly sensitive detection in a short time; Loop-mediated isothermal amplification has the characteristics of rapidity and sensitivity, but its weak anti-pollution ability leading to false positives limits its application in rapid nucleic acid detection; There are relatively many studies on recombinase polymerase amplification technology (RPA technology) or its derivative technologies, but currently, there are few products applied clinically. Its complex operation and weak fluorescence signal make it difficult to meet the requirements of ultra-rapid and highly sensitive detection.

[0004] Therefore, inventing a field molecular rapid detection technology and applying it to scenarios such as field on-site detection and monitoring is the most effective way to fundamentally cut off the source of tomato brown rugose fruit virus. Specifically, there is an urgent need to provide a kit and a detection method for rapid on-site detection of tomato brown rugose fruit virus that are comparable in accuracy to professional laboratories and have the advantages of rapidity, simplicity, and portability. Summary of the Invention

[0005] The object of the present invention is to overcome the above-mentioned defects and deficiencies existing in the prior art, and to provide a kit suitable for rapid on-site detection of tomato brown rugose fruit virus.

[0006] The second object of the present invention is to provide the application of the kit in the rapid on-site detection of tomato brown rugose fruit virus.

[0007] The third object of the present invention is to provide a method for rapid on-site detection of tomato brown rugose fruit virus.

[0008] The above objects of the present invention are achieved by the following technical solutions: A kit for detecting tomato brown rugose fruit virus based on enzyme-mediated dual amplification nucleic acid amplification, comprising: 1) Nucleic acid amplification enzyme system: recombinase, single-stranded binding protein, polymerase and ATP energy regeneration enzyme; 2) Signal amplification enzyme system: positioning enzyme and cleavage enzyme; 3) Activating enzyme NTP: nucleoside triphosphate; 4) RNA primer, DNA upstream primer and DNA downstream primer; 5) RNA primer fluorescent probe; 6) Buffer, RNase-free Water, lyoprotectant; Among them, the system composed of the above components is prepared into pre-packaged freeze-dried balls.

[0009] Preferably, the kit further includes tomato brown rugose fruit virus sample DNA.

[0010] Preferably, the kit further includes a high-efficiency lysis solution for extracting tomato brown rugose fruit virus detection sample DNA, and the high-efficiency lysis solution includes Tris (pH 8), NaCl, EDTA, SDS, PVP-40 and broad-spectrum protease.

[0011] Preferably, the nucleotide sequence of the RNA primer is: FAM-GAGAGCGGACGAGGCAACUCUUGCUUCA-BHQ1, the DNA upstream primer is 5'-GATAATTGTCGTGGTGGTGTCAGTGTCT-3', and the DNA downstream primer is 5'-AAGCTAATACGACTCACTATAGGGGCGTCCTTGGTAGTGATGTTGTAATTTG-3'.

[0012] Preferably, the RNA primer fluorescent probe is a single-stranded nucleotide sequence AGAAUGGAGAGAGCGGACGAGGCAACUC with a FAM-labeled reporter group at the 5' end and a BHQ1-labeled quenching group at the 3' end.

[0013] Preferably, the contents of the components of the kit in the reaction system are as follows: Buffer: 10 - 30 mM Tris-HAc with pH 7.2 - 7.8; 20 - 80 mM potassium acetate (KAc); 2 - 5 mM magnesium acetate [Mg(Ac)2]; 1 - 4 mM mercaptoethanol; 0.5 - 1 mM ATP; Lyoprotectant: polyethylene glycol (PEG) 20000 with a mass percentage of 1% - 3.5%; 50 - 100 μM dNTPs; 10 - 500 nM primer pair composed of DNA upstream primer and DNA downstream primer; 10 - 500 nM RNA primer of MP; 5 - 100 nM recombinase, 10 - 200 nM single-stranded binding protein, 5 - 100 nM polymerase,.1 - 2 μM ATP energy regeneration enzyme; 0.05 - 2.5 μM positioning enzyme, 0.05 - 2.5 μM cleavage enzyme.

[0014] Preferably, the kit further includes a plasmid standard of the gene fragment of tomato brown rugose fruit virus movement protein (MP).

[0015] The present invention also provides an application of a kit for detecting tomato brown rugose fruit virus based on enzyme-mediated double amplification nucleic acid amplification, and the kit is applied in the rapid on-site detection of tomato brown rugose fruit virus.

[0016] Preferably, the kit is used in conjunction with a palm metal bath and a palm fluorescence detector, and can meet the detection requirements of the on-site nucleic acid rapid detection scenario for detecting tomato brown rugose fruit virus.

[0017] The present invention also provides a detection method for detecting tomato brown rugose fruit virus based on enzyme-mediated double amplification nucleic acid amplification, and the method includes the following steps: A1) Collect samples, after treating with sample soaking solution, add them to a lysis tube, and extract sample DNA at 95°C for 10 minutes; A2) Using the sample DNA as a template, perform enzyme-mediated double exponential amplification nucleic acid detection with the kit to form an amplification curve; A3) Judge the detection result according to the Tt value; if there is no Tt value within the cycle, it indicates that the sample to be tested is not infected with tomato brown rugose fruit virus, and the detection result is negative. If a Tt value appears, it indicates that the sample to be tested is infected with tomato brown rugose fruit virus, and the detection result is positive.

[0018] The present invention targets the conserved region of the MP (movement protein) gene sequence in the genome of tomato brown rugose fruit virus, and designs RNA primers, DNA upstream primers and DNA downstream primers based on the enzyme-mediated dual-amplification nucleic acid rapid detection technology; through the sample to be tested, isothermal nucleic acid amplification and isothermal signal amplification reaction are carried out, and finally the fluorescence signal value is detected for judgment.

[0019] The kit of the present invention contains a nucleic acid amplification enzyme system and a signal amplification enzyme system, and integrates them into a reaction tube. The nucleic acid amplification enzyme system contains 4 enzymes (recombinase, single-strand binding protein, polymerase, ATP energy regeneration enzyme), and the signal amplification enzyme system contains 2 enzymes (transcriptase and nuclease), which can achieve dual amplification of the target nucleic acid.

[0020] The method of the present invention uses the enzyme-mediated dual exponential amplification (EmDEA) rapid nucleic acid detection technology, and completes molecular detection quickly and accurately through "exponential amplification + exponential reporting" of the target nucleic acid. As Figure 1 shown in the process in, first add the extracted target nucleic acid into the reaction system. The reaction system specifically amplifies (exponential amplification) the target nucleic acid sequence, transcribes the amplification product into target RNA, and then reverse transcribes the RNA single strand into DNA through reverse transcriptase; the RNA in the above RNA-DNA double strand is hydrolyzed by an engineered nuclease to form single-stranded DNA; after the specific RNA probe in the reaction system binds to the above target single-stranded DNA, it is hydrolyzed by an engineered nuclease to release a fluorescence signal; the target single-stranded DNA in the system can continue to bind the probe, and release a fluorescence signal after hydrolysis, realizing exponential reporting.

[0021] The RNA primer fluorescence probe in the kit of the present invention is a single-stranded nucleotide sequence with a FAM-labeled reporter group at the 5' end and a BHQ1-labeled quenching group at the 3' end. The FAM- and BHQ1-modified RNA primer fluorescence probe is used to display the fluorescence signal generated during the amplification process of the target gene. The fluorescence signal is proportional to the total amount of DNA binding to the probe.

[0022] The present invention prepares a system containing basic dry powder (recombinase, single-strand binding protein, polymerase, ATP energy regeneration enzyme, signal amplification enzyme system), DNA upstream primer (F5), DNA downstream primer (R6), RNA primer (RNA1), activation solution NTP (nucleoside triphosphate), buffer, RNase-free Water, lyoprotectant into pre-packaged freeze-dried balls, and includes nucleic acid amplification detection reagents in the kit for convenient on-site use.

[0023] The method of the present invention for on-site rapid detection of tomato brown rugose fruit virus based on enzyme-mediated dual amplification of nucleic acid is a rapid detection scheme, including the following steps: S1. Collect samples, treat them with sample soaking solution, add them to a lysis tube, and extract the sample DNA at 95°C for 10 minutes. S2. Using the DNA from step S1 as a template, add the pre-packaged lyophilized beads in the kit for isothermal amplification reaction. S3. Take the Tt value of the reaction fluorescence signal in step S2 as the detection result of tomato brown rugose fruit virus. If there is no Tt value within the cycle, it indicates that the sample to be tested is not infected with tomato brown rugose fruit virus, and the detection result is negative. If a Tt value appears, it indicates that the sample to be tested is infected with tomato brown rugose fruit virus, and the detection result is positive.

[0024] The above on-site molecular rapid detection scheme highly lyses the sample to be tested for 10 minutes. The nucleic acid amplification enzyme system, signal amplification enzyme system, RNA primer (RNA1), DNA upstream primer (F1), and DNA downstream primer (R1) are prepared into pre-packaged lyophilized beads. Only by adding the sample DNA, the reaction can be carried out on a palm-sized metal bath and a palm-sized fluorescence detector for 10 - 30 minutes, and the minute diagnosis can be completed.

[0025] Compared with the prior art, the present invention has the following beneficial effects: (1) The DNA extraction step provided by the present invention is simplified. Only the sample needs to be treated with the sample soaking solution, added to the lysis tube, and heat-treated for 10 minutes to complete.

[0026] (2) The enzyme-mediated dual-amplification nucleic acid amplification technology for detecting tomato brown rugose fruit virus in the present invention can amplify the target nucleic acid to 10 9 times within 10 - 30 minutes under the constant temperature condition of 42°C by integrating the nucleic acid amplification enzyme system amplification. By integrating the signal amplification enzyme system, more than 10,000 fluorescence signals can be generated from 1 nucleic acid amplification product under the constant temperature condition of 42°C. Finally, it achieves efficient and rapid detection of the sample.

[0027] (3) The present invention conducts molecular detection of tomato brown rugose fruit virus, has strong specificity, and the sensitivity can be as low as 1 copy / μL, enabling early detection of samples infected with tomato brown rugose fruit virus.

[0028] (4) The present invention can be used in conjunction with a portable palm-sized metal bath and a palm-sized fluorescence detector, and can be carried to any location such as rural sites for detection, meeting various on-site detection and monitoring application scenarios in the fields.

[0029] (5) The operation process of the present invention is simple, suitable for anyone to use, and has broad application prospects.

[0030] The kit of the present invention can achieve DNA detection at the aM level (converted to copy number, basically at the single-copy level). In addition to the rapid qualitative detection of tomato brown rugose fruit virus, it can also achieve the early screening of tomato brown rugose fruit virus. Through sequence analysis and comparison, the false negative rate of missed detection caused by the method of the present invention is extremely low. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 is a flow chart of the present invention for detecting tomato brown rugose fruit virus based on enzyme-mediated dual amplification nucleic acid amplification; Figure 2 is the analysis of MP gene mutation sites; Figure 3 is the RNA primer screening result of Example 2 of the present invention; Figure 4 is the DNA downstream primer screening result of Example 3 of the present invention; Figure 5 is the DNA downstream primer screening result of Example 3 of the present invention; Figure 6 is the DNA upstream primer screening result of Example 4 of the present invention; Figure 7 is the DNA upstream primer screening result of Example 4 of the present invention; Figure 8 is the specific experiment result of Example 5 of the present invention; Figure 9 is the sensitivity experiment result of Example 6 of the present invention; Figure 10 is the positive sample detection result of Example 7 of the present invention. DETAILED DESCRIPTION OF THE INVENTION

[0032] The present invention will be further described in detail below with reference to specific embodiments. The embodiments given are only for clarifying the present invention, rather than limiting the scope of the present invention.

[0033] A kit for detecting tomato brown rugose fruit virus based on enzyme-mediated dual amplification nucleic acid amplification, comprising 1) Nucleic acid amplification enzyme system: recombinase, single-stranded binding protein, polymerase and ATP energy regeneration enzyme; 2) Signal amplification enzyme system: positioning enzyme and cleavage enzyme; 3) Activating enzyme NTP: nucleoside triphosphate; 4) RNA primer, DNA upstream primer and DNA downstream primer; 5) RNA primer fluorescent probe; 6) Buffer, RNase-free Water, lyoprotectant; The reaction system composed of the above components is pre-prepared into pre-packaged freeze-dried balls.

[0034] A method for rapid on-site detection of Tomato brown rugose fruit virus based on enzyme-mediated dual amplification nucleic acid amplification, comprising the following steps: S1. Collect samples, after treating with a sample soaking solution, add them to a lysis tube, and extract sample DNA at 95°C for 10 minutes; S2. Using the DNA in step S1 as a template, add the pre-packaged freeze-dried beads in the kit for isothermal amplification reaction; S3. Take the Tt value of the reaction fluorescence signal obtained in step S2 as the detection result of Tomato brown rugose fruit virus. If there is no Tt value within the cycle, it indicates that the sample to be tested is not infected with Tomato brown rugose fruit virus, and the detection result is negative. If a Tt value appears, it indicates that the sample to be tested is infected with Tomato brown rugose fruit virus, and the detection result is positive.

[0035] Example 1 Target research and primer design: Tomato brown rugose fruit virus (abbreviated as ToBRFV) is a new species of the genus Tobamovirus, Virgaviridae family, Tobamovirus genus. The virus particles are rod-shaped, about 300 nm in length and about 17 nm in diameter.

[0036] The full-length genome of this virus is 6393 nt (base pairs). The genome structure is a typical virus structure of the genus Tobamovirus, including 4 ORFs (Open Reading Frames): ORF1 encodes a protein of 126.3 kDa, and ORF1 and ORF2 encode a protein of 183 kDa by means of codon readthrough. These two proteins are both related to virus replication; ORF3 encodes a movement protein (MP) of about 30 kDa, and ORF4 encodes a coat protein (CP) of about 17.5 kDa; According to its infection symptoms in tomatoes and genomic characteristics, this virus is named ToBRFV (Tomato brown rugose fruit virus).

[0037] All 4 ORFs in the whole genome have been reported in the literature as candidate target genes, among which ORF3 / MP and ORF4 / CP have been reported relatively more. Preliminary analysis shows that the homology among virus strains of ORF3 / MP is as high as 98.62%, and the homology with other closely related viruses (Tomato mosaic virus) is 81.76%. The homology among virus strains of ORF4 / CP is as high as 97.72%, and the homology with other closely related viruses (Tobacco mosaic virus) is 88.4%. Based on the above analysis, ORF3 / MP is selected as the candidate target gene.

[0038] Search for the full-length sequence of Tomato brown rugose fruit virus in NCBI. According to the alignment analysis of virus sequences in the database, the specific sequence mutation site information is as follows Figure 2 shown. The results show that there are 6 high-frequency mutation sites in the MP gene ( Figure 2 filled in red), and 6 medium-frequency mutation sites ( Figure 2 filled in blue). The bases at the positions marked in green are consistent in most virus strains, and the reference virus strain is mutated. When synthesizing plasmids later, the sequences of most virus strains are used for synthesis.

[0039] According to the above mutation site information, primers and RNA were designed for the MP gene, trying to avoid high-frequency and medium-frequency mutation sites. The primer design principle is as follows: the amplified sequences of the upstream and downstream primers are about 28 nt. In order to amplify the signal after target amplification, the T7 promoter sequence is introduced into the downstream primer; the RNA probe is 28 nt and modified with 5' 6-FAM 3' BHQ1. Since the amplification efficiency of primers cannot be predicted by sequences, multiple pairs of primers and probes were designed. Through effect screening, better primers and RNA were selected. The primers and RNA were synthesized by a third-party company for subsequent testing.

[0040] Table 1 Primer screening table

[0041]

[0042] Example 2 Primer screening

[0043] The positive sample of Tomato brown rugose fruit virus used in the experiment was from tomato virus-infected seeds. Continuous detection by fluorescence quantitative RT-PCR was all positive.

[0044] Operate using the FastPure Viral DNA / RNA Mini Kit (RC311-C1) to extract the total RNA of tomato seeds. The extracted RNA was reverse transcribed into cDNA and then aliquoted and stored in a -20°C refrigerator.

[0045] Reaction system: In an eight-strip tube containing basic dry powder (recombinase, single-stranded binding protein, polymerase, ATP energy regeneration enzyme, signal amplification enzyme system), add 1 μL of the upstream primer (10 μM) in Table 1, 1 μL of the DNA downstream primer (10 μM), 1 μL of the RNA primer (1 μM), and 7 μL of the target DNA (plasmid synthesized according to the amplified segment), then perform instantaneous centrifugation, let it stand at room temperature for 2 minutes, add 10 μL of the activation solution (a solution composed of NTP (nucleoside triphosphate) and buffer) along the wall of the eight-strip tube, and then perform instantaneous centrifugation; shake and mix evenly for 10 s, and perform on-machine detection after instantaneous centrifugation. Fluorescent quantitative PCR instrument (model Gentier 96E (TianLong), reaction temperature 42 °C, perform signal acquisition once for each cycle, a total of 30 cycles, reaction time is 30 minutes, and the reporter group is set to FAM.

[0046] Using the cDNA verified by previous RT-qPCR as the template and Tris-EDTA buffer (TE buffer, 10 mM Tris, adjusted to pH 8.0 with HCl, 1 mM EDTA) as the negative control, perform RNA primer screening. Take primer F2, F5 and primer R2, R4 for cross-combination testing, which are F2R2, F2R4, F5R2, F5R4 respectively. Add RNA primers RNA1, RNA2, RNA3, RNA4, RNA5, RNA6 to each group of primers respectively. Compare the corresponding identical primer groups, and select the RNA primer with the smallest Tt value, the highest end fluorescence value, and the smallest deviation of detection replicates. At the same time, according to the RNA primer, determine the screening results of the corresponding 4 groups of DNA primers, and select the primer group with the smallest Tt value, the highest end fluorescence value of the RNA primer, and no amplification signal in the negative control. The results show that when the 4 groups of primers F2R2, F2R4, F5R2, F5R4 and the 6 RNA primers RNA1, RNA2, RNA3, RNA4, RNA5, RNA6 are combined respectively, there are a total of 24 combinations, and 8 of them have better amplification effects. Among them, the Tt value of the F5R2+RNA1 combination is the lowest at 4.23, the deviation of detection replicates is the smallest, and there is no amplification signal in the negative control. Determine to select the RNA1 primer and take the F5R2 combination to carry out subsequent experiments ( Figure 3 )

[0047] Example 3 Using the cDNA of tomato brown rugose fruit virus as a template, according to the sample addition system of Example 2, fixing the RNA1 primer (RNA primer) and the upstream primer F5, and respectively taking the downstream primers R1, R2, R3, R4, R5, R6 for screening; using the tomato brown rugose fruit plasmid as a template, according to the sample addition system of Example 2, fixing the RNA1 primer (RNA primer) and the upstream primer F5, and respectively taking the downstream primers R7, R8, R9, R10, R11, R6 for screening, and selecting the RNA primer with the smallest Tt value and the highest end fluorescence value and the primer group with no amplification signal in the negative control. The results show that in the screening results of the DNA downstream primers, the R6 group has a relatively low Tt value of 5.02 and a relatively high fluorescence value, indicating that the downstream primer R6 has a better effect and there is no amplification signal in the negative control. It is determined to select the RNA1+R6 primer, and the F5R6 combination is taken to carry out the subsequent experiment ( Figure 4 and Figure 5 )

[0048] Example 4 Using the cDNA of tomato brown rugose fruit virus as a template, according to the sample addition system of Example 2, fixing the RNA1 primer and the downstream primer R6, and respectively taking the upstream primers F1, F2, F3, F4, F5, F6 for screening; using the tomato brown rugose fruit plasmid as a template, according to the sample addition system of Example 2, fixing the RNA1 primer and the downstream primer R6, and respectively taking the upstream primers F7, F8, F9, F10, F5 for screening, and selecting the DNA primer with the smallest Tt value and the highest end fluorescence value and the primer group with no amplification signal in the negative control. The results show that in the screening results of the DNA upstream primers, the F5 group has a relatively low Tt value of 6.05 and a relatively high fluorescence value, indicating that the upstream primer F5 has a better effect and there is no amplification signal in the negative control. It is determined to select the F5 primer, and it is determined to use the F5R6+RNA1 combination to carry out the experiment ( Figure 6 and Figure 7 )

[0049] Example 5 Specific Detection Use the FastPure Viral DNA / RNA Mini Kit (RC311-C1) to extract tomato seed RNA and commercially synthesized tomato brown rugose fruit plasmid as templates. According to the sample addition system of Example 2, use TE as the negative control, use ribonuclease-free water as the blank control, and perform specific detection on the screened optimal primer group F5R6+RNA1 according to the reaction system, time, and temperature of Example 2. The results show that tomato brown rugose fruit virus RNA and plasmid are detected, and neither the negative control nor the blank control is detected, indicating that the primer and probe combination screened by the present invention has high specificity ( Figure 8 )

[0050] Example 6 Sensitivity Test Reaction system: A system containing basic dry powder (recombinase, single-stranded binding protein, polymerase, ATP energy regeneration enzyme, signal amplification enzyme system), DNA upstream primer (F5), DNA downstream primer (R6), RNA primer (RNA1), activation solution NTP (nucleoside triphosphate), buffer, RNase-free Water, and lyoprotectant was prepared into pre-packaged freeze-dried beads. 50 μL of template DNA was added to the freeze-dried beads, the lid was covered, and the mixture was shaken and mixed for 10 s. After centrifugation for 10 s, it was loaded onto the machine for detection. Using a fluorescence quantitative PCR instrument, the reaction temperature was 42 °C, signal collection was performed once per cycle, for a total of 30 cycles, the reaction time was 30 minutes, and the reporter group was set to FAM.

[0051] The nucleic acid of tomato seed RNA virus was extracted and serially diluted with RNase-free Water. Dilutions / E4, / E5, and / E6 were selected for loading onto the machine for detection, and the sensitivity was detected using the optimal primer set F5R6+RNA1 obtained by screening. The results showed that according to the experimental results, the lowest dilution of the nucleic acid extracted from the RNA virus that could be detected by the screened primer probe was / E6, indicating high sensitivity ( Figure 9 ).

[0052] Example 7 Accuracy Test Using laboratory tomato seeds or leaves as test samples, after soaking and rubbing the samples with the sample soaking solution, they were added to a lysis tube, and the sample RNA was rapidly extracted at 95 °C for 10 minutes. Tomato brown rugose fruit virus RNA was used as a positive control, TE as a negative control, and RNase-free Water as a blank control. The optimal primer set F5R6+RNA1 obtained by screening was used to judge the effect of this method in actual samples according to the sample loading system, time, and temperature in Example 5. 5 samples were randomly selected from the laboratory for detection, and the remaining samples were used for qPCR detection. The results showed that the detection results of the 5 samples were consistent with those of qPCR, and the accuracy rate reached 100% (as shown in Table 2 and Figure 10 ).

[0053] Table 2. Comparison of the results of this implementation method and the qPCR detection method

[0054] Example 8 Rapid on-site nucleic acid sampling To improve the convenience of on-site use, in addition to the detection system, the sampling method and sample processing scheme are also extremely important. For seed samples, use a 0.02g small spoon (purchased on Taobao) to scoop one spoonful and add it to the lysis buffer (purchased from Suzhou Jingrui Biotechnology Co., Ltd., medical device preparation number: 20211362), and use a handheld metal bath to heat it at 95°C for 10 min. For leaf samples, the operator wears disposable gloves, tears off a leaf the size of a fingernail, adds it to the lysis buffer (purchased from Suzhou Jingrui Biotechnology Co., Ltd., medical device preparation number: 20211362), and uses a handheld metal bath to heat it at 95°C for 10 min. Using tomato brown rugose fruit virus RNA as a positive control and TE as a negative control, detect the above two types of samples using the freeze-dried beads described in Example 6. The results show that the rapid sampling method can normally detect positive samples.

[0055] Table 3 TT values for rapid sampling detection of seed samples and leaf samples

[0056] Example 9 Optimization of sample processing scheme To achieve on-site rapid test verification, the shorter the sample processing time, the better. Shorten the extraction time to 5 min to test positive tomato seeds. Cut a single seed in half and add it to two tubes of lysis buffer respectively; for leaf samples, divide a leaf into two parts and add it to two tubes of lysis buffer, and heat at 95°C for 5 min / 10 min. Using tomato brown rugose fruit virus RNA as a positive control and TE as a negative control, detect the above two types of samples using the freeze-dried beads described in Example 6. The results show that there is no significant difference in performance when the extraction time is shortened to 5 min, and heating for 5 min can be used as a rapid processing process for on-site samples.

[0057] Table 4 TT values for shortened extraction time test

[0058] Example 10 Simplification of freeze-dried bead operation To meet the requirements of on-site rapid testing, the oscillating mixing and centrifugation operations after adding samples to the freeze-dried beads need to be independent of instrument dependence and be purely manual operations. Using the freeze-dried bead detection system of Example 6, after adding samples to the same sample, perform oscillating mixer mixing, centrifuge centrifugation, and manual mixing respectively, and collect the liquid by hand shaking to compare the detection performance. The results show that there is no significant difference between manual operation and machine operation, and manual mixing can be directly used on-site.

[0059] Table 5 TT values for comparison of detection results between manual mixing and machine mixing

[0060] Example 11 On-site rapid testing According to the final full-process system, a spoon and disposable gloves are used for sampling. The sample processing time is 5 minutes, and the detection duration is 20 minutes. At the scene, a palm-top metal bath and a palm-top fluorescence detector are used in combination to test seeds and leaves. Tomato brown rugose fruit virus RNA is used as a positive control, and TE is used as a negative control. The lyophilized beads described in Example 6 are used to detect the above two types of samples. The specific operations are as follows: Use a 0.02 g small spoon (purchased from Taobao) to scoop up one spoonful and add it to the lysis solution; for leaf samples, the operator wears disposable gloves, tears off a leaf the size of a fingernail cover, and adds it to the lysis solution; for the above samples, use a palm-top metal bath to heat-treat at 95 °C for 5 min; take out the lyophilized bead for tomato brown rugose fruit virus detection, add 50 μL of the above-treated sample to the lyophilized bead, cover the lid and manually shake and mix for 10 s, flick the liquid to the bottom of the tube, put it into the palm-top fluorescence detector, and start it with one key to automatically run the detection program. After 20 minutes, the instrument automatically displays the detected TT value and the detection result of positive or negative relying on the internal algorithm. The whole process does not exceed 30 minutes, and a strong positive result can be displayed within 10 minutes. In Scenario 1, a socket is used to supply power to the palm-top metal bath and the palm-top fluorescence detector, and in Scenario 2, an 84 Wh mobile power supply is used to supply power to the above two portable instruments. The results are shown in Table 6.

[0061] Table 6 TT values of on-site tests of seeds and leaves

[0062] The present invention selects the primer and probe combinations with the best specificity, sensitivity, and accuracy, enabling the kit to achieve DNA detection at the aM level; the reagents necessary for the test are pre-prepared in the lyophilized beads, facilitating rapid on-site detection. The process is fast and simple, realizing the rapid qualitative detection of tomato brown rugose fruit virus.

[0063] It should be understood that the terms used in the embodiments of the present application are only for the purpose of describing specific embodiments, and are not intended to limit the present application. The singular forms "a", "the", and "said" used in the embodiments of the present application and the appended claims are also intended to include the plural forms, unless the context clearly indicates otherwise. "Plural" generally includes at least two, but does not exclude the case of including at least one.

[0064] It should also be noted that the term "comprising", "including" or any other variant thereof is intended to cover non-exclusive inclusion, so that a commodity or system including a series of elements not only includes those elements, but also includes other elements not explicitly listed, or further includes elements inherent to such commodity or system. Without further limitation, an element defined by the statement "including one..." does not exclude the existence of another identical element in the commodity or system including the said element.

[0065] Finally, it should be noted that those of ordinary skill in the art can understand that in order to enable readers to better understand this application, many technical details are presented in the embodiments of this application. However, even without these technical details and various changes and modifications based on the above embodiments, the technical solutions claimed in each claim of this application can be basically implemented. Therefore, in practical applications, various changes can be made to the above embodiments in form and details without departing from the spirit and scope of this application.

Claims

1. A kit for detecting tomato brown wrinkled fruit virus based on enzyme-mediated dual amplification nucleic acid amplification, characterized in that: The kit comprises 1) Nucleic acid amplification enzyme system: recombinase, single-strand binding protein, polymerase and ATP energy regeneration enzyme; 2) Signal amplification enzyme system: positioning enzyme and cutting enzyme; 3) Activating enzyme NTP: nucleoside triphosphate; 4) RNA primer, DNA upstream primer and DNA downstream primer; 5) RNA primer fluorescent probe; 6) Buffer, RNase-free water, lyophilization protective agent; Wherein, the reaction system composed of the above components is prepared into pre-packed freeze-dried balls; The kit also includes a sample RNA of tomato brown wrinkled fruit virus; The kit also includes a high-efficiency lysis solution for extracting RNA from a tomato brown wrinkled fruit virus detection sample, wherein the high-efficiency lysis solution includes Tris (pH 8), NaCl, EDTA, SDS, PVP-40 and a broad-spectrum protease; The nucleotide sequence of the RNA primer is: FAM-GAGAGCGGACGAGGCAACUCUUGCUUCA-BHQ1, the DNA upstream primer is 5'-GATAATTGTCGTGGTGGTGTCAGTGTCT-3', and the DNA downstream primer is 5'-AAGCTAATACGACTCACTATAGGGGCGTCCTTGGTAGTGATGTTGTAATTTG-3'; The RNA primer fluorescent probe is a single-stranded nucleotide sequence with a FAM-labeled reporter group at the 5' end and a BHQ1-labeled quencher group at the 3' end; The method for using the kit comprises the following steps: A1) Collect the sample, treat it with sample soaking solution, add it to the lysis tube, and extract the sample RNA at 95℃ for 10 minutes; A2) using the sample RNA as a template, performing enzyme-mediated dual exponential amplification nucleic acid detection using the kit to form an amplification curve; A3) Determine the test result based on the Tt value; if there is no Tt value in the cycle, it means that the sample to be tested is not infected with Tomato Brown Fruit Virus, and the test result is negative. If there is a Tt value, it means that the sample to be tested is infected with Tomato Brown Fruit Virus, and the test result is positive.

2. The kit according to claim 1, characterized in that The kit also contains a plasmid standard of the gene fragment of the movement protein of tomato brown wrinkled fruit virus.

3. The kit according to claim 1, characterized in that The contents of the components of the kit in the reaction system are: Buffer: 10-30 mM Tris-HAc, pH 7.2-7.8; 20-80 mM potassium acetate; 2-5 mM magnesium acetate; 1-4 mM mercaptoethanol; 0.5-1 mM ATP; Lyophilization protective agent: 1% to 3.5% by mass of polyethylene glycol (PEG) 20000; 50-100 μM dNTPs; 10-500 nM of a primer pair consisting of a DNA upstream primer and a DNA downstream primer; RNA primers of 10 to 500 nMMP; 5~100nM recombinase, 10~200nM single-chain binding protein, 5~100nM polymerase, .1~2μM ATP energy regeneration enzyme; 0.05~2.5μM positioning enzyme, 0.05~2.5μM cutting enzyme.

4. An application of a kit for detecting tomato brown wrinkled fruit virus based on enzyme-mediated dual amplification nucleic acid amplification, characterized in that: The kit is used for rapid on-site detection of tomato brown wrinkled fruit virus.

5. The use according to claim 4, characterized in that The test kit is used in conjunction with a handheld metal bath and a handheld fluorescence detector to detect tomato brown wrinkled fruit virus in the on-site rapid nucleic acid test scenario.

Images