DNA microarray chip with ordered nanostructure and application of DNA microarray chip

Abstract

The invention discloses a DNA microarray chip with an ordered nanostructure and application thereof, the DNA microarray chip is mainly composed of an ordered silicon film array formed by self-assembly of SiO2 microspheres, the particle size of the silicon spheres is 250-650nm, a single-layer densely arranged ordered nanostructure is formed on the surface of a silicon wafer, and probes are distributed on the silicon wafer modified by an aldehyde group to form a spot array. The silicon film array is used as a substrate, SiO2 microspheres are self-assembled on a silicon wafer, the SiO2 microsphere array has optical characteristics, movement of DNA to a solid-liquid interface is accelerated, the probability of collision between DNA and probe DNA is increased, and finally DNA hybridization efficiency and imaging efficiency are improved.

Description

Technical Field

[0001] The present invention relates to the technical field of nucleic acid detection in biochemistry, in particular to a DNA microarray chip with an ordered nanostructure and applications thereof. Background Art

[0002] Nucleic acid molecules are essential genetic material in living organisms. Accurately and sensitively capturing changes in nucleic acid molecules plays a vital role in the prevention, diagnosis, and treatment of diseases. Nucleic acid detection technology, which enables qualitative and quantitative analysis of nucleic acids, is widely used in clinical medicine, laboratory medicine, molecular biology, genomics, food safety, and other related fields, making it an indispensable testing method in the development of life sciences. Multiplexed nucleic acid detection technology can simultaneously detect multiple targets, meeting the needs of large-scale screening and other testing requirements. DNA microarrays use spatial encoding to achieve simultaneous detection of multiple nucleic acids.

[0003] In the life sciences, most recognition reactions occur at solid-liquid interfaces. DNA microarrays at these interfaces can capture specific nucleic acid sequences and have significant applications in genetic screening, DNA sequencing, and disease diagnosis. Compared to homogeneous solutions, the efficiency of DNA hybridization at solid-liquid interfaces is not only affected by solution composition and thermodynamic factors, but also by the properties of the solid-liquid interface, including electrostatic repulsion, steric hindrance, and hybridization kinetics. This limits the mass transfer efficiency of target DNA at the solid-liquid interface, reducing the collision probability and hybridization efficiency of probe DNA at the interface. Therefore, designing biosensing interfaces to enhance recognition kinetics and hybridization efficiency is crucial. Recent studies have demonstrated that altering DNA structure and chemically modifying the interface can improve DNA hybridization efficiency at solid-liquid interfaces. Furthermore, molecular mass transfer rates can be modulated by altering the interface structure and properties. Summary of the Invention

[0004] The present invention aims to address, at least to some extent, one of the technical problems in the related art. To this end, the present invention uses a silicon film array as a substrate to self-assemble SiO2 microspheres on a silicon wafer, forming a DNA microarray with an ordered nanostructure. The SiO2 microsphere array accelerates the migration of target DNA to the solid-liquid interface, increasing the probability of collision between target DNA and probe DNA, ultimately improving DNA hybridization efficiency and imaging efficiency. This strategy exhibits rapid DNA hybridization kinetics and high sensitivity.

[0005] The present invention adopts the following technical solutions:

[0006] Firstly,

[0007] The present invention provides a method for preparing a DNA microarray chip with an ordered nanostructure, comprising the following steps:

[0008] S1: Preparation of SiO2 microsphere suspension: Anhydrous ethanol, ultrapure water, and ammonia water were mixed to obtain a mixed solution A, and TEOS (tetraethyl orthosilicate) was then added dropwise to the mixed solution A. The mixture was reacted for 15-16 hours to synthesize SiO2 microspheres of 250-650 nm. After centrifugation, the resulting mixture was dispersed in a methanol solution to prepare a SiO2 microsphere suspension with a concentration of 5 wt%;

[0009] S2: Film removal: Chloroform is added to the SiO2 microsphere suspension to obtain a mixture B. An appropriate amount of the mixture B is then placed on a water surface. The microspheres spontaneously diffuse on the water surface. When a purple film forms on the water surface, 0.2% SDS surfactant is added dropwise to compress the SiO2 film. The film is then removed with a clean silicon wafer and dried to obtain a silicon wafer after film removal.

[0010] S3: Silicon wafer modification: The silicon wafer after film removal is subjected to hydroxylation, amination, and formaldehyde modification to obtain a film-modified silicon wafer;

[0011] S4: Fix the probes on the membrane-modified silicon wafer to form a microarray chip.

[0012] In some embodiments, in step S1, the volume ratio of anhydrous ethanol, ultrapure water, ammonia water, and TEOS is: (20-90): (1-3): (5-20): (0.5-3.5).

[0013] In a preferred embodiment, in step S1, the synthesized SiO2 microspheres are 300-500 nm. More preferably, the synthesized SiO2 microspheres are 350 nm.

[0014] In some embodiments, in step S2, the volume ratio of chloroform to SiO2 microsphere suspension is 2:3. When the water surface area is 150 cm 2 When the mixture B was added dropwise, the amount was about 200 μL, and the amount of 0.2% SDS surfactant added dropwise was 20 μL.

[0015] In some embodiments, step S3 includes:

[0016] (1) Hydroxylation: Hydroxylate the silicon wafer after film removal in a plasma machine for 5 minutes;

[0017] (2) Amination: The silicon wafer with hydroxylated surface was assembled in 10mM APTES (3-aminopropyl-triethoxysilane) anhydrous ethanol solution for 4 hours. The silicon wafer was taken out and rinsed twice with anhydrous ethanol on a shaker and dried with cold air. The obtained silicon wafer was baked at 100-110°C for 45 minutes to allow APTES (3-aminopropyl-triethoxysilane) to be completely assembled with the silicon wafer.

[0018] (3) Aldehyde formation: The assembled silicon wafer was immersed in 2.5% glutaraldehyde solution for 4 h, rinsed twice with deionized water on a shaker, and dried with cold air;

[0019] (4) Package and store in the dark at room temperature for future use.

[0020] In some embodiments, step S4 includes:

[0021] (1) Probe fixation: The DNA probe was dissolved in spotting buffer and spotted on the membrane-modified silicon wafer using a spotting machine. The spot diameter was 400 μm and the spacing was 1.5 mm. After spotting, the probe was placed in a reaction box and reacted overnight in a constant temperature and humidity chamber at 37°C and 75% relative humidity. The chip was removed from the reaction box the next day.

[0022] (2) Post-treatment: Wash with ultrapure water three times to remove unfixed DNA probes. Place the cleaned chip in aldehyde blocking solution and block for 20 min to remove unreacted active aldehyde groups on the chip substrate. After the reaction is completed, wash with PBS buffer solution three times and ultrapure water three times, dry with cool air, and store in the dark.

[0023] In some embodiments, the probe spotting buffer is 3×SSC (450 mM NaCl, 45 mM sodium citrate, pH 7.0) + 2.5 M betaine.

[0024] In some embodiments, the aldehyde blocking solution is 2.5 mg / mL NaBH4 in PBS buffer with 25% (v / v) ethanol, pH 7.4.

[0025] Secondly,

[0026] The present invention also provides a DNA microarray chip with an ordered nanostructure, which is prepared by the above-mentioned preparation method.

[0027] In some embodiments, the DNA microarray of ordered nanostructures is mainly composed of an ordered silicon film array formed by self-assembly of SiO2 microspheres. The particle size of the silicon spheres is 250-650nm, and common sizes include 350nm, 500nm, etc., to optimize hybridization efficiency and detection sensitivity. These microspheres form a single layer of densely arranged ordered nanostructures on the surface of the silicon wafer through interfacial self-assembly technology, thereby improving the transmission efficiency of the target DNA to the solid-liquid interface. The probes are distributed on the aldehyde-modified silicon wafer to form a spot array with a diameter of 400μm and a spacing of 1.5mm to enhance the spatial uniformity of DNA hybridization.

[0028] Thirdly,

[0029] The present invention also provides a detection kit for detecting high-risk HPV viruses, which is prepared by using the DNA microarray chip with the ordered nanostructure.

[0030] In some embodiments, the high-risk HPV virus is HPV16 and / or HPV18; and the detection kit comprises:

[0031] (1) The DNA microarray chip described above, wherein the probes of the DNA microarray chip include an HPV16 detection probe and / or an HPV18 detection probe;

[0032] (2) HPV16 amplification primers and / or HPV18 amplification primers; the HPV16 amplification primers include an HPV16 forward primer and an HPV16 reverse primer; the HPV18 amplification primers include an HPV18 forward primer and an HPV18 reverse primer.

[0033] In some embodiments, the sequence of the HPV18 detection probe is as shown in SEQ ID NO: 1-NH2 (3' amino group modified); the sequence of the HPV16 detection probe is as shown in SEQ ID NO: 2-NH2 (3' amino group modified);

[0034] The HPV18 forward primer is modified with ISP18 at the 5' end to form a hairpin structure, which is 5'-SEQ ID NO:3 / ISP18 / SEQ ID NO:4-3'; the HPV18 reverse primer is FAM-SEQ ID NO:5 (5' end FAM modified);

[0035] The HPV16 forward primer is modified with ISP18 at the 5' end to form a hairpin structure, which is 5'-SEQ ID NO:6 / ISP18 / SEQ ID NO:7-3'; the HPV16 reverse primer is FAM-SEQ ID NO:8 (5' end FAM modified);

[0036] 5'-ACGAGAAGAGGCTTaaaaaaaaaa-3'(SEQ ID NO:1)

[0037] 5'-CATAGATTCCGTCCaaaaaaaaaa-3'(SEQ ID NO:2)

[0038] 5'-AAGCC TCTTC TCGT-3'(SEQ ID NO:3)

[0039] 5'-ACGAGAAGAGGCTT TAGTG TGGGC CTGTG CTGGAGGTGGAAATTG-3'

[0040] (SEQ ID NO:4)

[0041] 5'-GGCGG CATGG GAACT TTCAG TGTCATCTAA-3' (SEQ ID NO:5)

[0042] 5'-ACTCATGGACTCGA-3'(SEQ ID NO:6)

[0043] 5'-TCGA GTCCATGAGT CCTGA CCCCAATAAG TTTGG TTTTC CTGAC-3'(SEQ ID NO:7)

[0044] 5'-CACCTAATGG CTGAC CACGACCTAC CTCAA-3'(SEQ ID NO:8)

[0045] In some embodiments, the detection kit further comprises a probe binding buffer, wherein the probe binding buffer comprises: 1×NEBuffer 3.1 (50 mM Tris-HCl, 100 mM NaCl, 10 mM MgCl2, 100 μg / mL BSA, pH 7.9), 1×Isothermal amplification (20 mM Tris-HCl, 50 mM KCl, 10 mM (NH4)2SO4, 2 mM MgSO4, 0.1% Tween-20, pH 8.8)

[0046] Compared with conventional DNA microarrays, the SiO2 microsphere array chip of the embodiment of the present invention is used to prepare a detection kit for detecting high-risk HPV viruses, and can achieve rapid, simple and high-throughput real-time DNA detection.

[0047] It is understandable that conventional DNA microarray assays suffer from long hybridization times, complex elution steps, and low imaging detection efficiency, making real-time nucleic acid detection difficult. Furthermore, conventional amplification products must undergo heat denaturation for use in DNA microarray assays, which is both complex and time-consuming. In the embodiments of the present invention, ISP18 is used to modify nucleic acid chains to form a hairpin structure, enhancing the flexibility of each oligonucleotide chain while preventing complementary pairing with other nucleic acid chains in the system. This allows the product to form a single-stranded structure, simplifying the operational process and enabling direct use of the product in DNA microarray assays.

[0048] The present invention has the following advantages and beneficial effects:

[0049] (1) The present invention uses a silicon film array as a substrate to self-assemble SiO2 microspheres on a silicon wafer. The SiO2 microsphere array has optical properties that accelerate the movement of DNA to the solid-liquid interface, increase the probability of collision between DNA and probe DNA, and ultimately improve DNA hybridization efficiency and imaging efficiency;

[0050] (2) The kit for detecting high-risk HPV viruses by using an ordered nanostructured DNA microarray of the present invention can realize the simultaneous detection of multiple targets, and can detect DNA quickly, simply and in high throughput. The experiment is short in time, simple to operate, does not require temperature cycling, and can be amplified quickly and effectively at a constant temperature, thus simplifying the requirements for the instrument. Specifically, the forward and reverse primers of the embodiment of the present invention are modified with ISP18 and a fluorescent group, respectively, and a hairpin structure is introduced at the ISP18 end. This design can improve the flexibility of each part of the oligonucleotide chain, and at the same time will not produce complementary pairing with other nucleic acid chains in the system, so that the product can form a structure with a single strand at the end, which can simplify the operation process and the product can be directly used for DNA microarray detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] Figure 1 Schematic diagram of the detection principle of high-risk HPV virus detection based on the ordered nanostructured DNA microarray in the present invention.

[0052] Figure 2 Schematic diagram of the preparation of silicon spheres in the present invention, (a) is a schematic diagram of regulating silicon spheres of different sizes by controlling the variables of TEOS, and (b) is a schematic diagram of regulating silicon spheres of different sizes by controlling the variables of anhydrous ethanol.

[0053] Figure 3 Schematic diagram of the fixation of single-stranded probes in the present invention.

[0054] Figure 4 This is a diagram showing the characterization results of silicon spheres of different sizes and the ordered silicon film substrates constructed therefrom in the present invention; wherein, TEM is a transmission electron microscope, used to characterize the silicon spheres;

[0055] SEM is a scanning electron microscope, which is used to characterize the array substrate;

[0056] AFM is an atomic force microscope, which is used to characterize the array substrate;

[0057] LSCM is a confocal microscope used to characterize the imaging results.

[0058] Figure 5 This is a comparison diagram of the glass and silicon wafer substrates with and without film removal in the present invention;

[0059] (a) is the substrate fluorescence imaging of the glass and silicon wafers with and without the film removed, (b) is the substrate fluorescence imaging analysis of the glass and silicon wafers with and without the film removed, (c) is a comparison of the potassium permanganate solution added to the glass wafers with and without the film removed, and (d) is a comparison of the potassium permanganate solution added to the silicon wafers with and without the film removed.

[0060] Figure 6 Figure 1 is a result diagram of the multiple detection performance of the DNA microarray chip in the present invention, (a) is a schematic diagram of the imaging results of different simulation products, (b) is a schematic diagram of different probe arrangements, and (c) is a thermal map analysis result of detecting different simulation products.

[0061] Figure 7 This is a comparison diagram of the imaging efficiency on an ordered silicon film silicon wafer substrate and an ordered silicon film glass substrate in the present invention.

[0062] Figure 8 This is a comparison chart of the time recovery efficiency on the ordered silicon film glass substrate and the modified glass sheet in the present invention.

[0063] Figure 9 The results are a sensitivity comparison of the ordered silicon film silicon wafer substrate, the ordered silicon film glass substrate, and the modified glass wafer in the present invention.

[0064] Figure 10 This is the specific result of the simulated product detection on the ordered silicon film silicon wafer substrate in the present invention.

[0065] Figure 11 This is the imaging result of detecting HPV18 based on the DNA microarray and RPA amplification method in the present invention.

[0066] Figure 12 This is the hybridization time result between the RPA product and the DNA microarray probe in the present invention.

[0067] Figure 13 This is the sensitivity of detecting HPV18 based on the DNA microarray and RPA amplification method in the present invention.

[0068] Figure 14 This is the sensitivity of detecting HPV16 based on the DNA microarray and RPA amplification method in the present invention.

[0069] Figure 15 Figures 1 and 2 show the results of the simultaneous detection of HPV16 / 18 using DNA microarray and RPA amplification methods in the present invention. Figure a shows the imaging results of the HPV16 product, Figure b shows the imaging results of the HPV18 product, and Figure c shows the imaging results of the HPV16 / 18 product.

[0070] Figure 16These are the results of the RPA primer amplification optimization experiment of the present invention. Figure a is the imaging result of the product amplified using the old primers, and Figure b is the imaging result of the product amplified using the new primers. DETAILED DESCRIPTION

[0071] The specific embodiments of the present invention will be described below in conjunction with the embodiments of the present invention. Unless otherwise specified, the technical means used in the following embodiments and experimental examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used can be obtained from commercial channels.

[0072] In the embodiment of the present invention, the detection signal of the probe is collected by a super-resolution confocal microscope with the following parameters: excitation wavelength of 488 nm, pixel size of 8.63 μm, and the collected image results are saved in TIFF format.

[0073] The collected imaging results were analyzed using ImageJ software for fluorescence signal and background signal values, and the mean and standard deviation of the signal were calculated from the data of 6 fluorescent spots.

[0074] Example 1

[0075] A method for constructing an ordered nanostructured DNA microarray chip comprises the following steps:

[0076] (1) Preparation of SiO2 microsphere suspension

[0077] Mix 20-90mL of anhydrous ethanol, 1-3mL of ultrapure water, and 5-20mL of aqueous ammonia for approximately one minute. Then, add 0.5-3.5mL of LTEOS dropwise to the mixture. The solution gradually turns milky white and reacts for approximately 16 hours to synthesize SiO2 microspheres approximately 250-650nm in diameter. By varying the experimental parameters, SiO2 microspheres of varying particle sizes can be obtained. Finally, the mixture is centrifuged at 8000rpm for 10 minutes to remove any unreacted material. The mixture is then dispersed in methanol to form a 5wt% SiO2 microsphere suspension.

[0078] Combine Figure 2 Description, with Figure 2Taking (a) as an example, when the amount of anhydrous ethanol is 50 mL, the amount of ultrapure water is 1 mL, and the amount of ammonia water is 10 mL, as the amount of TEOS increases from 0.5 mL to 3.5 mL (0.5 mL, 0.75 mL, 1 mL, 1.5 mL, 2 mL, 2.5 mL, 3 mL, and 3.5 mL in the figure), the size of the SiO2 microspheres increases from 350 nm to 650 nm (the corresponding sizes of the SiO2 microspheres are 350 nm, 370 nm, 380 nm, 400 nm, 460 nm, 500 nm, 550 nm, and 650 nm in order). The results show that the size of the SiO2 microspheres can be controlled by changing the amount of TEOS. The more TEOS is used, the larger the size of the SiO2 microspheres. Taking Figure b as an example, when the amount of ultrapure water is 1 mL, the amount of ammonia water is 10 mL, and the amount of TEOS is 1 mL, as the amount of anhydrous ethanol increases from 20 mL to 90 mL (20 mL, 30 mL, 40 mL, 50 mL, 60 mL, 70 mL, 80 mL, and 90 mL in the figure), the size of the SiO2 microspheres decreases from 550 nm to about 250 nm (the corresponding sizes of the SiO2 microspheres are 550 nm, 530 nm, 460 nm, 420 nm, 350 nm, 300 nm, 280 nm, and 250 nm in order). The results show that the size of the SiO2 microspheres can be controlled by changing the amount of anhydrous ethanol. The more anhydrous ethanol is used, the smaller the size of the SiO2 microspheres.

[0079] Specifically, the present invention prepared 250nm, 350nm, 500nm, and 650nm SiO2 microspheres using the following conditions: 250nm SiO2 microspheres: 90mL of anhydrous ethanol, 1mL of ultrapure water, 10mL of aqueous ammonia, and 1mL of TEOS. 350nm SiO2 microspheres: 60mL of anhydrous ethanol, 1mL of ultrapure water, 10mL of aqueous ammonia, and 1mL of TEOS. 500nm SiO2 microspheres: 50mL of anhydrous ethanol, 1mL of ultrapure water, 10mL of aqueous ammonia, and 2.5mL of TEOS. 650nm SiO2 microspheres: 50mL of anhydrous ethanol, 1mL of ultrapure water, 10mL of aqueous ammonia, and 3.5mL of TEOS.

[0080] (2) fishing out the film, comprising the following steps:

[0081] Chloroform was added to the SiO2 microsphere suspension in a volume ratio of 2:3, taking about 6 μL each time, for a total of about 200 μL (the last aliquot was less than 6 μL, so all was added directly), and placed on the water surface (the water surface area was about 150 cm). 2The microspheres spontaneously diffused on the water surface. The surface was then observed. When a purple film formed, 20 μL of 0.2% SDS surfactant was added to compress the SiO2 film. The film was then removed with a clean silicon wafer and dried for later use.

[0082] (3) Silicon wafer modification:

[0083] Hydroxylation: Hydroxylate the silicon wafer after film removal in a plasma machine for 5 minutes.

[0084] Amination: The hydroxylated silicon wafer was assembled in a 10 mM APTES (3-aminopropyl-triethoxysilane) solution in anhydrous ethanol for 4 hours. The wafer was removed and rinsed twice with anhydrous ethanol on a shaker, then blow-dried with a hair dryer on cold air. The resulting wafer was then placed in an oven and baked at 100-110°C for 45 minutes to completely assemble the APTES (3-aminopropyl-triethoxysilane) into the wafer.

[0085] Aldehyde formation: The assembled silicon wafer was immersed in 2.5% glutaraldehyde solution for 4 hours, then taken out and rinsed twice with deionized water in a shaker, and dried with a hair dryer with cold air.

[0086] The final product (i.e., the ordered silicon film silicon wafer substrate) is packaged and stored away from light at room temperature for future use.

[0087] (4) Microarray preparation:

[0088] 1) Probe Immobilization: Dissolve the probe in spotting buffer (3×SSC (450 mM NaCl, 45 mM sodium citrate, pH 7.0) + 2.5 M betaine) and spot the probe onto the ordered silica membrane wafer substrate using a dispenser (spot diameter 400 μm, 1.5 mm spacing). Place the probe in a reaction chamber and react overnight in a constant temperature and humidity chamber (37°C, 75% relative humidity). Remove the chip from the reaction chamber the next day.

[0089] 2) Post-treatment: Rinse three times with ultrapure water to remove unfixed DNA probe. Place the cleaned chip in an aldehyde blocking solution (2.5 mg / mL NaBH4 in PBS buffer (pH 7.4) with 25% (v / v) ethanol) for 20 minutes to remove unreacted active aldehyde groups on the chip substrate. After the reaction, rinse three times with PBS buffer and three times with ultrapure water. Air dry under cool air and store in a dark place.

[0090] Material characterization

[0091] Combine Figure 4 illustrate, Figure 4The morphology and distribution of nanoparticles of different particle sizes (250nm, 350nm, 500nm, and 650nm) under four different microscopic techniques are demonstrated. Silicon spheres were first prepared, and TEM (transmission electron microscopy) experimental results confirmed the successful preparation of uniform silicon spheres of different sizes. Silicon membrane substrates were then constructed using these four sizes of silicon spheres, and the substrates were characterized by SEM (scanning electron microscopy). The images showed the surface morphology and arrangement of the nanoparticles, and AFM (atomic force microscopy) images revealed the three-dimensional surface morphology of the nanoparticles. The results showed that the surfaces of the different substrates all presented an orderly array of silicon spheres. This result indicates that the present invention has successfully constructed an ordered silicon membrane substrate based on silicon spheres of 250nm, 350nm, 500nm, and 650nm.

[0092] Subsequently, the present invention spotted B-FAM probe DNA double-labeled with amino group (3' end) and fluorescent group (5' end) on four ordered silicon membrane substrates to form a 3×3 spot array. The array was imaged by LSCM (confocal microscopy). The results showed that obvious fluorescent spots appeared at the spot positions of silicon membrane substrates of different sizes. This result shows that Figure 3 The strategy of probe modification on silica membrane substrate is feasible.

[0093] The B-FAM probe is: FAM-SEQ ID NO: 9-NH2

[0094] 5'-CACGCAAACAGATGATGGAT GCTAAATTG TTTTT TTTT-3'(SEQ ID NO:9)

[0095] Comparative Example 1

[0096] The difference from Example 1 is that Comparative Example 1 uses an ordinary glass sheet, does not include steps (1) and (2), and directly performs step (3) in Example 1 on the ordinary glass sheet to obtain a modified glass sheet.

[0097] Comparative Example 2

[0098] The difference from Example 1 is that Comparative Example 2 uses a glass sheet, and performs steps (1), (2), and (3) to obtain an ordered silicon film glass sheet substrate.

[0099] Comparative Example 3

[0100] The difference from Example 1 is that Comparative Example 3 does not include step (1) and step (2), and step (3) is directly performed on an ordinary silicon wafer to obtain a modified silicon wafer.

[0101] like Figure 5As shown, B-FAM probe DNA double-labeled with amino group (3' end) and fluorescent group (5' end) was spotted on the ordered silicon film substrate of Example 1, the ordered silicon film glass substrate of Comparative Example 2, the modified glass slice of Comparative Example 1, and the modified silicon wafer of Comparative Example 3, respectively, to form a 3×3 spot array. The fluorescence signals of the glass slice and the silicon wafer before or after film removal were compared. A confocal microscope was used to collect images, and the results were analyzed by ImageJ software. It was found that the fluorescence brightness on the silicon wafer after film removal was higher, and the fluorescence signal on the silicon wafer after film removal was stronger than that on the glass wafer, confirming that the ordered silicon film array constructed by SiO2 microspheres can improve the detection performance of DNA microarray. By comparing the addition of potassium permanganate solution to the glass slices with and without film removal, and by comparing the addition of potassium permanganate solution to the silicon wafers with and without film removal, it can be seen that more aldehyde groups are modified on the surface after film removal, which can combine with more probes and the silicon wafer has strong hydrophilicity.

[0102] Example 2 Construction of DNA microarray platform

[0103] 2.1 Schematic diagram of DNA microarray detection

[0104] Combine Figure 1 To illustrate, using double-stranded DNA detection as an example, an ISP18-modified forward primer is designed to form a hairpin structure in the nucleic acid chain. Amplification is then performed with the reverse primer under the action of polymerase. ISP18 terminates the amplification, allowing the product to form a single-stranded structure. The DNA microarray substrate uses an ordered silicon membrane array as the substrate. NH2-modified single-stranded substrate probes are immobilized on an aldehyde-modified silicon wafer. The amplified RPA product is then dripped directly onto the DNA microarray for detection. When the target is present, a clear fluorescent signal is observed at the array spot. In the absence of the target, no fluorescent signal is generated.

[0105] 2.2 DNA microarray for multiplex detection

[0106] The nucleic acid sequence of the simulated product used is shown in Table 1, and the nucleic acid sequence of the single-stranded substrate probe is shown in Table 2.

[0107] Table 1

[0108]

[0109]

[0110] Table 2

[0111]

[0112] Combine Figure 6For illustration, (b) is a schematic diagram of the array arrangement, where four probes are spotted on the same chip, with P probes spotted on the left side of the first row, 2-P probes spotted on the right side of the first row, 3-P probes spotted on the left side of the second row, and 4-P probes spotted on the right side of the second row. In (a), when MP was added, only the spots on the left side of the first row showed fluorescent signals. When 2-MP was added, only the spots on the right side of the first row showed fluorescent signals. When 3-MP was added, only the spots on the left side of the second row showed fluorescent signals. When 4-MP was added, only the spots on the right side of the second row showed fluorescent signals. When we added four targets (MP, 2-MP, 3-MP, 4-MP) at the same time, we found that all spots showed obvious fluorescent signals. This proves that the designed microarray chip can quickly detect multiple targets nucleic acids at the same time, and the detection between targets does not affect each other. (c) is the result of the heat map analysis, which proves the multiplicity of DNA microarray detection.

[0113] 2.3 DNA microarray hybridization efficiency assessment

[0114] Combine Figure 7 、 Figure 8 To illustrate, MP and R-FAM were mixed and incubated for approximately 10 minutes, then added dropwise to DNA microarray chips prepared with P probes on ordered silicon membrane silicon wafer substrates (Example 1), ordered silicon membrane glass substrates (Comparative Example 2), and modified glass slides (Comparative Example 1). The hybridization time of the MP and R-FAM mixture on the DNA microarray was varied to investigate hybridization efficiency. Images were acquired using a confocal microscope, and the results were analyzed using ImageJ software. The fluorescence signal reached a plateau on the DNA microarray chip prepared with an ordered silicon membrane silicon wafer substrate constructed with 350nm silicon spheres after 30s, the fluorescence signal reached a plateau on the DNA microarray chip prepared with an ordered silicon membrane glass slide substrate constructed with 350nm silicon spheres after 1min, and the DNA microarray chip prepared with the modified glass slide after 8min, further demonstrating that removing the membrane enhanced DNA hybridization efficiency. This confirms that ordered silicon membrane arrays constructed with SiO2 microspheres can improve DNA microarray detection performance and hybridization efficiency.

[0115] The sequence of R-FAM is shown in FAM-SEQ ID NO: 20 (5' end FAM label),

[0116] CTGCC TGGAG TTGAATTTCTTGAAC TGTTG (SEQ ID NO:20)

[0117] 2.4 DNA microarray for sensitivity detection

[0118] Combine Figure 9To illustrate, experiments were carried out on ordered silicon film silicon wafer substrates constructed with silicon spheres of different sizes, ordered silicon film glass wafer substrates constructed with 350nm silicon spheres, and modified glass wafers. The concentration range of the simulated product (i.e., MP) was selected from 1-200nM. MP was mixed with R-FAM and then reacted on a DNA microarray chip prepared by spotting P probes. After the reaction was completed, images were collected using a confocal microscope and the results were analyzed using ImageJ software. The fluorescence signal increased with the increase in the concentration of the simulated product, and the fluorescence intensity showed a good linear relationship with the concentration of the simulated product. By comparison, it was found that the ordered silicon film silicon wafer substrate constructed based on 350nm silicon spheres had the highest sensitivity, and the detection limit (LOD) of the microarray chip was 1nM.

[0119] 2.5 DNA microarray for specific detection

[0120] Combine Figure 10 To illustrate, the spotted P probe was fixed on an ordered silicon membrane silicon wafer substrate constructed with 350nm silicon spheres to prepare a DNA microarray chip, and R-FAM was mixed with MP, MP-A, MP-C, MP-G, and MP-2AG, respectively, and incubated for about 10 minutes. Subsequently, they were dropped onto the DNA microarray chip to undergo hybridization reactions with different targets (target sequence and single-base mismatch sequence). After the reaction was completed, images were collected using a confocal microscope, and it was found that the fluorescence signal of the target that was completely complementary to the probe sequence was higher than the fluorescence signals of single-base mismatch and multi-base mismatch. This result fully demonstrated that the chip has good specificity.

[0121] 2.6 DNA microarray for detection of HPV18 RPA products

[0122] The sample to be tested is HPV18 plasmid (target sequence is

[0123] TAGTGTGGGCCTGTGCTGGAGTGGAAATTGGCCGTGGTCAGCCTTTAGGTGTTGGCCT TAGTGGGCATCCATTTTATAATAAATTAGATGACACTGAAAGTTCCCATGCCGCC,

[0124] (SEQ ID NO: 24) was synthesized by Beijing Qingke Biotechnology Co., Ltd., and the vector was derived from PUC57. The total reaction system was 25 μL. One RPA freeze-dried pellet was placed in a reaction tube, followed by the addition of 18.5 μL of ultrapure water, 1 μL of HPV18 forward primer, 1 μL of HPV18 reverse primer, 2.5 μL of SYBR dye, and 2 μL of HPV18 plasmid. Finally, Mg was added. 2+ The particles were reacted. A negative control group was set up without HPV18 plasmid and supplemented with 2 μL of water. The RPA program was set at 42°C and 20 cycles.

[0125] The HPV18 forward primer is modified with ISP18 at the 5' end to form a hairpin structure, which is 5'-SEQ ID NO:3 / ISP18 / SEQ ID NO:4-3'; the HPV18 reverse primer is FAM-SEQ ID NO:5 (5' end FAM modified);

[0126] 5'-AAGCC TCTTC TCGT-3'(SEQ ID NO:3)

[0127] 5'-ACGAGAAGAGGCTTTAGTGTGGGC CTGTG CTGGAGGTGGAAATTG-3'

[0128] (SEQ ID NO:4)

[0129] 5'-GGCGG CATGG GAACT TTCAG TGTCATCTAA-3' (SEQ ID NO:5)

[0130] Combine Figure 11 To illustrate, the RPA program is set to 42°C and the reaction is carried out for 20 minutes. The product after the reaction is completed is added to the DNA microarray chip prepared by spotting P probes on an ordered silicon membrane silicon wafer substrate constructed with 350nm silicon spheres. The image is collected using a confocal microscope. The last row is the positive control, and the first two rows are P probes spotted and combined with the product. After adding the amplified product, the reaction is carried out for about 5 minutes, followed by washing with water, and then adding probe binding buffer (1×NEBuffer 3.1 (50mMTris-HCl, 100mMNaCl, 10mMMgCl2, 100μg / mLBSA, pH 7.9), 1×Isothermal amplification (20mM Tris-HCl, 50mM KCl, 10mM (NH4)2SO4, 2mM MgSO4, 0.1% Tween-20, pH8.8)) for observation. Obvious fluorescence signals can be seen, and the results show successful amplification. Binding Figure 12 The results were analyzed by ImageJ software. The results showed that the fluorescence signal of RPA product was the highest when it was incubated on the array at room temperature for 5 minutes. 2 -10 6 Copy number, examine the detection sensitivity, such as Figure 13 As shown, the minimum detection limit is 10 2 copies.

[0131] 2.7 Detection of HPV16 RPA Products by DNA Microarray

[0132] The sample to be tested is HPV16 plasmid (target sequence is

[0133] CCTGACCCCAATAAGTTTGGTTTTCCTGACACCTCATTTTATAATCCAGATACACAGCG GCTGGTTTGGGCCTGTGTAGGTGTTGAGGTAGGTCGTGGTCAGCCATTAGGTG (SEQ ID NO: 25), synthesized by Beijing Qingke Biotechnology Co., Ltd., the vector is derived from PUC57), the total reaction system is 25 μL. One RPA lyophilized pellet was placed in a reaction tube, followed by the addition of 18.5 μL of ultrapure water, 1 μL of HPV16 forward primer, 1 μL of HPV16 reverse primer, 2.5 μL of SYBR dye, and 2 μL of HPV16 plasmid, and finally MgCl2. 2+ The particles were reacted. A negative control group was set up without HPV16 plasmid and supplemented with 2 μL of water. The RPA program was set at 42°C and 20 cycles.

[0134] The HPV16 forward primer is modified with ISP18 at the 5' end to form a hairpin structure, which is 5'-SEQ ID NO:6 / ISP18 / SEQ ID NO:7-3'; the HPV16 reverse primer is FAM-SEQ ID NO:8 (5' end FAM modified);

[0135] 5'-ACTCATGGACTCGA-3'(SEQ ID NO:6)

[0136] 5'-TCGAGTCCATGAGT CCTGACCCCAATAAGTTTGG TTTTC CTGAC-3'(SEQ ID NO:7)

[0137] 5'-CACCTAATGG CTGAC CACGACCTAC CTCAA-3'(SEQ ID NO:8)

[0138] Combine Figure 14To illustrate, the RPA program was set at 42°C for 20 minutes. The reaction product was then added dropwise to a DNA microarray chip prepared by spotting 2-P probes onto an ordered silicon film wafer substrate constructed with 350nm silicon spheres. Images were collected using a confocal microscope. The last row was a positive control, and the first two rows were 2-P probes spotted and bound to the product. After adding the amplified product, the reaction lasted approximately 5 minutes, followed by washing with water, and then adding probe binding buffer for observation. The results showed successful amplification. The sensitivity was then tested and analyzed using ImageJ software. The minimum detection limit was 10 2 copies.

[0139] 2.8 DNA microarray for RPA product detection of HPV18 / 16

[0140] The sample to be tested is HPV18 / 16 plasmid, and the total reaction system is 25 μL. Two RPA freeze-dried particles are placed in different reaction tubes, and then 18.5 μL of ultrapure water, 1 μL of HPV18 forward primer, 1 μL of HPV18 reverse primer, 2.5 μL of SYBR dye and 2 μL of HPV18 plasmid are added, and 18.5 μL of ultrapure water, 1 μL of HPV16 forward primer, 1 μL of HPV16 reverse primer, 2.5 μL of SYBR dye and 2 μL of HPV16 plasmid are added, and finally Mg is added. 2+ The particles were reacted. A negative control group was also set up without HPV18 / 16 plasmids and 2 μL of water was added to each. The RPA program was set at 42°C and 20 cycles.

[0141] Combine Figure 15 For explanation, the RPA program was set at 42°C for 20 minutes of reaction. The reaction product was added dropwise to a DNA microarray chip prepared on an ordered silicon membrane silicon wafer substrate constructed with 350nm silicon spheres and 2-P and P probes spotted respectively. Images were collected using a confocal microscope. The last row was a positive control, and the first two rows were 2-P and P probes spotted and combined with the product. After adding the amplified product, the reaction lasted for about 5 minutes, followed by washing with water, and then adding probe binding buffer for observation. The results showed successful amplification.

[0142] 2.9 Primer amplification optimization experiment

[0143] The sample to be tested is HPV16 plasmid, and the total reaction system is 25 μL. Two RPA freeze-dried particles are placed in different reaction tubes, and then 18.5 μL of ultrapure water, 1 μL of HPV16 (old) forward primer, 1 μL of HPV16 (old) reverse primer, 2.5 μL of SYBR dye and 2 μL of HPV16 plasmid are added; and 18.5 μL of ultrapure water, 1 μL of HPV16 (new) forward primer, 1 μL of HPV16 (new) reverse primer, 2.5 μL of SYBR dye and 2 μL of HPV16 plasmid are added, and finally Mg is added. 2+ The particles were reacted. A negative control group was set up uniformly, without HPV16 plasmid, and 2 μL of water was added to each. The RPA program was set at 42°C and 20 cycles.

[0144] Combine Figure 16 To illustrate, the RPA program was set at 42°C for 20 minutes to react. The product after the reaction was completed was added dropwise to a DNA microarray chip prepared by spotting 2-P probes on an ordered silicon film silicon wafer substrate constructed with 350nm silicon spheres. Images were collected using a confocal microscope. The last row was a positive control, and the first two rows were 2-P probes spotted and combined with the product. After adding the amplified product, the reaction lasted for about 5 minutes, followed by washing with water, and then adding probe binding buffer for observation. The results showed Figure 16 (a) was not successfully amplified. Figure 16 Middle (b) Successful amplification.

[0145] The sequences used are shown in Table 3.

[0146] Table 3

[0147]

[0148] ACTCATGGAC TCGA (SEQ ID NO: 21)

[0149] TCGA GTCCATGAGTACTAC TTGCA GTTGGACATC CCTAT TTTCC(SEQ ID NO:22)TCAGGAAAC CAAAC TTATT GGGGT CAGGT(SEQ ID NO:23)

[0150] In summary, the ordered silicon membrane array constructed by self-assembled SiO2 microspheres in the embodiments of the present invention can improve DNA microarray detection performance and hybridization efficiency. The RPA real-time detection method can shorten reaction time and provide accurate and reliable results. The high throughput, high specificity, and multiplicity of this method are of great significance for disease prevention and early diagnosis.

[0151] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above and that the invention can be embodied in other specific forms without departing from the spirit or essential characteristics of the invention; therefore, the embodiments should be considered in all respects as illustrative and non-restrictive, and the scope of the invention is defined by the appended claims rather than the foregoing description, and all changes that come within the meaning and range of equivalents of the claims are intended to be embraced therein. Any reference sign in a claim should not be construed as limiting the claim to which it relates.

[0152] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Any minor modifications, equivalent replacements, and improvements made to the above embodiments based on the technical essence of the present invention shall be included in the scope of protection of the technical solution of the present invention.

Claims

1. A method for preparing a DNA microarray chip with an ordered nanostructure, characterized in that: The steps include: S1: Preparation of SiO2 microsphere suspension: Anhydrous ethanol, ultrapure water, and ammonia water were mixed to obtain a mixed solution A, and TEOS was then added dropwise to the mixed solution A. The mixture was reacted for 15-16 hours to synthesize SiO2 microspheres of 250-650 nm. After centrifugation, the resulting mixture was dispersed in a methanol solution to prepare a SiO2 microsphere suspension with a concentration of 5 wt%; S2: Film removal: Chloroform is added to the SiO2 microsphere suspension to obtain a mixture B. An appropriate amount of the mixture B is then placed on a water surface. The microspheres spontaneously diffuse on the water surface. When a purple film forms on the water surface, 0.2% SDS surfactant is added dropwise to compress the SiO2 film. The film is then removed with a clean silicon wafer and dried to obtain a silicon wafer after film removal. S3: Silicon wafer modification: The silicon wafer after film removal is subjected to hydroxylation, amination, and formaldehyde modification to obtain a film-modified silicon wafer; S4: Fix the probes on the membrane-modified silicon wafer to form a microarray chip.

2. The method for preparing a DNA microarray chip with ordered nanostructures according to claim 1, characterized in that: In step S1, the volume ratio of anhydrous ethanol, ultrapure water, ammonia water, and TEOS is: (20-90): (1-3): (5-20): (0.5-3.5).

3. The method for preparing a DNA microarray chip with ordered nanostructures according to claim 2, characterized in that: The synthesized SiO2 microspheres are 300-500 nm; preferably, the synthesized SiO2 microspheres are 350 nm.

4. The method for preparing a DNA microarray chip with ordered nanostructures according to claim 1, characterized in that: Step S3 includes: (1) Hydroxylation: Hydroxylate the silicon wafer after film removal in a plasma machine for 5 minutes; (2) Amination: The silicon wafer with hydroxylated surface was assembled in 10mM APTES in anhydrous ethanol solution for 4 hours. The silicon wafer was taken out and rinsed twice with anhydrous ethanol on a shaker and dried with cold air. The obtained silicon wafer was baked at 100-110℃ for 45 minutes to allow APTES to be completely assembled with the silicon wafer. (3) Aldehyde formation: The assembled silicon wafer was immersed in 2.5% glutaraldehyde solution for 4 h, rinsed twice with deionized water on a shaker, and dried with cold air; (4) Package and store in the dark at room temperature for future use.

5. The method for preparing a DNA microarray chip with ordered nanostructures according to claim 1, characterized in that: Step S4 includes: (1) Probe immobilization: The DNA probe was dissolved in spotting buffer and spotted on the membrane-modified silicon wafer using a spotting machine. The spot diameter was 400 μm and the spacing was 1.5 mm. After spotting, the probe was placed in a reaction box and reacted overnight in a constant temperature and humidity chamber at 37°C and 75% relative humidity. The chip was removed from the reaction box the next day. (2) Post-treatment: Wash with ultrapure water three times to remove unfixed DNA probes. Place the cleaned chip in aldehyde blocking solution and block for 20 min to remove unreacted active aldehyde groups on the chip substrate. After the reaction is completed, wash with PBS buffer solution three times and ultrapure water three times, dry with cool air, and store in the dark.

6. The method for preparing a DNA microarray chip with ordered nanostructures according to claim 1, characterized in that: The probe spotting buffer was 3×SSC (450 mM NaCl, 45 mM sodium citrate, pH 7.0) + 2.5 M betaine; And / or, the aldehyde blocking solution is 2.5 mg / mL NaBH4, added with 25% (v / v) ethanol in PBS buffer, pH 7.

4.

7. A DNA microarray chip with ordered nanostructures, characterized in that: The invention is prepared by the preparation method according to any one of claims 1 to 6. Furthermore, the ordered nanostructured DNA microarray is mainly composed of an ordered silicon membrane array formed by self-assembly of SiO2 microspheres. The particle size of the silicon spheres is 250-650nm, forming a single layer of densely arranged ordered nanostructures on the surface of the silicon wafer. The probes are distributed on the aldehyde-modified silicon wafer to form a spot array with a diameter of 400μm and a spacing of 1.5mm.

8. A detection kit for detecting high-risk HPV viruses prepared using the DNA microarray chip with ordered nanostructures according to claim 7.

9. The detection kit according to claim 8, characterized in that The high-risk HPV virus is HPV16 and / or HPV18; the detection kit comprises: (1) The DNA microarray chip described above, wherein the probes of the DNA microarray chip include an HPV16 detection probe and / or an HPV18 detection probe; (2) HPV16 amplification primers and / or HPV18 amplification primers; the HPV16 amplification primers include an HPV16 forward primer and an HPV16 reverse primer; the HPV18 amplification primers include an HPV18 forward primer and an HPV18 reverse primer.

10. The detection kit according to claim 9, characterized in that The sequence of the HPV18 detection probe is shown in SEQ ID NO: 1-NH2; the sequence of the HPV16 detection probe is shown in SEQ ID NO: 2-NH2; The HPV18 forward primer is modified with ISP18 at the 5' end to form a hairpin structure, which is 5'-SEQ ID NO:3 / ISP18 / SEQ ID NO:4-3'; the HPV18 reverse primer is FAM-SEQ ID NO:5; The HPV16 forward primer is modified with ISP18 at the 5' end to form a hairpin structure, which is 5'-SEQ ID NO: 6 / ISP18 / SEQ ID NO: 7-3'; the HPV16 reverse primer is shown as FAM-SEQ ID NO: 8.

Images