Pichia pastoris separated from kefir grains and application thereof
By isolating Pichia Kluvia FMES-LF4 from Kerfir granules, the problem of unclear formation mechanism of Kerfir granules is solved, film-forming applications in dairy products and fermented foods are achieved, and the aggregation and polysaccharide production capacity of yeasts are improved.
Patent Information
- Application Number
- CN202510641284.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-19
- Publication Date
- 2025-08-19
AI Technical Summary
The formation mechanism of kefir particles is unclear and difficult to achieve industrial production, which limits the development of its products, and the aggregation and film-forming capacity of yeasts is not fully utilized.
The Pichia Kluvia strain FMES-LF4 was isolated from the Kefir granules, which had significant self-aggregation, film-forming and polysaccharide production ability, and was co-cultured with Lactococcus lactis to enhance biofilm formation.
It provides a theoretical basis for the research on the formation mechanism of kefir particles, promotes the film formation process in dairy products and fermented foods, and enriches the yeast species resource library.
Smart Images

Figure CN120505213A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to a Pichia yeast and an application thereof, in particular to a Pichia yeast separated from kefir granules and an application thereof in dairy products or fermented foods and in producing biofilms. Background Art
[0002] Kefir grains are a natural fermentation agent widely used in the production of traditional fermented dairy products in regions such as Tibet and Xinjiang. These grains are irregular, milky-white, gel-like, and elastic. Their bacterial flora is primarily composed of lactic acid bacteria, but also includes yeast and acetic acid bacteria, forming a complex multi-species symbiotic system. Their matrix primarily consists of proteins, fats, and metabolites such as exopolysaccharides secreted by microorganisms. These components enable the adhesion of different microorganisms, leading to layered accumulation and ultimately forming a relatively independent microbial ecosystem. Due to the diverse variety of kefir microorganisms and the unique environment in which they naturally form, the mechanisms of their formation remain unclear, and the fermentation process is difficult to precisely control. This makes industrial production of kefir grains difficult, further limiting the development of kefir products.
[0003] Related research indicates that kefir grain formation primarily relies on biofilm construction or the aggregation properties of bacterial strains. Furthermore, studies have shown that yeast isolated from kefir grains can promote the growth of lactic acid bacteria and enhance their ability to form biofilms. This suggests that the aggregation, biofilm-forming, and polysaccharide-producing abilities of kefir yeasts are closely linked to kefir grain formation. Therefore, isolating and characterizing the yeasts in kefir grains is crucial for further understanding the microbial environment and formation mechanisms of kefir. Summary of the Invention
[0004] In view of this, the present invention provides a Pichia kluyveri separated from kefir grains and applications thereof.
[0005] In order to achieve the above object, the present invention adopts the following technical solutions:
[0006] A Pichia kluyveri strain FMES-LF4 was isolated and screened from kefir particles, and the ITS gene sequence is shown in SEQ ID NO.1.
[0007] The strain was deposited in the China Center for Type Culture Collection on January 16, 2025, with the deposit number CCTCCNO: M2025160, and the deposit address is Wuhan University, Wuhan, China.
[0008] On the basis of the above technical solution, the present invention further defines the above strains as follows:
[0009] The strain has self-aggregation ability, and the self-aggregation ability after being cultured at 30°C for 4 hours is 97.19±0.08%.
[0010] The self-film forming ability of the strain after being cultured in YPD broth for 24 hours, 48 hours and 72 hours was 3.28±0.59, 2.65±0.17, 2.12±0.87 (OD 570nm value).
[0011] After co-culture of the strain with Lactococcus lactis FMES-LB15 for 5 days, the film-forming ability was 3.768±0.294 (OD 570nm value).
[0012] The extracellular polysaccharide production of the strain after culturing in YPD broth for 24 hours was 235.52±5.30 mg / L.
[0013] The present invention also provides the use of the Pichia kluyveri FMES-LF4 in producing biofilms, that is, using the Pichia kluyveri FMES-LF4 to generate biofilms.
[0014] The present invention also provides a method for producing a biofilm by co-culturing the Pichia pastoris FMES-LF4 and the Lactococcus lactis strain FMES-LB15, that is, the Pichia pastoris FMES-LF4 and the Lactococcus lactis strain FMES-LB15 are co-cultured in a 1:1 ratio to produce the biofilm.
[0015] The Lactococcus lactis strain FMES-LB15 is the Lactococcus lactis strain defined in Patent No. CN2025102230379.
[0016] The beneficial effects of the present invention are:
[0017] The present invention screened out a Pichia kluyveri (Pichia kluyveri) FMES-LF4 strain from the traditional starter kefir granules. The yeast has good aggregation and polysaccharide production capabilities and can improve the film-forming ability of Lactococcus lactis when co-cultured with Lactococcus lactis, laying a theoretical foundation for further research on the complex bacterial flora environment and granulation mechanism of kefir.
[0018] The Pichia pastoris FMES-LF4 of the present invention can be used in dairy products and fermented foods to promote film formation. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Figure 1 A colony morphology diagram of Pichia kluyveri FMES-LF4 provided by the present invention;
[0020] Figure 2 A microscope image of Pichia kluyveri FMES-LF4 provided by the present invention;
[0021] Figure 3 The self-aggregation ability of Pichia kluyveri FMES-LF4 provided by the present invention;
[0022] Figure 4 The self-film-forming ability of Pichia kluyveri FMES-LF4 provided by the present invention;
[0023] Figure 5 The present invention provides the co-culture film-forming ability of Pichia kluyveri FMES-LF4 and Lactococcus lactis FMES-LB15.
[0024] Figure 6 The present invention provides the polysaccharide production ability of Pichia kluyveri FMES-LF4. DETAILED DESCRIPTION
[0025] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.
[0026] In the following examples, the Pichia kluyveri strain FMES-LF4 was deposited in the China Center for Type Culture Collection on January 16, 2025, with the deposit number being CCTCC NO:
[0027] M2025160, deposited at Wuhan University, Wuhan, China.
[0028] The composition of YPD broth is shown in Table 1.
[0029] Table 1 YPD broth composition
[0030]
[0031]
[0032] Example 1
[0033] Isolation and identification of strains
[0034] The kefir bacteria were isolated from the obtained kefir grains (from Shijiazhuang, Hebei) by the following method:
[0035] Take 0.1g of kefir granules, put them into a 2mL centrifuge tube containing 0.9mL of normal saline and glass beads, put them into a cell disruptor for homogenization, and then perform gradient dilution; take 10 -4 , 10-5 and 10 -6 Spread the mixture of the three dilutions on plates and incubate at 30°C for 24-48 hours. Pick suspected single colonies and culture them separately on YPD agar plates. Repeatedly streak and purify until a single colony with consistent cell morphology is isolated. Visually observe the colony morphology of the isolated strain on YPD agar.
[0036] Results: One target yeast strain was screened out, and the suspected colonies appeared as white colonies with neat edges, flat circles and rough surfaces on YPD agar.
[0037] Pick a single colony of the isolated strain into YPD broth medium, culture at 30℃ for 24 hours, and then extract DNA using:
[0038] Primer ITS1 (TCCGTAGGTGAACCTGCGG)
[0039] and, primer ITS4 (TCCTCCGCTTATTGATATGC)
[0040] PCR amplification was performed, and the amplified product was sent to Qingke Biotechnology Co., Ltd. for ITS sequencing. The sequencing results were compared with the NCBI database, and the strain had a 100% similarity with Pichia kluyveri, indicating that they were of the same genus.
[0041] The gene sequence of ITS sequencing is shown in SEQ ID NO.1:
[0042] ATCGGAGGAAAAGAAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAGAGCTCAGATTTGAAATCTCACCTAGTGTGCGAGTTGTAAATTGCAGGTTGGAGTCTCGGGTTAGACGTGTGTGCAAGTCCCTTGGAACAG GGTGCCACTGAGGGTGAGAGCCCCGTATCGTGCATGTCGACACCTGTGAGGCCCTTCTGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATTGGCGAGAGACCGATAGCGAACAA GTACTGTGAAGGAAAGATGAAAAGCACTTTGAAAAGAGAGTGAAACAGCACGTGAAATTGTTGAAAGGGAAGGGTATTGGGCTCGACATGGGATTTACGCATCGTTGCCTCTCGTGGGCGGCGCTCTGGGTTTTTCCTGGGCCAGCA TCGGTTTTCGTTGCAGGATAAGGACAATTGGAATGTGGCTCCTCGGAGTGTTATAGCCTTTTGTAGATGCTGCGTATGGGGACCGAGGGCTGCGGCGGACTCGTTTCGTCTCGGATGCTGGCACAACGGCGCAATACCGCCCGCTGA
[0043] Example 2
[0044] Determination of the activation and self-aggregation ability of strains
[0045] After the strain FMES-LF4 was activated for three generations, it was inoculated into YPD broth at an inoculation rate of 2% and cultured in a 30°C constant temperature incubator. 7 cfu / mL, centrifuge at 10000×g, 4℃ for 10min. Remove the supernatant, wash and resuspend the bacterial slurry with PBS, and resuspend to the bacterial solution OD 600nm =1.00±0.02. Place the bacterial solution in a 30℃ constant temperature incubator for 4 hours, and take the top supernatant to measure OD 600nm . Self-aggregation (%) = (OD 0h -OD 4h ) / OD 0h ×100.
[0046] The results are as follows Figure 3As shown, at 30°C, the self-aggregation ability of strain FMES-LF4 was 97.19±0.08% after culturing for 4 h.
[0047] Example 3
[0048] Determination of the self-film-forming ability of strains
[0049] The strain FMES-LF4 was activated to 10 7 cfu / mL, inoculated into new YPD broth culture medium at an inoculation rate of 2%, placed in a constant temperature incubator at 30℃ for 24, 48, and 72 hours, and the amount of biofilm was determined using crystal violet staining. The specific steps are as follows: After the biofilm is formed, discard the bacterial solution and wash twice with sterile water to remove planktonic bacteria. Add methanol to fix for 10 minutes, and then discard the liquid in each well. Add 200μL of 1% crystal violet solution to each well for staining, pour out the stain after 10 minutes and rinse clean. Finally, add 200μL of 33% glacial acetic acid solution and culture at a constant temperature of 30℃ for 30 minutes. Finally, measure the OD of the solution in the culture well. 570nm value.
[0050] The results are as follows Figure 4 As shown, under 30°C conditions, the self-film-forming abilities of strain FMES-LF4 after culturing for 24, 48, and 72 h were 3.28±0.59, 2.65±0.17, and 2.12±0.87, respectively.
[0051] Example 4
[0052] Determination of co-film-forming ability of strains
[0053] The strain FMES-LF4 was activated to 10 7 cfu / mL, and the strain FMES-LB15 was activated to 10 8 cfu / mL, inoculated with new YPD and MRS broth media at a 2% inoculation rate, cultured in a 30°C constant temperature incubator for 5 days, and the amount of biofilm was determined using crystal violet staining. The specific steps were the same as in Example 3.
[0054] The results are as follows Figure 5 As shown in the figure, at 30°C, after co-culture of strain FMES-LF4 with Lactococcus lactis FMES-LB15 for 5 days, the biofilm formation ability of FMES-LB15 was significantly enhanced to 3.768±0.294 (OD 570nm value)
[0055] Example 5
[0056] Determination of the ability of strains to produce extracellular polysaccharides
[0057] The strain FMES-LF4 was activated to 10 7cfu / mL, inoculate new YPD broth culture medium at an inoculation rate of 2%, and place it in a constant temperature incubator at 30℃ for 24h. Take the culture medium and centrifuge it at 8000rpm and 4℃ for 10min to remove the bacteria. Add 30% trichloroacetic acid to the supernatant to a final concentration of 40g / L, stir it thoroughly and let it stand at 4℃ overnight, then centrifuge it at 10000rpm and 4℃ for 10min to remove the protein and collect the supernatant. Add three times the volume of pre-cooled 95% ethanol to the supernatant, mix it thoroughly and let it stand at 4℃ overnight to precipitate the extracellular polysaccharides. Centrifuge it at 10000rpm and 4℃ for 10min and remove the supernatant. Dissolve the precipitate with distilled water to obtain an extracellular polysaccharide aqueous solution. The aqueous solution is placed in a dialysis bag with a molecular weight cutoff of 8000-14000Da, change the water every 12h, and dialyze for 48h. OD is determined using the phenol-sulfuric acid method and glucose standard solution. 490nm The absorbance at 400 nm was used to calculate the extracellular polysaccharide production of the strain.
[0058] The results are as follows Figure 6 As shown, the extracellular polysaccharide production of strain FMES-LF4 was 235.52±5.30 mg / L when cultured at 30°C for 24 h.
Claims
1. A Pichia yeast isolated from kefir grains, characterized in that The strain was isolated and screened from kefir granules and named FMES-LF4. The ITS gene sequence is shown in SEQ ID NO.
1.
2. The Pichia kluyveri isolated from kefir grains according to claim 1, wherein The strain was deposited in the China Center for Type Culture Collection on January 16, 2025, with the deposit number CCTCC NO: M2025160, and the deposit address is Wuhan University, Wuhan, China.
3. Use of Pichia yeast isolated from kefir grains in dairy products or fermented foods.
4. Use of Pichia yeast isolated from kefir grains in producing biofilm.
5. The use according to claim 4, characterized in that Biofilms were generated using Pichia kluyveri FMES-LF4.
6. The use according to claim 5, characterized in that The biofilm was produced by co-culturing Pichia pastoris FMES-LF4 and Lactococcus lactis strain FMES-LB15 to enhance the biofilm formation ability.