Composition for leaching lithium, nickel or cobalt using chlorella vulgaris strain, and method for leaching lithium, nickel or cobalt

Abstract

The present invention relates to a composition for leaching lithium, nickel, or cobalt using a Chlorella vulgaris strain, and to a method for leaching lithium, nickel, or cobalt.

Description

Technical Field

[0001] This patent application claims priority from Korean Patent Application No. 10-2023-0009737 filed on January 25, 2023, in the Korean Intellectual Property Office, the disclosure of which is incorporated herein by reference.

[0002] The present invention relates to a composition for leaching lithium, nickel or cobalt using a Chlorella vulgaris strain and a method for leaching lithium, nickel or cobalt. Background Art

[0003] Chlorella vulgaris is a single-celled microalgae belonging to the Chlorophyta phylum. Chlorella vulgaris possesses photosynthetic machinery, allowing it to grow rapidly using only light, carbon dioxide, water, and a small amount of minerals. Therefore, it is widely used in research for the large-scale production of useful substances (photobioreactors).

[0004] In addition, its lipid content per unit biomass is high, about 42%, so it is also widely used in the development of biofuels that can be used as a biodiesel substitute. Recently, a study published that the use of common Chlorella can remove radioactive isotopes 90 Sr (strontium-90).

[0005] Electroporation using hygromycin B resistance gene, zeocin resistance gene, chloramphenicol acetyltransferase gene (CAT gene) as selection markers, although integration into chromosomal DNA occurs, only temporarily produces transformants, which soon lose resistance.

[0006] Transformation methods include glass beads, electroporation, and Agrobacterium-mediated transformation. However, the current situation limits the use of Chlorella vulgaris due to the lack of efficient selectable markers and transformation systems.

[0007] With technological advancements, electricity usage is surging, leading to improvements in energy consumption and production efficiency. To address this surge in electricity usage and the corresponding efficiency gains, global interest in utilizing nuclear power plants for electricity generation is growing. However, alongside these challenges, the ongoing risks of nuclear power plant accidents and contamination of water with radioactive and metallic ions remain.

[0008] Furthermore, the country faces the issue of import dependence for rare metals such as Sr, Cs, Li, Ni, and Co used in industrial sites. This issue is becoming increasingly prominent as the secondary battery market expands, and recycling-related issues are gradually emerging as major industrial and national issues.

[0009] To recover metals from raw ores or secondary resources (such as spent catalysts or scrap electronics), hydrometallurgy or pyrometallurgy are primarily used. However, hydrometallurgy, which involves acid and alkaline leaching, causes severe environmental pollution due to the use of strong acid and alkaline solvents. Pyrometallurgy, on the other hand, produces large amounts of sulfide gases, leading to numerous operational challenges. Consequently, interest in bioleaching, a more environmentally friendly leaching method, is growing.

[0010] Bioleaching is a hydrometallurgical process that utilizes metal-leaching microbes to recover valuable metals. However, while widely considered environmentally friendly, bioleaching suffers from low metal leaching efficiency. Therefore, developing a bioleaching technology with high leaching efficiency and environmental friendliness has become a pressing need. Summary of the Invention

[0011] Technical issues

[0012] Therefore, the present inventors have confirmed that lithium, nickel or cobalt can be leached from materials containing lithium, nickel or cobalt with excellent efficiency using the Chlorella vulgaris strain. In particular, they have confirmed that the Chlorella vulgaris strain transformed with the carrier of the present invention exhibits even better lithium, nickel or cobalt leaching efficiency, thereby completing the present invention.

[0013] The present inventors predicted and obtained the sequences of the promoter and terminator regions of the green alga Coccomyxa C-169 (formerly known as Chlorella vulgaris and later renamed) and synthesized them by fusion with the Sh ble gene. The synthesized DNA fragment, without any introns inserted into the middle of the Streptomyces verticillus bleomycin (Sh ble) gene, was treated with SwaI / KpnI restriction enzymes and cloned into the pSP124S vector, which was named pKA650.

[0014] Furthermore, the target gene, β-carbonic anhydrase, was cloned in the middle of the Sh ble gene of Streptomyces verticillium in the pKa650 vector, and the resulting vector was named pJG002.

[0015] Then, after transformation by gold particle bombardment, the cells were cultured in a medium containing Zeocin and selectively screened, and colonies were obtained from the selected culture to produce transformants.

[0016] Furthermore, it was confirmed that lithium, nickel, or cobalt can be leached from a substance containing lithium, nickel, or cobalt with excellent efficiency using Chlorella vulgaris or a transformant thereof.

[0017] Therefore, an object of the present invention is to provide a composition for leaching lithium, nickel or cobalt, comprising at least one selected from the group consisting of a Chlorella vulgaris strain, a culture of the strain, a concentrate of the culture and a dried product of the culture.

[0018] Another object of the present invention is to provide a method for leaching lithium, nickel, or cobalt by bioleaching, comprising: a mixing step of mixing one or more selected from the group consisting of a Chlorella vulgaris strain, a culture of the strain, a concentrate of the culture, and a dried product of the culture with a substance containing lithium, nickel, or cobalt; and a leaching step of leaching the lithium, nickel, or cobalt for a predetermined time.

[0019] Another object of the present invention is to provide a use of a Chlorella vulgaris strain in leaching lithium, nickel or cobalt.

[0020] Technical issues

[0021] The present invention relates to a composition for leaching lithium, nickel or cobalt using a Chlorella vulgaris strain and a method for leaching lithium, nickel or cobalt.

[0022] The present invention will be described in more detail below.

[0023] One aspect of the present invention relates to a composition for leaching lithium, nickel, or cobalt, comprising at least one selected from the group consisting of a Chlorella vulgaris strain, a culture of the strain, a concentrate of the culture, and a dried product of the culture.

[0024] In the present invention, the Chlorella vulgaris strain can crystallize lithium, nickel, or cobalt from a substance including lithium, nickel, or cobalt through biomineralization, thereby leaching lithium, nickel, or cobalt.

[0025] The term "leaching" in this specification refers to the separation of the target component and can be used interchangeably with "separation", "extraction" or "dissolution".

[0026] The term "leaching composition" in this specification refers to a composition for the purpose of separating a target component, and can be used interchangeably with "biomineralization composition" or "bioleaching composition".

[0027] In the present invention, the strain can be transformed with a vector comprising:

[0028] Promoter of the ribulose-1,5-bisphosphate carboxylase / oxygenase (RuBisCo) small subunit 2 (rbcS2) gene from Coccomyxa C-169;

[0029] a nucleotide sequence encoding β-type carbonic anhydrase from Coccomyxa subellipsoidea C-169; and

[0030] The terminator sequence of the rbcS2 gene from green algae C-169.

[0031] In the present invention, the promoter may include the base sequence of sequence number 2, or may include a base sequence that has substantial identity with the base sequence of sequence number 2, for example, may be composed of the base sequence of sequence number 2, but is not limited thereto.

[0032] In one example of the present invention, the promoter including the base sequence of SEQ ID NO: 2 may be a sequence further including 1 to 50 bp of bases at the 3' end of the sequence of SEQ ID NO: 2 included in SEQ ID NO: 1, but is not limited thereto.

[0033] In the present invention, the terminator sequence may include the base sequence of sequence number 3, or may include a base sequence that has substantial identity with the base sequence of sequence number 3, for example, may be composed of the base sequence of sequence number 3, but is not limited thereto.

[0034] In the present invention, the target protein encoding nucleotide sequence may be operatively linked to a promoter.

[0035] In the present invention, the term "operatively linked" refers to the functional binding between a nucleic acid expression regulatory sequence (e.g., a promoter sequence, a signal sequence, or an array of transcriptional regulatory factor binding sites) and other nucleic acid sequences, whereby the regulatory sequence can regulate the transcription and / or translation of the other nucleic acid sequences.

[0036] In the present invention, the target protein encoding nucleotide sequence may be connected to the 3' end of the terminator sequence, but is not limited thereto.

[0037] In the present invention, the vector may further include a selection marker.

[0038] In the present invention, the selection marker may be an antibiotic resistance gene, but is not limited thereto.

[0039] In the present invention, the antibiotic may be one or more selected from the group consisting of spectinomycin, paromomycin, ampicillin, Zeocin and bleomycin, but is not limited thereto.

[0040] In the present invention, the selection marker can be selected from various selection marker genes for existing antibiotics to be used, for example, aminoglycoside phosphotransferase that confers resistance to kanamycin antibiotics, chloramphenicol acetyltransferase that contributes to resistance to chloramphenicol antibiotics, and the like.

[0041] In the present invention, when the selection marker is bleomycin, the selection marker may include the base sequence of sequence number 4, or may include a base sequence that is substantially identical to the base sequence of sequence number 4, for example, it may be composed of the base sequence of sequence number 4, but is not limited thereto.

[0042] In the present invention, the method for screening transformed Chlorella vulgaris into which a selectable marker has been introduced can be easily performed according to methods known in the art, utilizing the phenotype expressed by the selectable marker. For example, when the selectable marker is a gene resistant to a specific antibiotic, transformants can be easily screened by culturing the transformants in a culture medium containing the antibiotic.

[0043] In the present invention, the vector may further include a gene encoding a reporter molecule.

[0044] In the present invention, the reporter molecule may be one or more selected from the group consisting of growth-promoting proteins, fluorescent proteins, and hydrolases, but is not limited thereto.

[0045] In the present invention, the fluorescent protein may be luciferase, but is not limited thereto.

[0046] In the present invention, the hydrolase may be β-glucuronidase, but is not limited thereto.

[0047] In the present invention, the vector may include the base sequence of sequence number 1, or may include a base sequence that has substantial identity with the base sequence of sequence number 1, for example, may be composed of the base sequence of sequence number 1, but is not limited thereto.

[0048] In the present invention, the vector can be used to transform Chlorella vulgaris using gold particles bombardment.

[0049] In the present invention, "vector" refers to a means for expressing a target gene in a host cell, and includes, for example, viral vectors such as plasmid vectors, cosmid vectors, phage vectors, adenoviral vectors, retroviral vectors, and adeno-associated viral vectors.

[0050] In the present invention, the vector that can be used as a recombinant vector can be prepared by modifying a plasmid commonly used in the art (for example, pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8 / 9, pUC6, pBD9, pHC79, pIJ61, pLAFR1, pHV14, pGEX series, pET series and pUC19, etc.), a phage (for example, λgt4λB, λ-Charon, λΔz1 and M13, etc.) or a virus (for example, SV40, etc.), for example, it can be a pSP124S vector backbone, but is not limited thereto.

[0051] In the present invention, the vector can generally be constructed as a vector for cloning or a vector for expression.

[0052] In the present invention, the vector used for expression can be any conventional vector used in the art for expressing target proteins in plants, animals or microorganisms.

[0053] In the present invention, the vector can be constructed by various methods well known in the art.

[0054] In the present invention, the term "substantial identity" means that each base sequence is aligned with any other base sequence in a manner that corresponds to the maximum extent possible, and upon sequence analysis, any other base sequence has a sequence homology of more than 70%, more than 90% or more than 98% with each base sequence.

[0055] Another aspect of the present invention relates to a method for leaching lithium, nickel, or cobalt by bioleaching, comprising: a mixing step of mixing one or more selected from the group consisting of a Chlorella vulgaris strain, a culture of the strain, a concentrate of the culture, and a dried product of the culture with a substance containing lithium, nickel, or cobalt; and a leaching step of leaching the lithium, nickel, or cobalt for a predetermined time.

[0056] In the present invention, the lithium, nickel or cobalt leaching method includes the following conversion step before the mixing step, and the Chlorella vulgaris strain of the mixing step may be a converted Chlorella vulgaris strain:

[0057] The transformation step involves introducing a vector comprising the promoter of the green algae (Coccomyxa) C-169 ribulose-1,5-bisphosphate carboxylase / oxygenase (RuBisCo) small subunit 2 (rbcS2) gene, a target protein encoding nucleotide sequence, and a terminator sequence of the green algae C-169 rbcS2 gene into Chlorella vulgaris.

[0058] In the present invention, the promoter may include the base sequence of sequence number 2, or may include a base sequence that has substantial identity with the base sequence of sequence number 2, for example, may be composed of the base sequence of sequence number 2, but is not limited thereto.

[0059] In one example of the present invention, the promoter including the base sequence of SEQ ID NO: 2 may be a sequence further including 1 to 50 bp of bases at the 3' end of the sequence of SEQ ID NO: 2 included in SEQ ID NO: 1, but is not limited thereto.

[0060] In one example of the present invention, the promoter including the base sequence of SEQ ID NO: 2 may be a sequence further including 1 to 50 bp of bases at the 3' end of the sequence of SEQ ID NO: 2 included in SEQ ID NO: 7, but is not limited thereto.

[0061] In the present invention, the terminator sequence may include the base sequence of sequence number 3, or may include a base sequence that has substantial identity with the base sequence of sequence number 3, for example, may be composed of the base sequence of sequence number 3, but is not limited thereto.

[0062] In the present invention, the target protein encoding nucleotide sequence may be operably linked to a promoter.

[0063] In the present invention, the target protein encoding nucleotide sequence may be connected to the 3' end of the terminator sequence, but is not limited thereto.

[0064] In the present invention, the vector may further include a selection marker.

[0065] In the present invention, the selection marker may be an antibiotic resistance gene, but is not limited thereto.

[0066] In the present invention, the antibiotic may be one or more selected from the group consisting of spectinomycin, paromomycin, ampicillin, Zeocin and bleomycin, but is not limited thereto.

[0067] In the present invention, the selection marker can be selected from a variety of selection marker genes for existing antibiotics to be used, for example, aminoglycoside phosphotransferase that confers resistance to kanamycin antibiotics, chloramphenicol acetyltransferase involved in chloramphenicol antibiotic resistance, and the like.

[0068] In the present invention, when the selection marker is bleomycin, the selection marker may include the base sequence of sequence number 4, or may include a base sequence that is substantially identical to the base sequence of sequence number 4, for example, it may be composed of the base sequence of sequence number 4, but is not limited thereto.

[0069] In the present invention, the method for screening transformed Chlorella vulgaris into which a selectable marker has been introduced can be easily performed according to methods known in the art, utilizing the phenotype expressed by the selectable marker. For example, when the selectable marker is a gene resistant to a specific antibiotic, transformants can be easily screened by culturing the transformants in a culture medium containing the antibiotic.

[0070] In the present invention, the vector may further include a gene encoding a reporter molecule.

[0071] In the present invention, the reporter molecule may be one or more selected from the group consisting of growth-promoting proteins, fluorescent proteins, and hydrolases, but is not limited thereto.

[0072] In the present invention, the fluorescent protein may be luciferase, but is not limited thereto.

[0073] In the present invention, the hydrolase may be β-glucuronidase, but is not limited thereto.

[0074] In the present invention, the vector may include the base sequence of sequence number 1, or may include a base sequence that has substantial identity with the base sequence of sequence number 1, for example, may be composed of the base sequence of sequence number 1, but is not limited thereto.

[0075] In the present invention, the vector may include the base sequence of sequence number 7, or may include a base sequence that has substantial identity with the base sequence of sequence number 7, for example, may be composed of the base sequence of sequence number 7, but is not limited thereto.

[0076] In the present invention, the vector can be used to transform Chlorella vulgaris using gold particles bombardment.

[0077] In the present invention, the vector that can be used as a recombinant vector can be prepared by modifying a plasmid commonly used in the art (for example, pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, p UC8 / 9, pUC6, pBD9, pHC79, pIJ61, pLAFR1, pHV14, pGEX series, pET series and pUC19, etc.), a bacteriophage (for example, λgt4λB, λ-Charon, λΔz1 and M13, etc.) or a virus (for example, SV40, etc.), for example, it can be a pSP124S vector backbone, but is not limited thereto.

[0078] In the present invention, the vector can generally be constructed as a vector for cloning or a vector for expression.

[0079] In the present invention, the vector used for expression can be any conventional vector used in the art for expressing target proteins in plants, animals or microorganisms.

[0080] In the present invention, the vector can be constructed by various methods well known in the art.

[0081] In the present invention, the conversion step can be performed using gold particles bombardment.

[0082] In the present invention, the cell phase in the transformation step may be the logarithmic phase, as the efficiency is highest when the cell phase is the logarithmic phase.

[0083] In the present invention, the OD686 value in the logarithmic phase may be 0.4 to 0.6, 0.45 to 0.6, 0.5 to 0.6, or 0.55 to 0.6, for example, 0.6.

[0084] In the present invention, the cell density in the transformation step can be 5.0*10 6 Up to 8.0*10 7 / 60mm diameter, 1.0*10 7 Up to 8.0*10 7 / 60mm diameter, 2.0*10 7 Up to 8.0*107 / 60mm diameter, 3.0*10 7 Up to 8.0*10 7 / 60mm diameter, 4.0*10 7 Up to 8.0*10 7 / 60mm diameter, 1.0*10 7 to 7.0*10 7 / 60mm diameter, 2.0*10 7 to 7.0*10 7 / 60mm diameter, 3.0*10 7 to 7.0*10 7 / 60mm diameter, 4.0*10 7 to 7.0*10 7 / 60mm diameter, 1.0*10 7 Up to 6.0*10 7 / 60mm diameter, 2.0*10 7 Up to 6.0*10 7 / 60mm diameter, 3.0*10 7 Up to 6.0*10 7 / 60mm diameter, 4.0*10 7 Up to 6.0*10 7 / 60mm diameter, 1.0*10 7 Up to 5.0*10 7 / 60mm diameter, 2.0*10 7 Up to 5.0*10 7 / 60mm diameter, 3.0*10 7 Up to 5.0*10 7 / 60mm diameter, 4.0*10 7 Up to 5.0*10 7 / 60mm diameter, for example, it can be 4.8*10 7 / 60mm diameter.

[0085] In the present invention, the vacuum degree of the conversion step can be 27.0 to 29.0 inches of mercury (inchs Hg), 27.5 to 29.0 inches of mercury, 28.0 to 29.0 inches of mercury, 28.5 to 29.0 inches of mercury, for example, 29.0 inches of mercury.

[0086] In the present invention, the target distance of the conversion step may be 3 to 9, for example, 3, 6 or 9.

[0087] In the present invention, the pressure of the conversion step can be 1200 to 1300 psi, 1210 to 1300 psi, 1220 to 1300 psi, 1230 to 1300 psi, 1240 to 1300 psi, 1250 to 1300 psi, 1260 to 1300 psi, 1270 to 1300 psi, 1280 to 1300 psi, 1290 to 1300 psi, for example, 1300 psi.

[0088] In the present invention, the substance including lithium, nickel or cobalt can be one or more selected from the group consisting of LiCl solution, Li2SO4 solution, lithium-containing battery, NiCl2 solution, NiSO4 solution, nickel-containing battery, CoCl2 solution, CoSO4 solution, cobalt-containing battery, waste battery, wastewater and salt marsh, but is not limited thereto.

[0089] Effects of the Invention

[0090] The present invention relates to a composition for leaching lithium, nickel or cobalt using a Chlorella vulgaris strain and a method for leaching lithium, nickel or cobalt. BRIEF DESCRIPTION OF THE DRAWINGS

[0091] Figure 1 FIG. 1 is a map of the pKA650 vector according to an embodiment of the present invention.

[0092] Figure 2 The photographs show the results of confirming that the conversion efficiency is low and the conversion effect is not good when using the glass bead method according to one embodiment of the present invention.

[0093] Figure 3 The photographs show the results of obtaining a mutant having antibiotic resistance by introducing a resistance gene using a vector system and transforming the mutant according to one embodiment of the present invention.

[0094] Figure 4 1 is a photograph showing the results of confirming the genetic information of the acquired mutant according to one embodiment of the present invention.

[0095] Figure 5 These are photographs showing the results of subculture to confirm the maintenance of mutants according to one example of the present invention.

[0096] Figure 6 FIG. 1 is a vector map of pJG002 according to an embodiment of the present invention.

[0097] Figure 7 This is the result of transformation according to one embodiment of the present invention using the same bioballistic method as in Example 2, and confirming the maintenance of antibiotic resistance based on concentration after subculture.

[0098] Figure 8 This is a photograph showing the results of confirming the band size of approximately 43 kDa of the target protein, beta-type carbonic anhydrase, by whole protein SDS-PAGE in order to confirm gene and protein expression in transformants according to one embodiment of the present invention.

[0099] Figure 9 This is the result of performing MALDI-TOF (matrix-assisted laser desorption ionization time-of-flight mass spectrometry) to confirm the bands of the target protein according to one embodiment of the present invention.

[0100] Figure 10 This is a photograph showing the results of Southern blot hybridization for confirming the presence of a target gene according to one embodiment of the present invention.

[0101] Figure 11 These are photographs showing the results of a comparison of Sr biomineralization between the wild type and the transformant according to one embodiment of the present invention.

[0102] Figure 12 The figure shows the analysis results obtained by inductively coupled plasma mass spectrometry (ICP-MS) in order to quantitatively compare the strontium (Sr) biomineralization between the wild type and the transformant according to one embodiment of the present invention.

[0103] Figure 13 and Figure 14 FIG. 1 is a graph showing the results of confirming the removal rate at a single lithium chloride (LiCl) concentration according to an embodiment of the present invention.

[0104] Figure 15 and Figure 16 The figure is a graph showing the effect of sodium and sulfate (at concentrations of 300, 600, and 900 mM) according to an embodiment of the present invention.

[0105] Figure 17 This is a chart showing the composition of a lithium battery solution according to one embodiment of the present invention.

[0106] Figure 18 This is a graph showing the crystallization results of lithium (Li) in a lithium battery solution according to one embodiment of the present invention.

[0107] Figure 19 and Figure 20 This is a graph showing the results of crystallization of sodium (Na) and sulfur (S) (300, 600, and 900 mM, respectively) in a lithium battery solution according to one embodiment of the present invention.

[0108] Figure 21 and Figure 22 FIG. 1 is a graph showing the results of confirming the removal rate at a single NiCl 2 concentration according to an embodiment of the present invention.

[0109] Figure 23 and Figure 24 The figure is a graph showing the effect of sodium and sulfate (at concentrations of 300, 600, and 900 mM) according to an embodiment of the present invention.

[0110] Figure 25 This is a graph showing the composition of a nickel battery solution according to one embodiment of the present invention.

[0111] Figure 26 This is a graph showing the results of Ni crystallization in a nickel battery solution according to one embodiment of the present invention.

[0112] Figure 27 and Figure 28 This is a graph showing the results corresponding to the crystallization of sodium (Na) and sulfur (S) (300, 600, and 900 mM, respectively) in a nickel battery solution according to one embodiment of the present invention.

[0113] Figure 29 and Figure 30 FIG. 1 is a graph showing the results of confirming the removal efficiency at a single CoCl 2 concentration according to an embodiment of the present invention.

[0114] Figure 31 and Figure 32 The figure is a graph showing the effect of sodium and sulfate (at concentrations of 300, 600, and 900 mM) according to an embodiment of the present invention.

[0115] Figure 33 This is a graph showing the composition of a cobalt battery solution according to one embodiment of the present invention.

[0116] Figure 34 This is a graph showing the results of cobalt (Co) crystallization in a cobalt battery solution according to one embodiment of the present invention.

[0117] Figure 35 and Figure 36 This is a graph showing the results corresponding to the crystallization of sodium (Na) and sulfur (S) (300, 600, and 900 mM, respectively) in a cobalt battery solution according to one embodiment of the present invention. DETAILED DESCRIPTION

[0118] A composition for leaching lithium, nickel or cobalt comprises at least one selected from the group consisting of a Chlorella vulgaris strain, a culture of the strain, a concentrate of the culture and a dried product of the culture.

[0119] Implementation Method

[0120] The present invention will be described in more detail below by the following examples. However, these examples are only used to illustrate the present invention, and the scope of the present invention is not limited by these examples.

[0121] Preparation Example 1. Plasmid construction and cloning

[0122] The sequence of the bleomycin resistance gene (Sh ble) was obtained from the genomic DNA of Streptomyces verticillus. The full sequence Sh-ble (GenScript, USA) was synthesized by joining the promoter sequence of the Coccomyxa-169rbcS2 gene to the 5' portion of the bleomycin resistance gene and joining the terminator sequence of the Coccomyxa C-169rbcS2 gene to the 3' portion. The synthesized gene was restricted with SwaI and KpnI and inserted into the pSP124S vector. The resulting plasmid was named pKA650, and the vector map is shown in FIG. Figure 1 shown.

[0123] As Figure 1 It was confirmed that OriV in the vector map is the replication origin, Shble is the Shble gene combined with the promoter and terminator of Streptomyces verticillus bleomycin, AmpR is the ampicillin-resistance gene, C-169-ble is the promoter sequence of the Coccomyxa C-169rbcS2 gene, and the 3' portion is the terminator portion of the Coccomyxa C-169rbcS2 gene.

[0124] Production Example 2. Conversion to Chlorella vulgaris

[0125] 2-1. Transformation using the glass bead method

[0126] A simple and rapid glass bead transformation method using glass beads was used. This method involves adding glass beads and applying physical force, which creates pores in the cell membrane through physical friction with the cells, allowing the desired plasmid to be introduced.

[0127] The experiment was conducted under the conditions described in Table 1. Specifically, at room temperature (25°C), the cells were vortexed with glass beads to break some of the cells. Then, the glass beads and the supernatant were separated by gravity, and DNA was added to the supernatant. Then, it was slowly rotated at 37°C to recover. After it was divided onto a solid culture medium containing antibiotics, the transformant was confirmed. The results are shown below. Figure 2 shown.

[0128] [Table 1]

[0129]

[0130]

[0131] As Figure 2 It can be confirmed that the efficiency is low and the conversion effect is poor.

[0132] 2-2. Transformation using the gene gun method

[0133] Transformation was performed using gold particle bombardment, a method used with a gene gun, a plant transformation method. This technique is also known as microparticle acceleration or bioballistics, but the official name for the device called a gene gun is microparticle bombardment. It involves transforming cells using microparticles that encapsulate plasmids. Because the microparticles are very heavy for their size, they penetrate cells well. The microparticles are fired at high speed toward the cells while being wrapped in a steel mesh to allow more of them to reach the cells. Once the microparticles enter the cells, the DNA coated on them is released and can enter the plant's genome. Transformation was performed using gold microparticles.

[0134] Specifically, to achieve transformation using gold particle bombardment, experiments were conducted by varying various conditions, as shown in Table 2. First, the vacuum level and helium pressure were fixed, and experiments were conducted taking into account the cell stage and concentration, the gold particle ejection range, the target distance, and the experimental environment of the cells.

[0135] During the process of establishing the conditions, we considered the range and pressure of the gold particle spray from the gene gun. We conducted experiments at 47mm, 50mm, and 60mm. We also experimented with varying target distances, with target distance 3 being the optimal distance. Furthermore, since the microalgae membrane thickens with further advancement in the cell stage, making experiments more difficult, we conducted experiments based on changes in OD values ​​from the initial stage. Furthermore, we also adjusted the cell density based on diameter.

[0136] [Table 2]

[0137]

[0138]

[0139]

[0140]

[0141] As shown in Table 2 and Figure 3 It was confirmed that when the experiment failed, the strain failed to grow on a solid medium containing antibiotics, while when the experiment succeeded, colonies formed. The promoter function (i.e., the mutant) was confirmed only under the conditions of 160704. Subsequently, the target protein (carbonic anhydrase) was introduced under the same conditions to generate a mutant.

[0142] Experimental Example 1. Confirmation of genetic information

[0143] To confirm its genetic information, genomic DNA was obtained, and the introduced gene was confirmed by PCR and DNA sequencing. Specifically, for PCR to confirm the gene, the primer set shown in Table 3 below was prepared. PCR was performed using the primers as follows: pre-denaturation at 98°C for 8 minutes, followed by 30 cycles of 98°C for 1 minute, 53.5°C for 30 seconds, and 72°C for 1 minute, and PCR at 72°C for 7 minutes. The results were confirmed by sequencing analysis. The results are shown in Table 1.

[0144] In addition, to confirm the full sequence Sh-ble obtained by ligating the promoter sequence of the Coccomyxa C-169rbcS2 gene to the 5' portion of the bleomycin-resistant gene targeted by the present inventors and the terminator sequence of the Coccomyxa C-169rbcS2 gene to the 3' portion, PCR was performed using the M13 primer set. After pre-denaturation at 98°C for 8 minutes, 30 cycles of 98°C for 1 minute, 54°C for 40 seconds, and 72°C for 2 minutes and 30 seconds were performed, followed by PCR at 72°C for 7 minutes. The target DNA band was confirmed by PCR, and the results are shown as follows. Figure 4 shown.

[0145] [Table 3]

[0146] Serial number name Sequence list (5'->3') Remark 5 Forward primer ATGGCCAAGTTGACCAGT 6 Reverse primer TCAGTCCTGCTCCTCGGCCA

[0147] As Figure 4 A band was confirmed at approximately 2 kb, the total size of the target gene. DNA gene analysis confirmed whether this band matched the target gene, and the results are shown in Table 4.

[0148] [Table 4]

[0149]

[0150]

[0151]

[0152] As can be confirmed from Table 4, when the DNA base sequence of the target gene Sh-ble was compared with the obtained gene information by CLUSTAL 2.1 multiple sequence alignment, they were confirmed to be completely consistent.

[0153] Experimental Example 2. Confirmation of Mutant Maintenance

[0154] For the maintenance of mutants, the mutant maintenance was confirmed by subculture, and the results were as follows. Figure 5 As shown by Figure 5 It was confirmed that the mutants were maintained by subculture.

[0155] Experimental Example 3. Biomineralization

[0156] Example 1: Plasmid construction and cloning

[0157] Based on the pKA650 vector, a plasmid with zeocin resistance and for expressing the target protein was constructed and cloned by inserting a gene for the target protein. The sequence of the bleomycin resistance gene (Sh ble) was obtained from the genomic DNA of Streptomyces verticillus (Sh ble). The full sequence was synthesized by connecting the promoter and terminator sequences of the ribulose-1,5-bisphosphate carboxylase / oxygenase small subunit (rbcS2) gene of the green algae (Coccomyxa) C-169 to the 5' and 3' portions of Sh ble, respectively. This sequence was named pKA650; in the synthesized pKA650, the intermediate gene BleoR of the full sequence Sh-ble was replaced with the beta-type carbonic anhydrase gene of C-169, and the repeated promoter portion was inserted using the restriction enzymes Kpn I and Apa I. The plasmid obtained by cloning is as follows Figure 6 As shown, it was named pJG002.

[0158] Example 2: Transformation of Chlorella vulgaris

[0159] The transformation method using the pJG002 vector is the same as that using the pKA650 vector.

[0160] Specifically, to prepare competent cells, 300 mL of sterile MBM medium (KNO3 2.5 mM, MgSO4 7H2O 0.3 mM, K2HPO4 0.43 mM, KH2PO4 1.29 mM, NaCl 0.43 mM, CaCl2*2H2O 0.068 mM, FeSO4*7H2O 0.1 g, A5 metal mix ml / L) was prepared in a 500 mL flask, inoculated with Chlorella vulgaris, and cultured at 23°C and 100 rpm. When the OD 686 When the value reaches 0.5-0.6, collect the common Chlorella using a centrifuge and confirm the cell number.

[0161] After confirming the cell number, prepare the cell density to 4.8*10 7. Afterwards, for gold particle bombardment, the pKA650 to be introduced is linearized with the restriction enzyme KpnI. Prepare the retaining cap, brass adjustable nest, microcarrier holder, stopping screen, and macrocarrier in a sterilized state in advance, and wash the ruptured membrane with 70% isopropanol. Allow the ruptured membrane to dry, and during this time prepare the plasmid and gold particle mixture. First, for 20 bombardments, add 12 mg of gold particles to a microcentrifuge tube and then add 1 ml of 70% ethanol. Vortex at maximum speed for 5 minutes and centrifuge for 5 seconds to remove the supernatant.

[0162] The gold particles were washed three times using the following procedure: 1 ml of distilled water was added, vortexed for 1 minute, allowed to stand for 1 minute, and centrifuged for 5 seconds before removing the supernatant. Next, 205 μl of 50% glycerol was added and dissolved by vortexing for 5 minutes. Vortexing was continued at a speed of 2-3. For 10 bombardments, 100 μl of the gold particles was transferred to a new microcentrifuge tube and vortexed. Then, 10 μl of DNA (0.5-20 μg / μl), 100 μl of 2.5 M CaCl₂, and 40 μl of 0.1 M spermidine were added, mixing with a pipette. After mixing, the mixture was vortexed for 2 minutes and allowed to stand for 1 minute. The precipitate was centrifuged for 2 seconds to settle, and the supernatant was removed. After removing the supernatant, 300 μl of 70% ethanol was added, allowed to stand for 1 minute, and the supernatant removed. Then, 300 μl of 100% ethanol was added and allowed to stand for 1 minute. The supernatant was removed again, and 110 μl of 100% ethanol was added and the pellet was dissolved by continuous vortexing.

[0163] After the gold particle mixture is prepared, 11 μl is added dropwise to the center of the microcarrier and allowed to dry for 5 to 10 minutes. During this time, the prepared cells are evenly spread on the culture medium with a diameter of 60 mm. Next, a barrier screen is placed on the brass adjustable nest, followed by the completely dried microcarriers. The holder is then secured and the gene gun instrument is turned on and preheated for 5 minutes. After preheating, the rupture membrane is placed on the retaining cap and screwed onto the gene gun. Next, the brass adjustable nest with microcarriers is inserted, and the culture medium with cells is placed at a target distance of 3. The door is closed. Turn on the helium gas and press the vacuum button. When the vacuum reaches 29 inches of mercury and the helium pressure reaches 1300 psi, press the fire button and the pressure rises to 1100 psi, launching the gold particles. After bombardment, the culture medium is incubated at 23°C to allow for a recovery period.

[0164] Example 3: Confirmation of Chlorella vulgaris transformants

[0165] The same bioballistic method as in Example 2 was used for transformation. After subculture, the antibiotic resistance was confirmed according to the concentration gradient. The results were as follows: Figure 7 A total of 42 transformants were obtained. These were obtained by using the culture medium of Example 2 and continuing to subculture while irradiating with light.

[0166] To confirm the gene and protein expression of such transformants, a band of about 43 kDa of the target protein β-carbonic anhydrase was confirmed by whole protein SDS-PAGE. Figure 8 shown.

[0167] To confirm the band of the target protein, MALDI-TOF (matrix-assisted laser desorption ionization time-of-flight mass spectrometry) was performed, and the results were as follows: Figure 9 shown.

[0168] The present invention was carried out by confirming the protein expression of the transformant and confirming the maintenance of resistance through passage. For gene confirmation, the presence of the target gene was confirmed by Southern blot hybridization. The results are as follows Figure 10 shown.

[0169] As Figure 10 It was confirmed that a DNA band was found at the same position as the target gene in size, which was also confirmed by DNA sequencing using PCR.

[0170] Example 4: Strontium (Sr) biomineralization

[0171] Regarding the function of the transformants, in order to achieve a functional enhancement effect on Sr biomineralization, the biomineralization crystals were visually confirmed by microscopy through crystallization at the same amount. First, the Sr biomineralization ability of Chlorella vulgaris, which is the wild type (WT), was confirmed.

[0172] Specifically, Chlorella vulgaris was cultured under light conditions to an OD of 0.6. After culture, the microalgae were collected under sterilization conditions at 25 degrees, 4000 rpm, and 15 minutes. Then, the microalgae were washed three times with 3mM sodium bicarbonate (NaHCO3). After that, the cells were adjusted to 1*10^7mL, 200ppm of Sr was added to the prepared 3mM NaHCO3, and the prepared Chlorella vulgaris was mixed in and cultured at 4°C for more than 4 hours. Then, it was stained with 0.004% sodium rhodizonate and observed under a microscope. The results are as follows: Figure 11 shown.

[0173] As Figure 11 It was confirmed that the amount of biomineralized crystals of WT was lower than that of the transformant. In addition, for quantitative comparison, analysis was performed by inductively coupled plasma mass spectrometry (ICP-MS), and the results were as follows: Figure 12 As shown in Table 5.

[0174] [Table 5]

[0175]

[0176] As Figure 12 As shown in Table 5, the amount of biomineralized crystals in the transformant was increased by approximately 160% at most compared to the wild type.

[0177] Example 5. Biomineralization results of lithium (Li) in single lithium chloride (LiCl)

[0178] 5-1. Removal rate at different LiCl concentrations

[0179] The lithium crystal removal rate of a single LiCl solution at different lithium concentrations was determined using the transformed Chlorella vulgaris cells described in Example 3, LiCl (Sigma), sterile MBM medium (KNO 2.5 mM, MgSO 7H O 0.3 mM, KH PO 0.43 mM, KH PO 1.29 mM, NaCl 0.43 mM, CaCl 2*2H O 0.068 mM, FeSO 7H O 0.1 g, A5 metal mixture (ml / L), deionized water (DIW), white light, a stirrer, a 10 ml conical tube, a centrifuge, and a 0.2 μM syringe filter. The specific experimental method is as follows.

[0180] Fresh (log phase) cells of Chlorella vulgaris were cultured in MBM medium at 6*10^7 / ml. After obtaining 5 mL of cells collected in the culture medium, a 10 mL conical tube was used to mix with 5 mL of LiCl solution of different concentrations (300, 600 and 900 mM, respectively) to a total volume of 10 mL. It was slowly stirred and reacted for 16 hours under white light. After 16 hours, centrifuged at 3000 rpm for 3 minutes. The supernatant was collected, the cells and crystals were filtered through a 0.2 uM syringe filter, and the collected solution was used for ICP analysis. The sample was loaded onto the ICP-OES and MS instruments, and the sample was ionized using the measured inductively coupled plasma, and the corresponding ions were separated using a mass spectrometer for ICP analysis. The results are shown in FIG. Figures 13 and 14 shown.

[0181] pass Figure 13 The results confirmed the lithium removal rate at different lithium concentrations: at 300mM, the lithium removal rate was about 71%; at 600mM, the lithium removal rate was about 94%; and at 900mM, the lithium removal rate was about 28%.

[0182] In addition, through Figure 14 The results confirmed the lithium removal rate depending on the presence or absence of cells. At all concentrations, the lithium removal rate was much better in the presence of cells (with C. vulgaris) than in the absence of cells (without C. vulgaris). Figure 14 The specific measurement values ​​are shown in Table 6.

[0183] [Table 6]

[0184]

[0185]

[0186] 5-2. Effects of Sodium and Sulfate

[0187] To determine the effects of sodium and sulfate, the experiment was conducted in the same manner as in Example 5-1, except that different concentrations of sodium chloride (NaCl) or potassium sulfate (potassium sulfate) were added to the conical tube. The concentration of lithium (Li) was fixed at 600 mM. Figures 15 and 16 shown.

[0188] As a result, through Figure 15 The results confirmed that the lithium removal rate varied with sodium concentration: at 300 mM, the lithium removal rate was approximately 13%; at 600 mM, the lithium removal rate was approximately -3%; and at 900 mM, the lithium removal rate was approximately 17%. This indicates that there is no correlation between sodium concentration and lithium removal rate.

[0189] In addition, through Figure 16 The results confirmed that the lithium removal rate varied with sulfate concentration: at 300 mM, the lithium removal rate was approximately -12%; at 600 mM, the lithium removal rate was approximately -1%; and at 900 mM, the lithium removal rate was approximately 13%. This indicates that there is no consistent correlation between sulfate concentration and lithium removal rate.

[0190] Example 6. Preparation of lithium battery solution

[0191] LiCl(sigma), NiCl2(sigma), CoCl2(sigma), MnCl(sigma), AlCl3(sigma), CuCl2(sigma), FeCl2(sigma), ClF(sigma), and KH2PO4(sigma) were mixed in deionized water (DIW) to produce a lithium battery solution. The composition of the produced lithium battery solution was analyzed, and the results are shown in Tables 7 and 8. Figure 17 shown.

[0192] [Table 7]

[0193]

[0194]

[0195] As can be confirmed from Table 7, Li is 4% (1 M), Ni is 26% (1.09 M), and Co is 33% (1.39 M).

[0196] Example 7. Biomineralization results of lithium (Li) in lithium battery solution

[0197] 7-1. Crystallization in lithium battery solutions

[0198] The results of Li crystallization in the lithium battery solution were confirmed using the transformed Chlorella vulgaris (cells) described in Example 3, the lithium battery solution prepared in Example 6, sterilized MBM medium (KNO3 2.5mM, MgSO4 7H2O 0.3mM, K2HPO4 0.43mM, KH2PO4 1.29mM, NaCl 0.43mM, CaCl2*2H2O 0.068mM, FeSO4*7H2O 0.1g, A5 metal mixture ml / L), deionized water (DIW), white light, a stirrer, a 10ml conical tube, a centrifuge, and a 0.2uM syringe filter. The specific experimental method is as follows.

[0199] Fresh (logarithmic phase) cells of Chlorella vulgaris were cultured in MBM medium at 6*10^7 / ml. After obtaining 5ml of cells collected in the culture medium, a 10ml conical tube was used to mix it with a lithium battery solution containing 5ml of 2M LiCl to finally make 10ml of 1M LiCl solution. The solution was slowly stirred and reacted under white light for 16 hours. After 16 hours, centrifuged at 3000rpm for 3 minutes. The supernatant was collected and the cells and crystals were filtered through a 0.2uM syringe filter. The collected solution was used for ICP analysis. The sample was loaded onto the ICP-OES and MS instruments, the sample was ionized using the measured inductively coupled plasma, and the corresponding ions were separated by a mass spectrometer for ICP analysis. The results are shown in Figure 2. Figure 18 shown.

[0200] pass Figure 18 The results confirmed the lithium removal rate depending on the presence or absence of cells. It was confirmed that when there were no cells (w / o Cell), almost no lithium was removed; while when there were cells (w / Cell), about 50% of the lithium was removed.

[0201] 7-2. Crystallization of Na and S in Lithium Battery Solutions

[0202] To determine the effects of sodium and sulfate, the experiment was conducted in the same manner as in Example 7-1, but different concentrations of NaCl or potassium sulfate (300, 600, 900 mM) were added to the conical tubes. Figures 19 to 20 shown.

[0203] pass Figure 19The results confirmed the lithium removal rate at different sodium concentrations. At 300 mM, the lithium removal rate was approximately 56%; at 600 mM, the lithium removal rate was approximately 68%; and at 900 mM, the lithium removal rate was approximately 37%. In other words, there was no correlation between sodium concentration and lithium removal rate.

[0204] In addition, through Figure 20 The results confirmed the lithium removal rate at different sulfate concentrations. At 300mM, the lithium removal rate was approximately 33%; at 600mM, the lithium removal rate was approximately 45%; and at 900mM, the lithium removal rate was approximately 75%. In other words, it was confirmed that the lithium removal rate increased with increasing sulfate concentration.

[0205] Example 8. Biomineralization results of nickel (Ni) in single NiCl2

[0206] 8-1. Removal rate at different NiCl2 concentrations

[0207] The nickel removal efficiency of a single NiCl2 solution at different nickel concentrations was determined using the Chlorella vulgaris cells transformed in Example 3, NiCl2 (Sigma), sterile MBM medium (KNO3 2.5mM, MgSO4 7H2O 0.3mM, K2HPO4 0.43mM, KH2PO4 1.29mM, NaCl 0.43mM, CaCl2*2H2O 0.068mM, FeSO4*7H2O 0.1g, A5 metal mixture (ml / L), deionized water (DIW), white light, a stirrer, a 10ml conical tube, a centrifuge, and a 0.2µM syringe filter. The specific experimental method is as follows.

[0208] Fresh (logarithmic phase) cells of Chlorella vulgaris were cultured in MBM medium at 6*10^7 / ml. After obtaining 5ml of cells collected in the culture medium, a 10ml conical tube was used to mix it with 5ml of NiCl2 solution of different concentrations (300, 600, and 900mM, respectively) to a total volume of 10ml. It was slowly stirred and reacted under white light for 16 hours. After 16 hours, centrifuged at 3000rpm for 3 minutes. The supernatant was collected, the cells and crystals were filtered through a 0.2uM syringe filter, and the collected solution was used for ICP analysis. The sample was loaded onto the ICP-OES and MS instruments, and after the sample was ionized using the measured inductively coupled plasma, the corresponding ions were separated using a mass spectrometer for ICP analysis. The results are shown as follows. Figures 21 to 22 shown.

[0209] pass Figure 21The results confirmed the nickel removal rate at different nickel concentrations. It was confirmed that at 300mM, the nickel removal rate was about 36%; at 600mM, the nickel removal rate was about 15%; and at 900mM, the nickel removal rate was about 23%.

[0210] In addition, through Figure 22 The results confirmed the nickel removal rate depending on the presence or absence of cells. It was confirmed that at all concentrations, the nickel removal rate in the presence of cells (w / C. vulgaris, with Chlorella vulgaris) was much better than in the absence of cells (w / o C. vulgaris, without Chlorella vulgaris). Figure 14 The specific measurement values ​​are shown in Table 8 below.

[0211] [Table 8]

[0212]

[0213] 8-2. Effects of Sodium and Sulfate

[0214] To determine the effects of sodium and sulfate, the experiment was conducted in the same manner as in Example 8-1, but different concentrations of NaCl or potassium sulfate (300, 600, and 900 mM) were added to the conical tube. The concentration of Ni was fixed at 600 mM. The results are shown in Figure 8-1. Figures 23 to 24 shown.

[0215] As a result, through Figure 23 The results confirmed the nickel removal rate at different sodium concentrations. At 300 mM, the nickel removal rate was approximately 11%; at 600 mM, the nickel removal rate was approximately 8%; and at 900 mM, the nickel removal rate was approximately 4%. In other words, as the sodium concentration increased, the nickel removal rate decreased.

[0216] In addition, through Figure 24 The results confirmed nickel removal rates at different sulfate concentrations. At 300 mM, the nickel removal rate was approximately 6%; at 600 mM, the nickel removal rate was approximately 2%; and at 900 mM, the nickel removal rate was approximately 9%. In other words, there was no correlation between sulfate concentration and nickel removal rate.

[0217] Example 9. Preparation of Nickel Battery Solution

[0218] LiCl2(sigma), NiCl2(sigma), CoCl2(sigma), MnCl(sigma), AlCl3(sigma), CuCl2(sigma), FeCl2(sigma), ClF(sigma), and KH2PO4(sigma) were mixed in deionized water (DIW) to produce a nickel battery solution. The composition of the produced nickel battery solution was analyzed, and the results are shown in Tables 9 and Figure 25 shown.

[0219] [Table 9]

[0220] element Grams per liter (g / L) Al 5 Co 33 Cu 3 Fe 0.3 Li 4 Mn 11 Ni 26 F 4 P 1

[0221] As can be confirmed from Table 9, Li is 4% (1 M), Ni is 26% (1.09 M), and Co is 33% (1.39 M).

[0222] Example 10. Results of biomineralization of nickel (Ni) in nickel battery solution

[0223] 10-1. Crystallization in nickel battery solutions

[0224] The nickel crystallization results in the nickel battery solution were confirmed using the Chlorella vulgaris (cells) transformed in Example 3, the nickel battery solution prepared in Example 9, sterilized MBM medium (KNO3 2.5mM, MgSO47H2O 0.3mM, K2HPO4 0.43mM, KH2PO4 1.29mM, NaCl 0.43mM, CaCl2*2H2O 0.068mM, FeSO4*7H2O 0.1g, A5 metal mixture ml / L), deionized water (DIW), white light, a stirrer, a 10ml conical tube, a centrifuge, and a 0.2uM syringe filter. The specific experimental method is as follows.

[0225] Fresh (logarithmic phase) cells of Chlorella vulgaris were cultured in MBM medium at 6*10^7 / ml. After obtaining 5ml of cells collected in the culture medium, a 10ml conical tube was used to mix it with 5ml of nickel battery solution containing 2.18M NiCl2 to finally make 10ml of 1.09M NiCl2 solution. It was slowly stirred and reacted under white light for 16 hours. After 16 hours, centrifuged at 3000rpm for 3 minutes. The supernatant was collected and the cells and crystals were filtered through a 0.2μm syringe filter. The collected solution was used for ICP analysis. The sample was loaded onto the ICP-OES and MS instruments, the sample was ionized using the measured inductively coupled plasma, and the corresponding ions were separated using a mass spectrometer for ICP analysis. The results are shown as follows. Figure 26 shown.

[0226] pass Figure 26 The results confirmed the nickel removal rate depending on the presence or absence of cells. It was confirmed that when there were no cells (w / o Cell), almost no nickel was removed; while when there were cells (w / Cell), about 80% of nickel was removed.

[0227] 10-2. Crystallization of Na and S in Nickel Battery Solutions

[0228] To determine the effects of sodium and sulfate, the experiment was conducted in the same manner as in Example 10-1, but different concentrations of NaCl or potassium sulfate (300, 600, 900 mM) were added to the conical tubes. Figures 27 and 28 shown.

[0229] pass Figure 27 The results confirmed the nickel removal rate at different sodium concentrations. At 300mM, the nickel removal rate was approximately 74%; at 600mM, the nickel removal rate was approximately 62%; and at 900mM, the nickel removal rate was approximately 80%. In other words, there was no correlation between sodium concentration and nickel removal rate.

[0230] In addition, through Figure 28 The results confirmed the nickel removal rate at different sulfate concentrations. At 300 mM, the nickel removal rate was approximately 12%; at 600 mM, the nickel removal rate was approximately 55%; and at 900 mM, the nickel removal rate was approximately 64%. In other words, the nickel removal rate increased with increasing sulfate concentration.

[0231] Example 11. Biomineralization results of cobalt (Co) in single cobalt chloride (CoCl2)

[0232] 11-1. Removal rate at different CoCl2 concentrations

[0233] The removal efficiency of a single CoCl2 solution at different cobalt concentrations was determined using the transformed Chlorella vulgaris cells described in Example 3, CoCl2 (Sigma), sterile MBM medium (KNO3 2.5mM, MgSO4 7H2O 0.3mM, K2HPO4 0.43mM, KH2PO4 1.29mM, NaCl 0.43mM, CaCl2*2H2O 0.068mM, FeSO4*7H2O 0.1g, A5 metal mixture (ml / L), DIW (deionized water), white light, a stirrer, a 10ml conical tube, a centrifuge, and a 0.2µM syringe filter. The specific experimental method is as follows.

[0234] Fresh (logarithmic phase) cells of Chlorella vulgaris were cultured in MBM medium at 6*10^7 / ml. After obtaining 5ml of cells collected in the culture medium, they were mixed with 5ml of CoCl2 solution of different concentrations (300, 600, and 900mM, respectively) using a 10ml conical tube to a total volume of 10ml. The reaction was slowly stirred under white light for 16 hours. After 16 hours, centrifuged at 3000rpm for 3 minutes. The supernatant was collected, the cells and crystals were filtered through a 0.2μm syringe filter, and the collected solution was used for ICP analysis. The sample was loaded onto the ICP-OES and MS instruments, and after the sample was ionized using the measured inductively coupled plasma, the corresponding ions were separated using a mass spectrometer for ICP analysis. The results are shown as follows. Figures 29 to 30 shown.

[0235] pass Figure 29 The results confirmed the cobalt removal rate at different cobalt concentrations. It was confirmed that at 300mM, the cobalt removal rate was about 50%; at 600mM, the cobalt removal rate was about 54%; and at 900mM, the cobalt removal rate was about 30%.

[0236] In addition, through Figure 30 The results confirmed the cobalt removal rate depending on the presence or absence of cells. It was confirmed that the cobalt removal rate in the presence of cells (w / C. vulgaris) was much better than that in the absence of cells (w / o C. vulgaris) at all concentrations. Figure 14 The specific measured values ​​are shown in Table 10 below.

[0237] [Table 10]

[0238]

[0239]

[0240] 11-2. Effects of Sodium and Sulfate

[0241] To determine the effects of sodium and sulfate, the same experiment as in Example 11-1 was conducted, but different concentrations of NaCl or potassium sulfate (300, 600, and 900 mM) were added to the conical tube. The concentration of Co was fixed at 600 mM. The results are shown in Figure 11-1. Figures 31 to 32 shown.

[0242] As a result, through Figure 31The results confirmed the cobalt removal rate at different sodium concentrations. At 300 mM, the cobalt removal rate was approximately 3%; at 600 mM, the cobalt removal rate was approximately 0%; and at 900 mM, the cobalt removal rate was approximately 3%. In other words, there was no correlation between sodium concentration and cobalt removal rate.

[0243] In addition, through Figure 32 The results confirmed the cobalt removal rate at different sulfate concentrations. At 300 mM, the cobalt removal rate was approximately 5%; at 600 mM, the cobalt removal rate was approximately 13%; and at 900 mM, the cobalt removal rate was approximately 4%. In other words, there was no correlation between sulfate concentration and cobalt removal rate.

[0244] Example 12. Preparation of cobalt battery solution

[0245] LiCl2(sigma), NiCl2(sigma), CoCl2(sigma), MnCl(sigma), AlCl3(sigma), CuCl2(sigma), FeCl2(sigma), ClF(sigma), and KH2PO4(sigma) were mixed in DIW (deionized water) to produce a cobalt battery solution. The composition of the produced cobalt battery solution was analyzed, and the results are shown in Tables 11 and 11. Figure 33 shown.

[0246] [Table 11]

[0247]

[0248]

[0249] As can be confirmed from Table 11, Li is 4% (1 M), Ni is 26% (1.09 M), and Co is 33% (1.39 M).

[0250] Example 13. Biomineralization results of cobalt (Co) in cobalt battery solution

[0251] 13-1. Crystallization in Cobalt Battery Solutions

[0252] The cobalt battery solution prepared in Example 12, the cobalt battery solution transformed with Chlorella vulgaris (cells) in Example 3, sterilized MBM medium (KNO3 2.5mM, MgSO4 7H2O 0.3mM, K2HPO4 0.43mM, KH2PO4 1.29mM, NaCl 0.43mM, CaCl2*2H2O 0.068mM, FeSO4*7H2O 0.1g, A5 metal mixture ml / L), DIW (deionized water), white light, a stirrer, a 10ml conical tube, a centrifuge, and a 0.2uM syringe filter were used to confirm the crystallization of Co in the cobalt battery solution. The specific experimental method is as follows.

[0253] Fresh (logarithmic phase) cells of Chlorella vulgaris were cultured in MBM medium at 6*10^7 / ml. After obtaining 5ml of cells collected in the culture medium, they were mixed with 2.78M cobalt battery solution containing 5ml of NiCl2 using a 10ml conical tube to finally make 10ml of 1.39M CoCl2 solution. It was slowly stirred and reacted for 16 hours under white light. After 16 hours, centrifuged at 3000rpm for 3 minutes. The supernatant was collected and the cells and crystals were filtered through a 0.2uM syringe filter. The collected solution was used for ICP analysis. The sample was loaded onto the ICP-OES and MS instruments, the sample was ionized using the measured inductively coupled plasma, and the corresponding ions were separated using a mass spectrometer for ICP analysis. The results are shown as follows. Figure 34 shown.

[0254] pass Figure 34 The results confirmed the cobalt removal rate depending on the presence or absence of cells. It was confirmed that when there were no cells (w / o Cell), almost no cobalt was removed, while when there were cells (w / Cell), about 75% of cobalt was removed.

[0255] 13-2. Crystallization of Na and S in Cobalt Battery Solutions

[0256] To determine the effects of sodium and sulfate, the same method as in Example 13-1 was used to conduct the experiment, but different concentrations of NaCl or potassium sulfate (300, 600, 900 mM) were added to the conical tube. The results are shown in Figure 13-1. Figures 35 to 36 shown.

[0257] pass Figure 35 The results confirmed the cobalt removal rate at different sodium concentrations. At 300 mM, the cobalt removal rate was approximately 74%; at 600 mM, the cobalt removal rate was approximately 64%; and at 900 mM, the cobalt removal rate was approximately 77%. In other words, there was no correlation between sodium concentration and cobalt removal rate.

[0258] In addition, through Figure 36 The results confirmed the cobalt removal rate at different sulfate concentrations. At 300 mM, the cobalt removal rate was approximately 13%; at 600 mM, the cobalt removal rate was approximately 53%; and at 900 mM, the cobalt removal rate was approximately 62%. In other words, it was confirmed that the cobalt removal rate increased with increasing sulfate concentration.

[0259] sintering

[0260] The results of lithium (Li) biomineralization in single LiCl solution and lithium battery solution are summarized in Tables 12 and 13 below.

[0261] [Table 12]

[0262]

[0263]

[0264] [Table 13]

[0265]

[0266] The results of the biomineralization of nickel (Ni) in a single NiCl2 solution and a nickel battery solution are summarized in Tables 14 and 15 below.

[0267] [Table 14]

[0268]

[0269] [Table 15]

[0270]

[0271]

[0272] The results of biomineralization of cobalt (Co) in single CoCl2 solution and cobalt battery solution are summarized in Tables 16 and 17 below.

[0273] [Table 16]

[0274]

[0275] [Table 17]

[0276]

[0277]

[0278] Industrial applicability

[0279] The present invention relates to a composition for leaching lithium, nickel or cobalt using a Chlorella vulgaris strain and a method for leaching lithium, nickel or cobalt.

Claims

1. A composition for leaching lithium, nickel or cobalt, comprising at least one selected from the group consisting of a Chlorella vulgaris strain, a culture of the strain, a concentrate of the culture and a dried product of the culture.

2. The composition for leaching lithium, nickel or cobalt according to claim 1, wherein The strain was transformed with a vector comprising: Promoter of the green algae (Coccomyxa) C-169 ribulose-1,5-bisphosphate carboxylase / oxygenase (RuBisCo) small subunit 2 (rbcS2) gene; a nucleotide sequence encoding β-type carbonic anhydrase from Coccomyxa subellipsoidea C-169; and The terminator sequence of the rbcS2 gene from green algae C-169.

3. The composition for leaching lithium, nickel or cobalt according to claim 2, wherein The promoter includes the base sequence of sequence number 2.

4. The composition for leaching lithium, nickel or cobalt according to claim 2, wherein The nucleotide sequence encoding the beta-type carbonic anhydrase of Coccomycetes C-169 is operatively linked to a promoter.

5. The composition for leaching lithium, nickel or cobalt according to claim 2, wherein The terminator sequence includes the base sequence of column number 3.

6. The composition for leaching lithium, nickel or cobalt according to claim 2, wherein The vector further includes an antibiotic resistance gene as a selectable marker.

7. The composition for leaching lithium, nickel or cobalt according to claim 6, wherein The antibiotic is one or more selected from the group consisting of spectinomycin, paromomycin, ampicillin, Zeocin and bleomycin.

8. The composition for leaching lithium, nickel or cobalt according to claim 2, wherein The vector further comprises a gene encoding a reporter molecule.

9. The composition for leaching lithium, nickel or cobalt according to claim 8, wherein The reporter molecule is one or more selected from the group consisting of growth-promoting proteins, fluorescent proteins, and hydrolases.

10. The composition for leaching lithium, nickel or cobalt according to claim 9, wherein The fluorescent protein is luciferase.

11. The composition for leaching lithium, nickel or cobalt according to claim 9, wherein The hydrolase is β-glucuronidase.

12. The composition for leaching lithium, nickel or cobalt according to claim 2, wherein The vector is used for transformation of microalgae using gold particles bombardment.

13. A method for leaching lithium, nickel or cobalt by bioleaching, wherein: a mixing step of mixing one or more selected from the group consisting of a Chlorella vulgaris strain, a culture of the strain, a concentrate of the culture, and a dried product of the culture with a substance including lithium; and A leaching step in which lithium is leached for a predetermined time.

14. The method for leaching lithium, nickel or cobalt according to claim 13, wherein: The lithium, nickel or cobalt leaching method comprises the following conversion step before the mixing step, and the Chlorella vulgaris strain in the mixing step is a converted Chlorella vulgaris strain: The transformation step of Chlorella vulgaris is carried out by introducing a vector comprising the promoter of the ribulose-1,5-bisphosphate carboxylase / oxygenase (RuBisCo) small subunit 2 (rbcS2) gene of Coccomyxa C-169, a nucleotide sequence encoding beta-type carbonic anhydrase of Coccomyxa subellipsoidea C-169, and a terminator sequence of the rbcS2 gene of Coccomyxa subellipsoidea C-169.

15. The method for leaching lithium, nickel or cobalt according to claim 14, wherein: The promoter includes the base sequence of sequence number 2.

16. The method for leaching lithium, nickel or cobalt according to claim 14, wherein: The nucleotide sequence encoding the beta-type carbonic anhydrase of Coccomycetes C-169 is operatively linked to a promoter.

17. The method for leaching lithium, nickel or cobalt according to claim 14, wherein: The terminator sequence includes the base sequence of column number 3.

18. The method for leaching lithium, nickel or cobalt according to claim 14, wherein: The vector further includes an antibiotic resistance gene as a selectable marker.

19. The method for leaching lithium, nickel or cobalt according to claim 18, wherein: The antibiotic is one or more selected from the group consisting of spectinomycin, paromomycin, ampicillin, Zeocin and bleomycin.

20. The method for leaching lithium, nickel or cobalt according to claim 14, wherein: The vector further comprises a gene encoding a reporter molecule.

21. The method for leaching lithium, nickel or cobalt according to claim 20, wherein: The reporter molecule is one or more selected from the group consisting of growth-promoting proteins, fluorescent proteins, and hydrolases.

22. The method for leaching lithium, nickel or cobalt according to claim 21, wherein: The fluorescent protein is luciferase.

23. The method for leaching lithium, nickel or cobalt according to claim 21, wherein: The hydrolase is β-glucuronidase.

24. The method for leaching lithium, nickel or cobalt according to claim 14, wherein: The vector is used for transformation of microalgae using gold particles bombardment.

25. The method for leaching lithium, nickel or cobalt according to claim 14, wherein: The conversion step was performed using gold particles bombardment.

26. The method for leaching lithium, nickel or cobalt according to claim 14, wherein: The cell phase during the transformation step is the logarithmic phase.

27. The method for leaching lithium, nickel or cobalt according to claim 26, wherein: The OD686 value in the logarithmic phase was 0.4 to 0.

6.

28. The method for leaching lithium, nickel or cobalt according to claim 14, wherein: The cell density of the transformation step was 5.0*10 6 Up to 8.0*10 7 / 60mm diameter.

29. The method for leaching lithium, nickel or cobalt according to claim 14, wherein: The vacuum level during the conversion step was 27.0 to 29.0 inches Hg.

Images