Mouse model construction method for inducing acute inflammatory anemia

Abstract

The invention provides a construction method of a mouse model for inducing acute inflammatory anemia. An existing inflammatory anemia model is too long in construction period and cannot simulate the clinical phenomenon of acute anemia, the mouse model provided by the invention can induce the number of red blood cells and the hemoglobin level to be remarkably reduced through single Poly (I: C) stimulation for 36 hours, an acute anemia time window is accurately simulated, and a good foundation is laid for mechanism research of acute inflammatory anemia.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to a method for constructing a mouse model for inducing acute inflammatory anemia. Background Art

[0002] Anemia of inflammation (AI), a common anemia, seriously affects patients' health and quality of life. Among AI patients, 71% suffer from acute infections, 12% suffer from cancer, and 16% suffer from chronic infections or autoimmune diseases. Based on their pathogenesis and etiology, anemia of inflammation can be divided into multiple types. Acute anemia of inflammation is the most common clinical type, typically triggered by acute inflammatory responses such as infection, trauma, and surgery. It often develops suddenly within 24-48 hours and is characterized by rapid onset. Without timely and effective intervention, it can lead to serious consequences such as multi-organ dysfunction. Therefore, in-depth research on the pathogenesis of acute anemia of inflammation and the development of effective therapeutic drugs are of great clinical significance.

[0003] Existing methods for constructing anemia models, including gene editing and chemical or physical induction, have significant limitations for research related to acute inflammatory anemia, such as complex procedures, high time costs, and unstable phenotypes. For example, anemia models constructed using gene editing primarily mimic inherited anemias, whose pathogenesis differs significantly from that of infectious inflammatory anemias, making them inadequate models for studying acute inflammatory anemias. LPS-induced anemia models require multiple stimulations (e.g., over seven days) to develop the chronic inflammatory anemia phenotype, which is time-consuming and subject to numerous confounding factors. Furthermore, chronic inflammatory anemias rely on hepcidin accumulation and EPO resistance, whereas acute anemias primarily involve acute red blood cell destruction and a sudden drop in hemoglobin levels, resulting in distinct pathological mechanisms. Currently, there is a lack of a method for rapidly and stably constructing such acute inflammatory anemia models to define the onset of acute inflammatory anemia, providing strong support for rapid drug screening and in-depth investigation of its pathogenesis.

[0004] Based on the above background, developing an effective method to induce acute inflammatory anemia in mice model has important clinical significance and application value. Summary of the Invention

[0005] In response to the problems that existing technologies cannot quickly and stably construct an acute inflammatory anemia model and lack a clear time node for acute inflammatory anemia, the present invention provides a method for constructing a mouse model of acute inflammatory anemia by inducing single Poly (I:C) induction and time window control, which is different from the existing technology.

[0006] To achieve the above objectives, the specific technical solutions provided by the present invention are as follows:

[0007] A first aspect of the present invention provides a method for constructing a mouse model of inducing acute inflammatory anemia, wherein the steps of the construction method include administering Poly(I:C) to the mouse once, and the model is constructed after 36 hours.

[0008] For the purposes of this invention, acute inflammatory anemia refers to a secondary anemia caused by an acute illness (such as infection, trauma, or surgery). Its core mechanism is related to acute inflammatory responses, immune activation, or tissue damage. This type of anemia has an abrupt onset and is characterized by a short-term decrease in hemoglobin concentration, which often fluctuates with the progression of the primary disease. The pathophysiological process primarily involves inflammatory cytokine-mediated bone marrow suppression, decreased hemoglobin gene expression, and accelerated red blood cell destruction.

[0009] In the present invention, Poly(I:C) (Polyinosinic acid-polycytidylic acid) is also known as (PolyI:C), and its Chinese aliases include polycytidylic acid, polyinosinic acid, polyinosinic acid, polycytidylic acid, polyinosinic acid cytosine nucleotide, and polyinosinic acid-polycytidylic acid, and its CAS number is 42424-50-0.

[0010] Furthermore, the administration dose of the Poly(I:C) is 12 mg / kg.

[0011] Furthermore, the method of administering the Poly(I:C) is intraperitoneal injection.

[0012] Furthermore, the mice are C57BL / 6J mice.

[0013] The second aspect of the present invention provides a mouse model obtained by the construction method described in the first aspect of the present invention.

[0014] In some embodiments, the test results of the mouse model, compared with wild-type mice, show at least one change in the following indicators: increased proportion of peripheral blood monocytes, decreased red blood cell concentration, decreased hemoglobin concentration, increased spleen weight, decreased hemoglobin gene expression, increased innate immune gene expression, and decreased erythroid regulatory gene expression.

[0015] In the present invention, increase or decrease means that compared with wild-type mice, in the test results of the mouse model obtained by the construction method described in the first aspect of the present invention, the expression level of the above-mentioned indicator changes by at least 10%, at least 50%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100%.

[0016] In the present invention, innate immune genes, as part of the innate immune system, can act as intracellular and extracellular signaling molecules to regulate immune responses. In a specific embodiment of the present invention, the innate immune genes include Rsad2, Isg15, Ifit1, and Oas1a.

[0017] In the present invention, erythroid regulatory genes refer to key genes that regulate erythropoiesis and differentiation. They ensure normal erythrocyte development and function by regulating the expression of erythrocyte-specific genes. In a specific embodiment of the present invention, erythroid regulatory genes include Eklf, Gata1, Nfe2, and Ldb1.

[0018] The third aspect of the present invention provides the application of the mouse model obtained by the construction method described in the first aspect of the present invention in the study of the pathogenesis of acute inflammatory anemia.

[0019] The fourth aspect of the present invention provides the use of the mouse model obtained by the construction method described in the first aspect of the present invention in screening therapeutic drugs for acute inflammatory anemia.

[0020] The fifth aspect of the present invention provides a method for screening therapeutic drugs for acute inflammatory anemia, the steps of which include: administering the drug to be screened to the mouse model obtained by the construction method described in the first aspect of the present invention; detecting at least one indicator of the mouse peripheral blood mononuclear cell ratio, red blood cell concentration, hemoglobin concentration, spleen weight, hemoglobin gene expression level, innate immune gene and erythroid regulatory gene expression level; comparing the test results of mice administered with the drug to be screened and mice not administered with the drug to be screened, and evaluating whether the drug to be screened is a therapeutic drug for acute inflammatory anemia.

[0021] In some embodiments, if the test results of the mice administered with the drug to be screened show at least one change among a decreased proportion of peripheral blood mononuclear cells, an increased red blood cell concentration, an increased hemoglobin concentration, a decreased spleen weight, an increased hemoglobin gene expression, a decreased serum EPO level, a decreased serum TNF-α and IL-6 levels, a decreased innate immune gene expression, and an increased erythroid regulatory gene expression compared to the mice not administered with the drug to be screened, then the drug to be screened has a therapeutic effect on acute inflammatory anemia and is a candidate therapeutic drug for acute inflammatory anemia; if the test results remain unchanged or are contrary to the above results, then the drug to be screened is not a candidate therapeutic drug for acute inflammatory anemia.

[0022] Furthermore, the drugs to be screened include protein analogs, antibodies, DNA, RNA, and small molecule compounds.

[0023] Furthermore, the source of the small molecule compound is selected from: newly synthesized or existing databases; wherein the existing databases include but are not limited to general natural product databases (COCONUT, Super Natural II, NPASS), plant natural product databases (KNApSaCK, CMAUP, TriForC, Alkamid, NPACT DB, BioPhytMol), traditional Chinese medicine natural product databases (China TCM@Taiwan, CEMTDD, CHDD, ETCM, TM-MC, TCMID, YaTCM), microbial natural product databases (StreptomeDB, NP Altas, ProCarDB, PAMDB, Lichen Database), marine natural product databases (MNPD, SWMD), natural product databases of different countries and regions (IMPPAT, NeMedPlant, MedPServer, TlPdb, AfroDB, ANPDB, BIOFACQUIM, NUBBEDB), food natural product databases (FooDB, BitterDB, Phenol-Explorer, PhytoHub, SuperSweet database), toxic natural product databases (Exposome-Explorer, T3DB, Snake Neurotoxin Database, TPPT), natural product industry catalogs (Greenpharma, AnalytiConDiscovery, InterBioScreen, Indofine Chemical Company, Pi Chemicals Systems\Specs, TargetMol), databases for deduplication using MS data (MoNA, MassBank, METLIN, HMDB, YMDB, ReSpect, GNPS), databases for deduplication using NMR data (NMRShiftDB, NAPROC-13), etc.

[0024] Furthermore, the DNA includes single-stranded DNA, double-stranded DNA, circular DNA, and linked DNA.

[0025] Furthermore, the RNA includes mRNA, tRNA, rRNA, snRNA, hRNA, antisense RNA, tCRNA, dsRNA, SCRNA, RNA with catalytic activity, and various viral RNAs.

[0026] Furthermore, the drug to be screened includes various pharmaceutically acceptable salt forms.

[0027] Furthermore, the drugs to be screened include drugs used alone or in combination.

[0028] Furthermore, the pharmaceutical composition refers to a combination of the drug to be screened and a pharmaceutically acceptable carrier.

[0029] As used herein, the term "pharmaceutically acceptable" refers to compounds, materials, compositions, and / or dosage forms that are suitable for use in contact with human and animal tissues without excessive toxicity, irritation, allergic reaction, or other problems or complications, consistent with a reasonable benefit / risk ratio, within the scope of sound medical judgment. Suitable carriers can be large, slowly metabolized macromolecules such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, and amino acid copolymers. Such carriers are well known to those of ordinary skill in the art.

[0030] Advantages and beneficial effects of the present invention:

[0031] 1) The present invention can induce a significant decrease in red blood cell count and hemoglobin levels through a single Poly(I:C) stimulation for 36 hours, accurately simulating the time window of acute anemia.

[0032] 2) This invention clearly defines 36 hours as the threshold for acute anemia for the first time, providing a precise time point for drug screening and mechanism research of acute inflammatory anemia.

[0033] 3) The construction of the acute inflammatory anemia mouse model of the present invention lays a good foundation for the study of the mechanism of acute inflammatory anemia. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 Schematic diagram of the method for establishing an acute inflammatory anemia mouse model and statistical graphs of blood routine test results. (a) Schematic diagram of the method for establishing an acute inflammatory anemia mouse model, (b) statistical graph of the percentage of mononuclear cells in mouse peripheral blood, (c) statistical graph of red blood cell concentration, and (d) statistical graph of hemoglobin concentration.

[0035] Figure 2 This is a statistical chart of spleen weight in the acute inflammatory anemia mouse model.

[0036] Figure 3 This is a statistical chart of the hemoglobin gene (Hbb-b1 / bs / bt) expression levels in the acute inflammatory anemia mouse model.

[0037] Figure 4 This is a statistical chart of serum EPO levels in mice with acute inflammatory anemia.

[0038] Figure 5 This is a statistical chart of the levels of serum inflammatory factors TNF-α and IL-6 in mice with acute inflammatory anemia.

[0039] Figure 6The statistical chart shows the expression levels of innate immune genes (Rsad2, Isg15, Ifit1, Oas1a) in bone marrow-derived erythroid cells in the acute inflammatory anemia mouse model.

[0040] Figure 7 This is a statistical chart of the expression levels of erythroid regulatory genes (Eklf, Gata1, Nfe2, and Ldb1) in bone marrow-derived erythroid cells in an acute inflammatory anemia mouse model. DETAILED DESCRIPTION

[0041] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without making any creative efforts shall fall within the scope of protection of the present invention.

[0042] Example 1 Determining the critical time points for establishing an acute inflammatory anemia mouse model

[0043] 1. Experimental Materials

[0044] 1. Animal Types and Sources: Wild-type C57BL / 6J mice were purchased from the Institute of Laboratory Animal Science, Chinese Academy of Medical Sciences. All mice were maintained in the SPF animal laboratory of the Laboratory Animal Research Center, Institute of Basic Medicine, Chinese Academy of Medical Sciences, and their diet was provided by the Animal Center of the Academy of Military Medical Sciences. The animal care room operated on a 12-h light-dark cycle, with lights on from 7:00 AM to 7:00 PM daily and dark from 7:00 PM to 7:00 AM the following day. All animal experiments in this study were ethically reviewed by the Laboratory Animal Center of Peking Union Medical College, with the ethics review number being ACUC-A02-2015-001.

[0045] 2. Reagents and consumables: Poly(I:C) powder (Merck, product number Sigma-Aldrich P1530), Anti-Ter119 MicroBeads (Miltenyi Biotec, product number 130-049-901), magnetic columns (Miltenyi Biotec, product number 130-042-201), magnetic rack (Miltenyi Biotec, product number 130-042-108), rapid cell RNA extraction kit (Yishan Bio, product number RN001), reverse transcription reagent PrimeScript IV 1st strand cDNA Synthesis Mix (TAKARA, product number 6215A).

[0046] 2. Experimental Methods

[0047] 1. Intraperitoneal injection of Poly(I:C) into mice

[0048] Male mice aged 8-10 weeks and in good condition were used for the experiment. Mice were randomly divided into experimental group 1 (Poly(I:C) injected 12 hours later), experimental group 2 (Poly(I:C) injected 36 hours later), and control group (PBS injected), with 5 mice in each group. Poly(I:C) powder was weighed and dissolved in PBS to prepare a 2 mg / ml stock solution. After mixing, the mixture was sterilized with a 0.22 μm filter and stored in aliquots at -20°C. Using a 1 ml insulin syringe, mice were intraperitoneally injected with 12 mg / kg of Poly(I:C) at a point 5 mm lateral to the midline of the lower abdomen. The experimental group received an equal volume of PBS. Samples were collected 12 and 36 hours after injection for subsequent experiments.

[0049] 2. Routine peripheral blood test of adult mice

[0050] Prepare anticoagulant blood collection tubes: one day in advance, add the prepared PBS containing EDTA-2Na or heparin to a 1.5ml centrifuge tube, dry it at 56°C, and label it. Take the mouse to be tested, inject the anesthetic sodium pentobarbital according to its weight, and prepare the instruments at the same time. After the mouse faints, hold the mouse upside down with your left hand, gently press the skin to make the eyeball congested, and quickly remove the eyeball with surgical forceps in your right hand, and quickly collect the blood in a centrifuge tube. If the blood flows out slowly, gently press the mouse's abdominal cavity and chest cavity to increase the amount of blood collected. Quickly invert the collected blood to mix it evenly to ensure the effect of the anticoagulant. The blood sample is sent to the Institute of Laboratory Animals, Chinese Academy of Medical Sciences for routine blood index testing. The time from collection to testing is within 5 hours, and the temperature is maintained at 4-10°C during transportation.

[0051] 3. Mouse spleen removal

[0052] Mice were sacrificed by cervical dislocation and sprayed with 75% alcohol for disinfection. The lower abdominal skin was lifted with surgical forceps. A 1 cm transverse incision was made with scissors along the ventral midline toward the xiphoid process to remove the spleen. The spleen was supported on filter paper moistened with pre-chilled PBS, and the pancreatic tissue was gently dissected to prevent any residual adhesions. The pancreas was weighed using a 1 / 10,000 electronic balance, reset to zero.

[0053] 4. Mouse bone marrow-derived erythroid cells (Ter119 + Cell separation

[0054] Use surgical forceps to grasp the mouse's inguinal skin, cut the skin along the groin line, and remove the femur below the pelvis. After securing the injection needle, use surgical forceps and gauze to dissect the muscle from the femur to obtain a relatively clean femur. Carefully cut the ends of the tibia to allow the needle of a 1 ml syringe to be inserted into the tibia. Rinse the tibial cavity with PBS and collect the rinsate (Note: rinse the cavity until it becomes transparent or whitish). Use a pipette to disperse bone marrow cells from the rinsate, filter through a 40 μm membrane, and centrifuge at 300 g for 10 minutes. Resuspend the rinsate in 1 ml of PBS, count the cells, and incubate the cells in a 1.5 ml microcentrifuge tube with mouse TER119 magnetic beads (Anti-Ter119 MicroBeads). Incubate in the dark at 4-8°C for 15 minutes, then wash twice with 1 ml of pre-chilled PBS / 2 mM EDTA / 0.5% BSA. After centrifugation, add 500 μl PBS / 2 mM EDTA / 0.5% BSA to rinse the magnetic column and pass the resuspended cells through the column. Wash the magnetic column with 500 μl PBS / 2 mM EDTA / 0.5% BSA for three times, and then remove the TER119 adsorbed in the column with 500 μl PBS / 2 mM EDTA / 0.5% BSA. + Cells were collected by centrifugation.

[0055] 5. Extraction, reverse transcription and real-time fluorescence quantitative PCR (qPCR) of total cell RNA

[0056] The total RNA of erythroid cells was extracted using a cell RNA rapid extraction kit. The collected erythroid cells (about 5x10 6Resuspend (100 cells) in 1 ml of PBS, centrifuge at 1000 rpm at 4°C for 5 min, and discard the supernatant. Add 500 μl of Lysis Buffer and lyse the cells by pipetting vigorously 10 times or vortexing for 10 seconds. Add an equal volume (500 μl) of anhydrous ethanol, mix thoroughly, and transfer the column to an RNA spin column in two batches. Centrifuge at 12,000 g for 1 min at room temperature and discard the liquid. At this point, the RNA has bound to the membrane in the center of the column. After discarding the flow-through, turn the collection tube downward and remove any remaining liquid from the tube with absorbent paper. Add 500 μl of wash buffer to the column and centrifuge at 12,000 g at 4°C for 1 min. Discard the flow-through and remove any remaining liquid from the tube with absorbent paper. Centrifuge at 12,000 g at 4°C for 1 min to thoroughly remove any remaining liquid. Discard the collection tube and transfer the spin column to an RNase-free 1.5 ml EP tube. Open the cap and let it air dry for 2 min. Add 30 μl of Elution Buffer to the membrane in the center of the spin column. Incubate at room temperature for 2 minutes. Centrifuge at 12,000 g at 4°C for 1 minute to obtain the RNA solution. Determine RNA concentration and purity using a Nanodrop UV spectrophotometer. Store the extracted RNA at -80°C.

[0057] Total cellular RNA was reverse transcribed and cDNA synthesized using PrimeScript IV 1st strand cDNA Synthesis Mix. Based on the total amount of RNA obtained, a total of 2 μg of reverse transcription was prepared and diluted to 14 μl with DEPC water. Then, 4 μl of 5× PrimeScript IV cDNA Synthesis Mix and 2 μl of Random 6 mers (50 μM) were added to prepare a 20 μl reverse transcription system. The system was mixed thoroughly and placed in a metal bath. The reaction program was set: incubate at 30°C for 10 min, incubate at 42°C for 15 min, and incubate at 95°C for 5 min to inactivate the enzyme. The sample was then cooled on ice and stored in a -20°C refrigerator.

[0058] To 20 μl of 2 μg of reverse transcription product, add 380 μl of ddH₂O to dilute the cDNA to 5 ng / μl, which will serve as a template for subsequent real-time fluorescence quantitative analysis. For each reaction, prepare the qPCR system: aspirate 2 μl of cDNA as template, add 10 μl of SYBR Green Master Mix, 1 μl of each upstream and downstream primer (10 μM), and 6 μl of distilled water, mix well, and centrifuge. Samples were transferred to a 96-well plate, and three replicates were performed for each tube. The real-time quantitative PCR instrument used was a BioRad CFX96. The qPCR program was as follows: 40 cycles of amplification at 95°C for 10 s, 60°C for 30 s, and 72°C for 30 s, followed by melting curve analysis.

[0059] qPCR detection was performed using the forward primer sequence for Ms Hbb-b1 / bs / bt (mouse adult hemoglobin gene): TTTAACGATGGCCTGAATCACTT (SEQ ID NO: 1), and the reverse primer sequence: CAGCACAATCACGATCATATTGC (SEQ ID NO: 2). The forward primer sequence for Ms GAPDH (mouse internal reference gene): TGTAGACCATGTAGTTGAGGTCA (SEQ ID NO: 3), and the reverse primer sequence: AGGTCGGTGTGAACGGATTTG (SEQ ID NO: 4). mRNA levels were measured using the cycle CT value, with GAPDH mRNA expression as the internal reference for relative quantification.

[0060] 3. Experimental Results

[0061] Figure 1 Figure a is a schematic diagram of the construction of an acute inflammatory mouse model. Samples were collected for testing 12 hours (experimental group 1) and 36 hours (experimental group 2) after intraperitoneal injection of Poly(I:C) into the mice.

[0062] Figure 1 b, c, d, and Tables 1-3 show the results of routine peripheral blood tests of mice, where Table 1 is the control group, Table 2 is the experimental group 1, and Table 3 is the experimental group 2. P values ​​were all calculated using Students' t test, and data are expressed as mean ± standard error, n = 5. Figure 1 As shown in b, c, and d, compared with the control group, the proportion of monocytes in experimental groups 1 and 2 was significantly increased, the red blood cell content in experimental group 1 had no statistically significant difference from that in the control group, while the red blood cell concentration and hemoglobin concentration in experimental group 2 decreased significantly, which was consistent with the acute anemia phenotype.

[0063] Table 1. Blood routine test results of the control group

[0064]

[0065]

[0066] Table 2. Blood routine test results of experimental group 1

[0067]

[0068]

[0069] Table 3. Blood routine test results of experimental group 2

[0070]

[0071]

[0072] Figure 2 Figure 3. Changes in mouse spleen weights. P values ​​were compared using the Student's t test. Data are presented as mean ± standard error (SEM). n = 5. There was no significant difference in spleen weight between the control group and experimental group 1; however, spleen weight was significantly increased in experimental group 2 (P = 0.0039), indicating that the acute inflammatory response led to significant splenic congestion and enlargement, consistent with immune activation and extramedullary hematopoietic stress.

[0073] Figure 3 This study shows the expression levels of hemoglobin genes (Hbb-b1 / bs / bt) in mouse bone marrow-derived erythroid cells. P values ​​were determined using the Student's t test. Data are presented as mean ± standard error (SE). n = 5. The overall expression levels of the hemoglobin gene cluster (Hbb-b1, Hbb-bs, and Hbb-bt) in adult mice were measured and normalized using GAPDH as an internal control. Results showed no significant difference in hemoglobin gene expression in experimental group 1 compared with the control group, while hemoglobin gene expression was significantly suppressed in experimental group 2 (P < 0.0001), with the relative expression level dropping to approximately 0.4. This suggests that inflammatory factors accelerate the blockage of erythropoiesis by suppressing the expression of key genes for erythroid differentiation.

[0074] Example 2 Validation of the acute inflammatory anemia mouse model

[0075] 1. Experimental Materials

[0076] Mouse Erythropoietin / EPO Quantikine ELISA Kit (R&D Systems, Product No. MEP00B), Mouse TNF-alpha Quantikine ELISA Kit (R&D Systems, Product No. MTA00B), Mouse IL-6 Quantikine ELISA Kit (R&D Systems, Product No. D6050B).

[0077] 2. Experimental Methods

[0078] 1. Detection of EPO levels, inflammatory factors TNF-α, and IL-6 levels in mouse serum

[0079] Thirty-six hours after intraperitoneal injection of Poly(I:C) or PBS, mice were anesthetized with sodium pentobarbital. Approximately 0.5 mL of whole blood was collected from the retroorbital venous plexus and placed in anticoagulant tubes containing EDTA-2Na or heparin. The blood was allowed to stand at 4°C for 30 minutes before centrifugation at 2000 g for 20 minutes at 4°C. The supernatant serum was separated, aliquoted, and stored at -80°C until use, avoiding repeated freeze-thaw cycles. All reagents in the ELISA kit were equilibrated at room temperature for 30 minutes prior to the experiment. Reconstitute the lyophilized EPO, TNF-α, and IL-6 standards with the corresponding Calibrator Diluent. Let stand for 5 minutes, then gently mix to obtain a high-concentration stock solution of 3000 pg / mL (EPO, IL-6) or 7000 pg / mL (TNF-α). Subsequently, perform a two-fold serial dilution with Calibrator Diluent (starting at 300 pg / mL for EPO and IL-6, and 700 pg / mL for TNF-α) for a total of seven concentration points. A zero-concentration blank control should also be included. Gently mix the Mouse Epo Conjugate (EPO), Mouse TNF-α Conjugate (TNF-α), or Human IL-6 Conjugate (IL-6) by inversion to avoid foaming. Dilute 25x Wash Buffer Concentrate to a 1x working solution with deionized water (e.g., add 480 mL of deionized water to 20 mL of concentrate) and mix thoroughly for later use. Mix Color Reagent A (H₂O₂) and Color Reagent B (TMB) in a 1:1 ratio by volume. Use within 15 minutes and store in the dark. Remove the 96-well antibody-coated microplate and set up blank, standard, and sample wells. Add 50 μL of Assay Diluent to each well, followed by 50 μL of a series of standards or a serum sample diluted 1:2 (using the corresponding Calibrator Diluent). Gently tap the plate frame for 1 minute to mix thoroughly, then cover with a sealing film and incubate at room temperature on a horizontal microplate shaker for 2 hours. Discard the liquid in the wells and add 400 μL of 1× Wash Buffer to each well. Let stand for 30 seconds, then discard the liquid and pat dry with absorbent paper. Repeat four times for a total of five times to ensure complete removal of any residual liquid. Add 100 μL of the corresponding enzyme conjugate to each well, cover with a new sealing film, and incubate at room temperature for 2 hours. Wash again five times as in step 4 and pat dry. Add 100 μl of freshly prepared Substrate Solution to each well and incubate at room temperature, protected from light, for 30 minutes. The wells will gradually change color from colorless to blue. Add 100 μl of Stop Solution to each well in the order in which the color development solutions were added. Gently tap the plate frame to mix thoroughly. The blue color will immediately turn yellow. Within 30 minutes, measure absorbance using a microplate reader at 450 nm, with a calibration wavelength of 540 nm or 570 nm. Fit the standard curve to calculate the concentration of each sample.If the sample is diluted, multiply the result by the dilution factor.

[0080] 2. Detection of mouse bone marrow-derived erythroid cells (Ter119 + Expression of innate immune genes and erythroid regulatory genes in

[0081] The specific experimental steps for extracting total cell RNA, reverse transcription, and qPCR were the same as above. The primer sequences used in the qPCR assay are as follows:

[0082]

[0083] 3. Experimental Results

[0084] Figure 4 This study shows serum EPO levels in a mouse model of acute inflammatory anemia. P values ​​were compared using the Student's t test. Data are presented as mean ± standard error (SEM). N = 4. Results showed that serum EPO levels were significantly elevated in the Poly(I:C) 36-hour group compared with the control group (P = 0.0001). This result suggests that in acute inflammatory anemia, although the body initiates compensatory EPO secretion, it is unable to overcome the erythroid suppression and red blood cell destruction mediated by inflammatory factors, resulting in an anemic phenotype characterized by a significant decrease in hemoglobin levels.

[0085] Figure 5 Figures show serum inflammatory cytokine levels (TNF-α and IL-6) in a mouse model of acute inflammatory anemia. P values ​​were compared using the Student's t test. Data are presented as mean ± standard error (SEM). N = 4. Serum TNF-α levels were significantly elevated in the Poly(I:C) injection group 36 hours after injection compared with the PBS control group (P = 0.0006). Serum IL-6 levels were also significantly elevated (P = 0.0008), indicating that TNF-α and IL-6 synergistically participate in the acute inflammatory response and mediate the development of inflammatory anemia.

[0086] Figure 6 Figure 3. Changes in mRNA levels of innate immune genes (Rsad2, Isg15, Ifit1, and Oas1a) in bone marrow-derived erythroid cells from mice with acute inflammatory anemia. P values ​​were calculated using the Student's t test. Data are presented as mean ± standard error (SE). n = 4. Expression of these genes increased significantly 36 hours after Poly(I:C) injection, indicating that Poly(I:C) rapidly induces widespread activation of the type I interferon pathway by mimicking viral double-stranded RNA signaling.

[0087] Figure 7Figure 3. Changes in mRNA levels of erythroid regulatory genes (Eklf, Gata1, Nfe2, and Ldb1) in bone marrow-derived erythroid cells from mice with acute inflammatory anemia. P values ​​were calculated using the Student's t test. Data are presented as mean ± standard error (SE). n = 4. Expression of these genes was significantly suppressed 36 hours after Poly(I:C) injection, indicating a direct inhibition of terminal differentiation of erythroid progenitor cells and hemoglobin synthesis.

[0088] This study first discovered that a single 36-hour Poly (I:C) stimulation can induce acute inflammatory anemia in mice, and confirmed through 12-hour negative control data that 36 hours is a critical time point. The mouse model provided by this invention can accurately simulate the acute anemia time window, laying a good foundation for the study of the mechanism of acute inflammatory anemia.

[0089] Example 3 Screening Method for Treating Acute Inflammatory Anemia

[0090] First, the acute inflammatory anemia mice obtained by the method described in Example 1 were randomly divided into a model group and a drug administration group. The drug to be screened was administered to the drug administration group, and PBS was administered to the control group.

[0091] Secondly, at least one indicator related to acute inflammatory anemia among the peripheral blood monocyte ratio, red blood cell concentration, hemoglobin concentration, spleen weight, hemoglobin gene expression, innate immune gene and erythroid regulatory gene expression of each group of mice was detected.

[0092] Finally, the test results of the mice in the drug treatment group and the mice in the model group were compared, and the test results were used to evaluate whether the drug to be screened is a therapeutic drug for acute inflammatory anemia.

[0093] The specific evaluation criteria for the screening method for the treatment of acute inflammatory anemia are: if, compared with the mice in the model group, the test results of the mice in the administration group show at least one change among a decreased proportion of peripheral blood mononuclear cells, an increased red blood cell concentration, an increased hemoglobin concentration, a decreased spleen weight, an increased hemoglobin gene expression, a decreased serum EPO level, a decreased serum TNF-α and IL-6 levels, a decreased innate immune gene expression, and an increased erythroid regulatory gene expression, then the drug to be screened has a therapeutic effect on acute inflammatory anemia and is a candidate drug for the treatment of acute inflammatory anemia; if the test results remain unchanged or are contrary to the above results, then the drug to be screened is not a candidate drug for the treatment of acute inflammatory anemia.

[0094] The above embodiments are only provided for understanding the method and core concept of the present invention. It should be noted that, without departing from the principles of the present invention, a number of improvements and modifications may be made to the present invention by a person skilled in the art, and such improvements and modifications shall fall within the scope of protection of the claims of the present invention.

Claims

1. A method for constructing a mouse model of inducing acute inflammatory anemia, characterized in that: The steps of the construction method include administering Poly(I:C) to mice once, and the model is completed after 36 hours.

2. The construction method according to claim 1, characterized in that The administration dose of Poly(I:C) was 12 mg / kg.

3. The construction method according to claim 1, characterized in that The administration method of the Poly(I:C) is intraperitoneal injection.

4. The construction method according to claim 1, characterized in that The mice are C57BL / 6J mice.

5. A mouse model obtained by the construction method according to any one of claims 1 to 4.

6. Application of the mouse model obtained by the construction method according to any one of claims 1 to 4 in the study of the pathogenesis of acute inflammatory anemia.

7. Use of the mouse model obtained by the construction method according to any one of claims 1 to 4 in screening therapeutic drugs for acute inflammatory anemia.

8. A method for screening therapeutic drugs for acute inflammatory anemia, characterized in that: The steps of the method include: administering a drug to be screened to the mouse model obtained by the construction method according to any one of claims 1 to 4; Detecting at least one indicator of the mouse peripheral blood mononuclear cell ratio, red blood cell concentration, hemoglobin concentration, spleen weight, hemoglobin gene expression, serum erythropoietin level, serum inflammatory factor TNF-α, serum inflammatory factor IL-6 level, innate immune gene and erythroid regulatory gene expression; Compare the test results of mice administered with the drug to be screened and mice not administered with the drug to be screened to evaluate whether the drug to be screened is a therapeutic drug for acute inflammatory anemia.

9. The method according to claim 8, characterized in that The drugs to be screened include protein analogs, antibodies, DNA, RNA, and small molecule compounds.

10. The method according to claim 8, characterized in that The drugs to be screened include drugs used alone or in combination.

Images