Kit and device for detecting acinetobacter baumannii

Abstract

The invention discloses a kit and a device for detecting acinetobacter baumannii. The kit comprises a first primer, a second primer, recombinase polymerase, Cas12a protein, crRNA and ssDNA, wherein the sequence of the first primer is as shown in SEQ ID NO.1; the sequence of the second primer is as shown in SEQ ID NO. 2; the sequence of the crRNA is as shown in SEQ ID NO.3, the crRNA is modified with a light-sensitive chemical group for preventing the combination of the crRNA and target nucleic acid, and the light-sensitive chemical group falls off from the crRNA when irradiated by light with a predetermined wavelength; the sequence of the ssDNA is as shown in SEQ ID NO.4, one end of the ssDNA is modified with a fluorophore, and the other end of the ssDNA is modified with a quenching group. By adopting the kit or the device provided by the invention, the acinetobacter baumannii can be accurately detected, the working efficiency can be improved, and the risk of cross contamination can be reduced.

Description

Technical Field

[0001] The present application relates to the field of biotechnology, and in particular to a kit and device for detecting Acinetobacter baumannii. Background Art

[0002] Acinetobacter baumannii (A.baumannii) is a common pathogen in hospitals. This pathogen has a strong adaptability and can survive for a long time on inanimate surfaces. It is mainly transmitted through the hospital environment, medical staff and medical equipment, so it is called a "hospital superbug." Acinetobacter baumannii can inhabit the respiratory tract, urinary tract and skin. In people with weakened immunity or skin injuries, it can multiply rapidly and secrete bacterial toxins, causing local inflammatory reactions at the site of infection. This pathogen is associated with a variety of infections, including respiratory tract infections, bloodstream infections, urinary tract infections, intracranial infections, and skin and soft tissue infections. Therefore, rapid and accurate detection of Acinetobacter baumannii is of great significance for personal infection prognosis and public health.

[0003] Currently, common methods for detecting Acinetobacter baumannii include bacterial culture, mass spectrometry identification, and polymerase chain reaction (PCR). Bacterial culture is recognized as the gold standard for bacterial diagnosis and is widely accepted in medical institutions, but detailed culture has a long turnaround time (2-3 days) and cumbersome procedures. Mass spectrometry-based identification is simple, rapid, accurate, and high-throughput, but requires the establishment of a microbial protein fingerprint database. PCR offers high sensitivity and specificity, but requires specialized equipment, stringent thermal cycling conditions (thermal cycling is required to achieve nucleic acid denaturation, annealing, and extension), skilled technicians, and a well-maintained laboratory environment. Isothermal amplification molecular diagnostic techniques, such as recombinase polymerase amplification (RPA), offer the advantage of being "isothermal" compared to traditional PCR, using recombinase, polymerase, and single-stranded binding proteins to rapidly amplify target genes at a constant temperature (typically between 37-42°C). In recent years, the CRISPR / Cas system has been widely applied in gene editing, single nucleotide polymorphisms, pathogenic microbiology, exosome research, and cancer research, providing new insights and methods for the development of molecular diagnostic technologies. The CRISPR / Cas system, with its powerful single-base recognition and trans-cleavage activity, is often combined with various nucleic acid amplification technologies. The combination of RPA and the CRISPR / Cas system can significantly improve diagnostic specificity and sensitivity.

[0004] However, most CRISPR-based nucleic acid diagnostic platforms currently developed involve multiple steps and spatial transfer, with target amplification and CRISPR detection performed in different test tubes, which not only complicates the procedure and reduces work efficiency, but also increases the risk of cross-contamination. Summary of the Invention

[0005] To solve the above problems, the present application provides a kit and device for detecting Acinetobacter baumannii.

[0006] This application adopts the following technical solutions:

[0007] In the first aspect of the present application, a kit for detecting Acinetobacter baumannii is disclosed, comprising a first primer, a second primer, a recombinase polymerase, a Cas12a protein, crRNA and ssDNA, wherein: the sequence of the first primer is shown in SEQ ID NO.1; the sequence of the second primer is shown in SEQ ID NO.2; the sequence of the crRNA is shown in SEQ ID NO.3, the crRNA is modified with a photosensitive chemical group that prevents the crRNA from binding to the target nucleic acid, and the photosensitive chemical group falls off from the crRNA when irradiated with light of a predetermined wavelength; the sequence of the ssDNA is shown in SEQ ID NO.4, one end of the ssDNA is modified with a fluorescent group and the other end is modified with a quenching group.

[0008] In one implementation of the present application, the kit further includes dNTPs, buffer, Mg 2+ and at least one of ddH2O.

[0009] In one implementation of the present application, the predetermined wavelength is 100 nm to 400 nm.

[0010] In one implementation of the present application, the photosensitive chemical group is deoxythymidine modified with a photosensitive protective group (NPOM-dt).

[0011] In a second aspect, the present application discloses a device for detecting Acinetobacter baumannii, comprising: an amplification module for subjecting a nucleic acid sample to be tested and a first primer and a second primer to recombinase polymerase amplification, wherein the amplification system of the recombinase polymerase amplification further contains a recombinase polymerase, a Cas12a protein, crRNA and ssDNA; wherein the sequence of the first primer is shown in SEQ ID NO.1; the sequence of the second primer is shown in SEQ ID NO.2; the sequence of the crRNA is shown in SEQ ID NO.3, the crRNA is modified with a photosensitive chemical group that prevents the crRNA from binding to the target nucleic acid, and the photosensitive chemical group falls off from the crRNA when irradiated with light of the predetermined wavelength; the sequence of the ssDNA is shown in SEQ ID NO.4, one end of the ssDNA is modified with a fluorescent group and the other end is modified with a quenching group; an illumination module for irradiating the amplification system of the recombinase polymerase amplification with light of the predetermined wavelength; and a result interpretation module for judging whether the sample to be tested contains Acinetobacter baumannii according to the fluorescence value.

[0012] In one implementation of the present application, in the amplification system of the recombinase polymerase amplification, the concentration of the first primer or the second primer is 400nM to 500nM; preferably, in the amplification system of the recombinase polymerase amplification, the concentration of the first primer or the second primer is 440nM.

[0013] In one implementation of the present application, the amplification time of the recombinase polymerase amplification is 20 minutes to 30 minutes; preferably, the amplification time of the recombinase polymerase amplification is 25 minutes.

[0014] In one implementation of the present application, in the amplification system of the recombinase polymerase amplification, the concentration of the Cas12a is 180nM to 420nM; preferably, in the amplification system of the recombinase polymerase amplification, the concentration of the Cas12a is 340nM.

[0015] In one implementation of the present application, in the amplification system of the recombinase polymerase amplification, the concentration of the crRNA is 180nM to 420nM; preferably, in the amplification system of the recombinase polymerase amplification, the concentration of the crRNA is 340nM.

[0016] In one implementation of the present application, in the illumination module, the illumination time is 90 seconds to 120 seconds.

[0017] The beneficial effects of this application are:

[0018] In the present application, the designed primer set (first primer and second primer) and crRNA have excellent amplification efficiency and CRISPR / Cas12a system shearing efficiency, and can accurately detect Acinetobacter baumannii; can be amplified under isothermal conditions, easy to operate, and low equipment requirements; the crRNA in the CRISPR-Cas12a system is modified using a light-sensitive chemical group, which can prevent crRNA from base pairing with the target fragment produced by amplification, temporarily silencing the CRISPR-Cas12a system, and can effectively separate the pre-amplification and signal recognition processes at the time level. The entire detection process can be performed in one tube without opening the tube, reducing aerosol contamination caused by opening the tube or reduced efficiency caused by frequent addition of reagents. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 It is a schematic diagram of the principle of detecting Acinetobacter baumannii involved in this application.

[0020] Figure 2 The figure shows the result of the component omission experiment involved in the examples of the present application.

[0021] Figure 3 The figure shows the experimental results of different light sources involved in the embodiments of the present application.

[0022] Figure 4 The figure shows the result of the reaction condition optimization experiment involved in the examples of the present application.

[0023] Figure 5 The results of sensitivity and specificity involved in the examples of the present application are shown in the figure.

[0024] Figure 6 The figure shows the test results of the clinical samples involved in the embodiments of the present application. DETAILED DESCRIPTION

[0025] The present invention is further described in detail below by specific embodiments in conjunction with the accompanying drawings. In the following embodiments, many detailed descriptions are intended to enable the present application to be better understood. However, those skilled in the art can readily appreciate that some of the features may be omitted in different circumstances, or may be replaced by other materials or methods. In some cases, some operations related to the present application are not shown or described in the specification. This is to avoid the core of the present application being overwhelmed by excessive descriptions, and for those skilled in the art, it is not necessary to describe these related operations in detail. They can fully understand the related operations based on the description in the specification and the general technical knowledge in the art.

[0026] In addition, the features, operations, or characteristics described in the specification may be combined in any appropriate manner to form various embodiments. Furthermore, the steps or actions in the method description may be reordered or adjusted in a manner readily apparent to those skilled in the art. Therefore, the various sequences in the specification and drawings are provided solely for the purpose of clearly describing a particular embodiment and are not intended to be mandatory, unless otherwise specified.

[0027] The present application provides a kit and device for detecting Acinetobacter baumannii, which can also be called a "one-tube RPA-CRISPR / Cas12a detection system based on light activation". The present application can solve the problem of multi-step operation or multi-step detection required in the prior art, reduce the complexity of operation, improve detection efficiency, and is more suitable for local resource medical and health institutions, providing a new perspective for the development of home diagnostic kits. In addition, the present application can quickly and sensitively identify Acinetobacter baumannii. The kit or device of the present application operates under isothermal conditions (37°C) and can detect target fragments with a concentration as low as 10 copies / μL, and has no cross-reaction with six other common clinical pathogens. The main advantages of this detection system are low cost and low equipment requirements, and it can help eliminate the risk of aerosol contamination caused by repeated opening and transferring of tubes. In addition, it simplifies the workflow and is particularly suitable for resource-limited environments, providing a new method for promoting bedside diagnosis and rapid detection solutions.

[0028] The test kit or device of the present application uses the OXA-51 gene as a target. It should be noted that traditional bacterial identification usually selects 16sRNA as an identification target, but this usually has the following problems: 1. The 16S rRNA gene is a conserved gene shared by almost all bacteria, and bacteria are classified and identified by subtle sequence differences. However, the sequence similarity of Acinetobacter baumannii and other closely related strains (such as the baumannii subgroup or related species) on the 16S rRNA gene is high, and a slight inappropriateness in designing primers can easily lead to false positives or insufficient detection specificity; 2. Although the 16S rRNA gene can identify bacterial species, it is not directly related to antibiotic resistance and is difficult to provide information on the prediction of drug resistance phenotypes or guiding treatment. The present application selects OXA-51 as a target, which has the following advantages: 1. The OXA-51 gene is a β-lactamase gene unique to Acinetobacter baumannii. As its species-specific marker, it is widely present in Acinetobacter baumannii, and its sequence conservation is high. Therefore, selecting OXA-51 as a target can significantly improve the specificity of detection and effectively avoid non-specific detection of other species.

[0029] The key point of this application lies in the design of primers and crRNA. Appropriate primers and crRNA ensure their amplification efficiency and the cleavage efficiency of the CRISPR / Cas12a system. Secondly, the modification of crRNA with photosensitive groups is also crucial. The crRNA modified with photosensitive groups can destroy the base complementary pairing between crRNA and the target chain, indirectly silencing the CRISPR / Cas12a system temporarily, ensuring the smooth progress of RPA pre-amplification. After the amplification is completed, its activity can be fully restored by irradiation with UV light.

[0030] The present embodiment relates to a kit for detecting Acinetobacter baumannii (hereinafter sometimes referred to as a "detection kit" or "kit") and a device for detecting Acinetobacter baumannii (hereinafter sometimes referred to as a "detection device" or "device").

[0031] In a specific embodiment, the detection kit may include a primer set for amplifying the OXA-51 gene, which is used to amplify and generate a target nucleic acid. The primer set includes a first primer (forward primer) and a second primer (reverse primer).

[0032] In a specific embodiment, the first primer sequence may be as shown in SEQ ID NO. 1 (5'-TAAGGCAACCACCACAGAAGTATTTAAG-3'), and the second primer sequence may be as shown in SEQ ID NO. 2 (5'-CCTCTTGCTGAGGAGTAATTTTTAAAGG-3').

[0033] In a specific embodiment, the detection kit may include crRNA that recognizes the OXA-51 gene.

[0034] In a specific embodiment, crRNA can be modified with a light-sensitive chemical group that prevents crRNA from binding to the target nucleic acid. Thus, the CRISPR-Cas12a system can be silenced by the light-sensitive chemical group.

[0035] In one embodiment, the photosensitive chemical group is detached from the crRNA when irradiated with light of a predetermined wavelength. Thus, the photosensitive group can be detached from the crRNA by irradiating it with light of a specific wavelength, thereby activating the CRISPR-Cas12a system.

[0036] In a specific embodiment, the predetermined wavelength may be 100 nm to 400 nm.

[0037] In a specific embodiment, the predetermined wavelength may be 365 nm.

[0038] In one embodiment, the photosensitive chemical group is deoxythymidine modified with a photosensitive protecting group.

[0039] In a specific embodiment, the number of light-sensitive chemical groups in each crRNA can be 1 to 5.

[0040] In a specific embodiment, the crRNA sequence that recognizes the OXA-51 gene can be shown as SEQ ID NO. 3 (UAAUUUCUACUAAGUGUAGAUGCUCGUCGUAUUGGACUUGA).

[0041] In one embodiment, three photosensitive protective group-modified deoxythymidines are modified at bases 22, 24, and 29 of the crRNA (UAAUUUCUACUAAGUGUAGAUGCUCGUCGUAUUGGACUUGA) sequence. This modification has better photostability and is only allowed to fall off under 365nm ultraviolet light, but not under other lighting conditions.

[0042] In one embodiment, the detection kit may include a single-stranded DNA reporter molecule (ssDNA).

[0043] In one embodiment, one end of the single-stranded DNA reporter molecule is labeled with a fluorescent group, and the other end is labeled with a quencher group.

[0044] In a specific embodiment, the fluorescent group can be selected from but not limited to FAM, FITC, HEX, VIC, TET, JOE, ROX, CY3, CY5 and CY7.

[0045] In a specific embodiment, the quencher group can be selected from but not limited to BHQ1, BHQ2, BHQ3 and DABCYL.

[0046] In a specific embodiment, the sequence of the single-stranded DNA reporter molecule can be shown as SEQ ID NO. 4 (TTATT).

[0047] In a specific embodiment, the composition of the single-stranded DNA reporter molecule can be 5'-FAM-TTATT-BHQ1-3'.

[0048] In a specific embodiment, the detection kit may further include Cas12a protein, recombinase, single-stranded DNA binding protein, dNTPs, buffer, Mg 2+ and at least one of ddH2O.

[0049] In a specific embodiment, the detection kit may further include a bacterial genome extraction kit.

[0050] In a specific embodiment, the detection kit may include a positive control and a negative control.

[0051] Figure 1 This is a schematic diagram of the principle of detecting Acinetobacter baumannii involved in this application. Figure 1 As shown, the detection process of the kit of the present application may include: obtaining bacterial DNA; a one-tube reaction of PRA and CRISPR-Cas12a; and signal reading. The bases of crRNA can be modified with light-sensitive chemical groups. When irradiated with a specific wavelength (e.g., 365nm ultraviolet light), the light-sensitive chemical groups fall off, and the CRISPR-Cas12a system is activated and emits fluorescence.

[0052] In a specific embodiment, the detection device can use the above-mentioned detection kit for detection.

[0053] In a specific embodiment, the detection device may include a nucleic acid extraction module.

[0054] In a specific embodiment, the nucleic acid extraction module can use a bacterial DNA extraction kit to extract bacterial DNA. The extracted nucleic acid sample can be used for the next test, and the unused nucleic acid sample can be stored at -80°C.

[0055] In a specific embodiment, the sample type to be tested may be at least one of a bacterial culture sample, a sputum sample, a blood sample, a urine sample, a wound secretion sample, a pleural effusion sample, a cerebrospinal fluid sample, and an ascites sample.

[0056] In a specific embodiment, the detection device may include an amplification module.

[0057] In a specific embodiment, the amplification module may include amplifying the nucleic acid sample to be tested.

[0058] In a specific embodiment, the amplification module may include using a first primer and a second primer to amplify the nucleic acid sample to be tested.

[0059] In a specific embodiment, the amplification module can be amplified using recombinase polymerase amplification (RPA amplification).

[0060] In a specific embodiment, in the RPA amplification system, the concentration of the first primer or the second primer may be 400 nM to 500 nM. Preferably, in the RPA amplification system, the concentration of the first primer or the second primer may be 440 nM.

[0061] In a specific embodiment, in the RPA amplification system, the amplification time may be 20 minutes to 30 minutes. Preferably, in the RPA amplification system, the amplification time may be 25 minutes.

[0062] In a specific embodiment, in the RPA amplification system, the concentration of Cas12a can be 180nM to 420nM. Preferably, in the RPA amplification system, the concentration of Cas12a can be 340nM.

[0063] In a specific embodiment, in the RPA amplification system, the concentration of crRNA can be 180nM to 420nM. Preferably, in the RPA amplification system, the concentration of crRNA can be 40nM.

[0064] In a specific embodiment, the detection device may include a light irradiation module configured to irradiate the amplification system of the recombinase polymerase amplification with light of a predetermined wavelength.

[0065] In a specific embodiment, in the illumination module, the illumination time may be 90 seconds to 120 seconds.

[0066] In a specific embodiment, the detection device may include a result interpretation module configured to determine whether the tested sample contains Acinetobacter baumannii based on the fluorescence value.

[0067] The present invention is further described in detail below by means of specific examples. The following examples are only provided to further illustrate the present invention and should not be construed as limiting the present invention. In the present examples, unless otherwise specified, the kits and instruments used are all commercially available, and the experimental procedures are carried out in accordance with the product instructions and conventional experimental specifications.

[0068] Example:

[0069] (1) Nucleic acid extraction:

[0070] For pure cultured bacteria, the genomic DNA of the bacteria was extracted by direct boiling. Specifically, the strains were collected in EP tubes, washed twice with PBS, centrifuged at 13000g for 2min, and the supernatant was discarded. Subsequently, TE buffer (100 μL) was introduced and then boiled for 10 minutes. The supernatant was then collected by centrifugation at 13000g for 5min. All DNA templates were stored at -20°C before use in subsequent experiments.

[0071] For sputum specimens, first mix 5% sodium hydroxide (NaOH) with the sputum in a 1:1 ratio. Vortex to mix thoroughly, then let the sample stand at room temperature for 30 minutes to dissolve the sputum. After 30 minutes, transfer 100 μL of the sample to a clean tube, centrifuge at 13,000 g for 2 minutes, and discard the supernatant. Rinse with an equal volume of PBS to the pellet, repeating this process three times. Add TE buffer, mix thoroughly, and boil for 10 minutes. Centrifuge at 13,000 g for 2 minutes, and collect the supernatant for later use.

[0072] (2) Primers and crRNA:

[0073] Using the OXA-51 gene as the target, the sequences of the RPA primers were: 5'-TAAGGCAACCACCACAGAAGTATTTAAG-3' (SEQ ID NO.1, forward primer) and 5'-CCTCTTGCTGAGGAGTAATTTTTAAAGG-3' (SEQ ID NO.2, reverse primer). The sequence of crRNA was: UAAUUUCUACUAAGUGUAGAUGCUCGUCGUAUUGGACUUGA (SEQ ID NO.3); the sequence of ssDNA was: 5'-FAM-TTATT-BHQ1-3' (SEQ ID NO.4). In addition, in order to obtain crRNA modified with a photosensitive chemical group, three photosensitive protective group-modified deoxythymidines were embedded in the 22nd, 24th, and 29th bases of the crRNA (UAAUUUCUACUAAGUGUAGAUGCUCGUCGUAUUGGACUUGA) sequence. The bases in italics are bases with modified groups. This modification can ensure the stability of crRNA, while allowing it to fall off only under 365nm ultraviolet light, and not under other lighting conditions. The conservation and specificity of primer pairs and crRNA sequences were evaluated using NCBI "BLAST", and by conducting experiments on multiple primer pairs and multiple crRNAs using positive controls (standard strains), it was found that the use of the above primer set can have better amplification efficiency and no non-specific amplification bands. The use of the above crRNA can produce strong fluorescence values ​​and good visualization effects.

[0074] (3) Establishment of a photoactivated one-tube RPA-CRISPR / Cas12a system based on modification of photosensitive groups:

[0075] In this example's diagnostic strategy, the RPA preamplification system and CRISPR-Cas12a system were combined into a single reaction mixture. Before the experiment, according to the RPA user manual, lyophilized enzyme powder was dissolved in 29.5 μL of buffer solution. Then, 2.4 μL each of the forward and reverse primers (10 μM) and 9.2 μL of nuclease-free water were added to prepare a premix.

[0076] The 15 μL single-tube reaction system consists of the following components: (a) 10 μL RPA reaction mixture, including lyophilized enzyme powder premix, forward primer, reverse primer, template DNA, nuclease-free water, and MgCl2. 2+(b) 5 μL CRISPR / Cas12a reaction mixture, including 10× r2.1 buffer, Cas12a, crRNA modified with a photosensitive group, ssDNA, and nuclease-free water. The mixture was gently vortexed, briefly centrifuged, and then incubated at 37°C for 20 minutes. After the incubation, the reactants were exposed to ultraviolet light at a wavelength of 365 nm for 60 seconds to activate the crRNA modified with the photosensitive group. The fluorescent signal was then dynamically recorded every minute for 30 minutes at 37°C using the Tianlong Gentier96E / 96R qPCR system, and the FAM fluorescence signal was collected in real time.

[0077] (4) Verification of the feasibility of light-activated one-tube RPA-CRISPR / Cas12a:

[0078] Previous studies have highlighted a major challenge: directly combining RPA amplification with various CRISPR-based detection strategies in a one-tube format often results in significantly reduced detection efficiency. This may be due to the production of excessive target fragments during the RPA pre-amplification stage, which simultaneously activates the CRISPR detection system. To address this issue, photosensitive groups were used to modify the crRNA in the CRISPR-Cas12a system to prevent crRNA from base pairing with the continuously produced target fragments. This modification can inactivate the Cas12a / crRNA complex and temporarily silence the CRISPR-Cas12a system, effectively separating the pre-amplification and signal amplification processes at the temporal level. The entire experimental process can be performed in one tube without opening the lid, reducing aerosol contamination caused by opening the lid or reduced efficiency caused by frequent addition of reagents.

[0079] In order to verify the feasibility of the method, this embodiment designs a series of component omission experiments to evaluate the necessity of each component, including Cas12a protein, crRNA modified with a light-sensitive group, crRNA without modified light-sensitive group, ssDNA probe and template. By comparing with the standard single-tube strategy of crRNA without modified light-sensitive group. The experimental results are evaluated by fluorescence signal intensity and agarose gel electrophoresis. Figure 2 The figure shows the result of the component omission experiment involved in the embodiment of the present application, Figure 2 In the figure, A is the fluorescence value of different experimental groups, B is the gel electrophoresis result of different experimental groups (M refers to Marker), C is the UV fluorescence image of different experimental groups, and 1 to 7 are different experimental groups. For example, according to Figure 2 , Experimental Group 1 is the situation where UV light, Cas12a, crRNA modified with light-sensitive groups, ssDNA and nucleic acid template are all present. Figure 2It can be seen that the light-activated one-tube RPA-CRISPR / Cas12a detection method of experimental group 1 has the best signal intensity.

[0080] In addition, this example also studies the effects of different light sources on the light-controlled single-tube RPA-CRISPR / Cas12a system, including ultraviolet light, natural light, incandescent light, infrared light, and LED light. Figure 3 The experimental results of different light sources involved in the embodiments of the present application are shown in FIG. Figure 3 In the figure, A is the fluorescence value of different experimental groups, B is the UV fluorescence image of different experimental groups, C is the gel electrophoresis result of different experimental groups (M refers to Marker), 1 to 5 are different experimental groups, corresponding to UV light, natural light, incandescent light, LED light and darkroom conditions respectively. Figure 3 It can be seen that only ultraviolet light irradiation can activate the light-controlled single-tube RPA-CRISPR / Cas12a system of this application.

[0081] (5) Optimization of reaction conditions:

[0082] The reaction components in the light-controlled single-tube RPA-CRISPR / Cas12a detection system are very complex and involve multiple biochemical reactions, so the concentration of a single component is crucial to the detection efficiency. In this embodiment, the key components that affect the reaction efficiency are optimized. In order to determine the optimal primer concentration in the pre-amplification stage of RPA, different experimental groups were set at intervals of 80nM in the concentration range of 200-440nM and the fluorescence values ​​were measured. Similarly, to determine the optimal reaction time for RPA pre-amplification, different experimental groups were set at intervals of 5 minutes in the time interval of 10 to 25 minutes and the fluorescence values ​​were recorded. The optimal RPA reaction conditions were determined based on the combination that produced the highest fluorescence signal. In order to improve the trans-cleavage activity of the CRISPR-Cas12a system, we further optimized a series of reaction conditions. First, the gradient concentrations of Cas12a protein and crRNA modified with a light-sensitive group were tested at intervals of 80nM in the range of 100-420nM. In addition, the length of UV irradiation time directly affects the deprotection efficiency and recovery rate of crRNA modified with photosensitive groups. We explored the optimal irradiation time in the range of 10-120 seconds. Figure 4 The results of the reaction condition optimization experiment involved in the embodiment of the present application are shown in FIG. Figure 4 In the figure, A is the result of the primer concentration optimization experiment, B is the result of the RPA pre-amplification time optimization experiment, C is the result of the Cas12a concentration optimization experiment, D is the result of the crRNA concentration optimization experiment modified with a light-sensitive group, E is the result of the ultraviolet irradiation time optimization experiment, **** represents p < 0.0001 (n = 3). Figure 4It can be seen that when the primer concentration is 440nM, the RPA pre-amplification time is 25min, the Cas12a concentration is 340nM, the crRNA concentration modified with a light-sensitive group is 340nM, and the UV illumination time is 90s-120s, the detection signal value is the strongest.

[0083] (6) Sensitivity and specificity:

[0084] The sensitivity and specificity of the assay were tested using the experimental conditions obtained in the previous experiment. To evaluate the sensitivity of the light-controlled single-tube RPA-CRISPR / Cas12a detection system, the pUC19-51 plasmid was used as the positive template. The initial concentration was 1×10 6 A series of positive samples was generated using a 10-fold dilution series to validate the sensitivity of the detection system. Subsequently, the specificity of the system was evaluated using standard strains of six common clinical pathogens: Pseudomonas aeruginosa, Escherichia coli, Stenotrophomonas maltophilia, Klebsiella pneumoniae, Staphylococcus aureus, and Haemophilus influenzae. Fluorescence intensity results were used to clearly assess the specificity of the system.

[0085] Figure 5 The results of sensitivity and specificity involved in the examples of this application are shown in FIG. Figure 5 In the figure, A is the endpoint fluorescence value of the experimental group with different sample concentrations, B is the real-time fluorescence curve of the experimental group with different sample concentrations, C is the endpoint fluorescence value of the experimental group with different pathogenic bacteria, D is the real-time fluorescence curve of the experimental group with different pathogenic bacteria, NC is the negative control group, **** represents p < 0.0001 (n = 3). Figure 5 It can be seen that the light-controlled one-tube RPA-CRISPR / Cas12a detection system of this embodiment can detect a minimum of 10 copies / μL of Acinetobacter baumannii, and has good specificity, and can well distinguish Acinetobacter baumannii from other pathogens.

[0086] (7) Verification of clinical performance:

[0087] To evaluate the clinical performance of the light-controlled, one-tube RPA-CRISPR / Cas12a detection system, 38 clinical sputum samples were collected from the Microbiology Laboratory of the Affiliated Hospital of Youjiang Medical College for Nationalities. Samples were numbered S1 to S38. Samples S3, S4, S14, S15, S25, S32, S33, and S38 were negative for Acinetobacter baumannii by culture and mass spectrometry, while the remaining samples were positive for Acinetobacter baumannii. To maintain confidentiality of the sample status, two technicians from the same laboratory participated in the experiment. One technician tested the samples using the light-controlled, one-tube RPA-CRISPR / Cas12a method, while the other technician tested the samples using traditional PCR. The results of the two methods were compared to assess their consistency. The total PCR reaction volume was 25 μL, consisting of 12.5 μL of 2× EsTaq MasterMix (dye), 1.25 μL of forward primer (SEQ ID NO. 5, 5'-AGCACCATAAGGCAACCA-3'), 1.25 μL of reverse primer (SEQ ID NO. 6, 5'-CCAACACGCTTCACTTCC-3'), 1 μL of DNA template, and 9 μL of ddH2O. Thermal cycling conditions were as follows: initial denaturation at 94°C for 2 min, followed by 35 cycles of 94°C for 10 sec, 53°C for 30 sec, and 72°C for 30 sec, and a final extension at 72°C for 2 min. PCR products were visualized by agarose gel electrophoresis.

[0088] Figure 6 The figure shows the test results of the clinical samples involved in the embodiments of the present application. Figure 6 In the figure, A is the detection result of the light-controlled single-tube RPA-CRISPR / Cas12a system, and B is the detection result of the traditional PCR method. It can be seen that the light-controlled single-tube RPA-CRISPR / Cas12a system of this embodiment is used to detect Acinetobacter baumannii, and the detection results are consistent with those of other methods, with good accuracy.

[0089] The above content is a further detailed description of the present application in conjunction with specific implementation methods, and the specific implementation of the present application cannot be considered to be limited to these descriptions. For ordinary technicians in the technical field to which the present application belongs, several simple deductions or substitutions can be made without departing from the concept of the present application.

Claims

1. A kit for detecting Acinetobacter baumannii, characterized in that: It includes a first primer, a second primer, a recombinase polymerase, a Cas12a protein, crRNA and ssDNA, wherein: the sequence of the first primer is shown in SEQ ID NO.1; the sequence of the second primer is shown in SEQ ID NO.2; the sequence of the crRNA is shown in SEQ ID NO.3, the crRNA is modified with a photosensitive chemical group that prevents the crRNA from binding to the target nucleic acid, and the photosensitive chemical group falls off from the crRNA when irradiated with light of a predetermined wavelength; the sequence of the ssDNA is shown in SEQ ID NO.4, one end of the ssDNA is modified with a fluorescent group and the other end is modified with a quenching group.

2. The kit according to claim 1, wherein The kit also includes dNTPs, buffer, Mg 2+ and at least one of ddH2O.

3. The kit according to claim 1, wherein The predetermined wavelength is 100 nm to 400 nm.

4. The kit according to claim 1, wherein The photosensitive chemical group is deoxythymidine modified with a photosensitive protective group.

5. A device for detecting Acinetobacter baumannii, characterized in that: include: An amplification module for performing recombinase polymerase amplification on the nucleic acid sample to be tested and the addition of a first primer and a second primer, wherein the amplification system of the recombinase polymerase amplification further contains a recombinase polymerase, a Cas12a protein, crRNA and ssDNA; wherein the sequence of the first primer is shown in SEQ ID NO.1; the sequence of the second primer is shown in SEQ ID NO.2; the sequence of the crRNA is shown in SEQ ID NO.3, the crRNA is modified with a photosensitive chemical group that prevents the crRNA from binding to the target nucleic acid, and the photosensitive chemical group falls off from the crRNA when irradiated with light of the predetermined wavelength; the sequence of the ssDNA is shown in SEQ ID NO.4, one end of the ssDNA is modified with a fluorescent group and the other end is modified with a quenching group; an illumination module, configured to illuminate the amplification system of the recombinase polymerase amplification with the light of the predetermined wavelength; The result interpretation module is used to judge whether the sample to be tested contains Acinetobacter baumannii according to the fluorescence value.

6. The device according to claim 5, characterized in that In the amplification system of the recombinase polymerase amplification, the concentration of the first primer or the second primer is 400nM to 500nM; Preferably, in the amplification system of the recombinase polymerase amplification, the concentration of the first primer or the second primer is 440 nM.

7. The device according to claim 5 or 6, characterized in that The amplification time of the recombinase polymerase amplification is 20 min to 30 min; Preferably, the amplification time of the recombinase polymerase amplification is 25 minutes.

8. The device according to claim 5, characterized in that In the amplification system of the recombinase polymerase amplification, the concentration of the Cas12a is 180nM to 420nM; Preferably, in the amplification system of the recombinase polymerase amplification, the concentration of the Cas12a is 340nM.

9. The device according to claim 5, characterized in that In the amplification system of the recombinase polymerase amplification, the concentration of the crRNA is 180nM to 420nM; Preferably, in the amplification system of the recombinase polymerase amplification, the concentration of the crRNA is 340 nM.

10. The device according to claim 5, characterized in that In the illumination module, the illumination time is 90 seconds to 120 seconds.

Images