Method for high-efficiency catalytic synthesis of psilol by using recombinant Escherichia coli
By constructing the ribitol dehydrogenase mutant KoRDHE106G-V1 and overexpressing formate dehydrogenase in Escherichia coli, the problem of low conversion rate of allol in microbial whole-cell synthesis was solved, efficient allol synthesis was achieved, and industrial production capacity was obtained.
Patent Information
- Application Number
- CN202510604968.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-12
- Publication Date
- 2025-09-19
AI Technical Summary
The existing method of synthesizing allol by whole-cell microorganisms is limited by the conversion rate of allol and cannot be achieved on an industrial scale.
A ribitol dehydrogenase mutant KoRDHE106G-V1 was constructed, and formate dehydrogenase from Candida boidinii was overexpressed in Escherichia coli. An NADH/NAD+ coenzyme recycling system was constructed, and a substrate flow addition strategy was used for whole-cell catalytic synthesis of allol.
The efficient synthesis of allol was achieved, with a conversion rate of 61.2% and a yield of 61.2g/L, breaking through the laboratory level and having the potential for industrial production.
Smart Images

Figure CN120665830A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to a method for efficiently catalyzing and synthesizing allol by utilizing recombinant Escherichia coli, and belongs to the fields of genetic engineering technology and synthetic biology. Background Art
[0002] Allol is also known as garlicitol (C6H 14 O6), in the field of medicine, it is mainly used to treat constipation, lower blood sugar, prevent dental caries, etc., and has the characteristics of reducing the water transit time of the small intestine and increasing the water content of the small intestine and cecum.
[0003] With economic and social development and improved living standards, health issues such as diabetes and hypertension have had a significant impact on people's health. Consequently, people are pursuing healthier, lower-sugar diets. With rising public health awareness and growing demand for health foods and pharmaceuticals, rare sugar alcohols are attracting increasing attention due to their unique nutritional properties. Among them, allol, a rare sugar alcohol with diverse functional applications, has also garnered widespread attention.
[0004] At present, the most common synthesis method is to use whole microbial cells to synthesize allitol. For example, in 2018, Hassanin et al. constructed a recombinant Escherichia coli that co-expressed ribitol dehydrogenase (RDH) and formate dehydrogenase (FDH) from Providencia alcalifaciens RIMD1656011. The strain catalyzed the reaction at 30°C, pH 7.0 and 2% substrate concentration for 48 hours and successfully produced 19.8 mg of allitol (Reference: Hassanin H AM, Letsididi R, Koko MYF, et al. Synthesis of allitol from D-psicose using ribitol dehydrogenase and formate dehydrogenase [J]. Tropical Journal of Pharmaceutical Research 2017, 15 (12): 2701-2708). Then, Zhao et al. constructed a multi-enzyme self-assembly system to synthesize allitol using 15% psicose as a substrate (Reference: Zhao J, Guo Y, Li Q, et al. Reconstruction of a Cofactor Self-Sufficient Whole-Cell Biocatalyst System for Efficient Biosynthesis of Allitol from d-Glucose[J]. Journal of Agricultural and Food Chemistry, 2022, 70(12): 3775-3784). However, due to the influence of the conversion rate of allitol, current research is still at the laboratory level and has not yet achieved industrial-scale production. Therefore, it is urgent to construct a strain that efficiently produces allitol, in order to provide an efficient and economical method for the industrial production of allitol. Summary of the Invention
[0005] In view of the above-mentioned deficiencies in the prior art, the present invention provides a method for efficiently catalyzing the synthesis of allol using recombinant Escherichia coli. The purpose is to solve the technical problem that the existing microbial whole-cell synthesis of allol is still limited by the conversion rate of allol and remains at the laboratory level and cannot be achieved on an industrial scale.
[0006] The first technical solution provided by the present invention is a ribitol dehydrogenase mutant, wherein the mutant is a ribitol dehydrogenase parent with an amino acid sequence as shown in SEQ ID No. 5, subjected to at least one of the following mutations:
[0007] (1) Leucine L at position 12 mutated to Cysteine C, and alanine A at position 39 mutated to Cysteine C;
[0008] (2) The glutamic acid E at position 106 was mutated to glycine G.
[0009] In certain embodiments, the mutant is a ribitol dehydrogenase parent as shown in SEQ ID No. 5, wherein the 12th leucine L is mutated to cysteine C, the 39th alanine A is mutated to cysteine C, and the 106th glutamic acid E is mutated to glycine G, to obtain KoRDH. E106G-V1 .
[0010] In certain embodiments, the ribitol dehydrogenase parent is derived from Klebsiella oxytoca CGMCC7662.
[0011] In certain embodiments, the ribitol dehydrogenase mutant KoRDH E106G-V1 The amino acid sequence is shown in SEQ ID No. 3.
[0012] The second technical solution provided by the present invention is a gene encoding the mutant described in the first technical solution.
[0013] In certain embodiments, the nucleotide sequence of the gene is shown as SEQ ID No. 4.
[0014] The third technical solution provided by the present invention is a recombinant vector carrying the gene described in the second technical solution.
[0015] In certain embodiments, the recombinant vector uses a PET series plasmid as an expression vector.
[0016] The fourth technical solution provided by the present invention is a recombinant cell expressing the mutant described in the first technical solution, or containing the gene described in the second technical solution, or transformed with the recombinant vector described in the third technical solution.
[0017] In certain embodiments, the recombinant cell is hosted by Escherichia coli.
[0018] The fifth technical solution provided by the present invention is a recombinant Escherichia coli, wherein the recombinant Escherichia coli uses Escherichia coli BL21 (DE3) as a host, heterologously expresses formate dehydrogenase from Candida boidinii, and constructs NADH / NAD + Coenzyme recycling regeneration system, followed by expression of the ribitol dehydrogenase mutant KoRDH described in the first technical solution E106G-V1 .
[0019] In certain embodiments, the amino acid sequence of the formate dehydrogenase derived from Candida boidinii is shown as SEQ ID No. 1.
[0020] In certain embodiments, the nucleotide sequence encoding the formate dehydrogenase derived from Candida boidinii is shown as SEQ ID No. 2.
[0021] In certain embodiments, the recombinant E. coli uses E. coli BL21 (DE3) as a host and pETDuet1 plasmid as an expression plasmid to co-express KoRDH E106G-V1 and CbFDH.
[0022] The sixth technical solution provided by the present invention is a method for biosynthesizing allol, wherein the method uses psicose as a substrate and utilizes the recombinant Escherichia coli described in the fifth technical solution as a whole-cell catalyst to form a reaction system to synthesize psicone.
[0023] In some embodiments, the method uses 50 mmol / L Tris-HCl buffer with a pH value of 7.0 as the reaction solution, the reaction system contains an initial substrate concentration of 50 g / L, a bacterial biomass of OD 600 =30, a psicose:sodium formate (mM / mM) ratio of 1:2, a substrate flow addition strategy was adopted, and the substrate was added from the 6th hour until the substrate concentration reached 100 g / L. No pH adjustment was required. The conversion temperature was 45°C and the conversion time was 18 h.
[0024] In certain embodiments, the preparation method of the whole-cell catalyst is as follows: the recombinant Escherichia coli described in the fifth technical solution is inoculated into LB medium, TB medium or TY medium for inducing expression to obtain a whole-cell catalyst containing ribitol dehydrogenase and formate dehydrogenase.
[0025] In certain embodiments, the recombinant Escherichia coli is cultured at a temperature of 37° C., and the induction temperature of ribitol dehydrogenase and formate dehydrogenase is 25° C., the rotation speed is 200 rpm, and the induction time is 16 h.
[0026] The present invention also provides a seventh technical solution, which is the use of the recombinant Escherichia coli described in the fifth technical solution or the method described in the sixth technical solution in the preparation of allol or a product containing allol.
[0027] The technical effects of the present invention are as follows:
[0028] The present invention provides a method for constructing an optimal mutant of ribitol dehydrogenase KoRDH. E106G-V1 and the formate dehydrogenase from Candida boidinii and the mutant KoRDH E106G-V1Overexpression was performed in Escherichia coli to construct a recombinant E. coli strain. Whole cells of the recombinant E. coli were used as catalysts, 50 mmol / L Tris-HCl buffer with a pH of 7.0 was used as the reaction solution, and a substrate flow-in strategy was adopted. A total of 100 g / L DD-psicose was added. After 18 hours, 61.2 g / L of allol was obtained, with a conversion rate of up to 61.2%. BRIEF DESCRIPTION OF THE DRAWINGS
[0029] Figure 1 is the relative enzyme activity of wild-type ribitol dehydrogenase and its mutants at different pH.
[0030] Figure 2 Relative enzyme activities of wild-type ribitol dehydrogenase and its mutants at different temperatures.
[0031] Figure 3 is the relative catalytic activity at different ratios of D-psicose and sodium formate.
[0032] Figure 4 is the yield of allol at different conversion temperatures.
[0033] Figure 5 is the yield of allol at different conversion pH.
[0034] Figure 6 is the yield of allol at different bacterial biomasses.
[0035] Figure 7 This is the catalytic yield of whole cells in a 5 L fermenter. DETAILED DESCRIPTION
[0036] The following describes preferred embodiments of the present invention. It should be understood that the embodiments are for better explanation of the present invention and are not intended to limit the present invention.
[0037] Test method:
[0038] 1. Ribitol dehydrogenase activity assay
[0039] RDH activity is determined by measuring the change in absorbance at 340 nm due to NADH consumption or NAD+ production over a 1-minute period. The 1 mL reaction mixture used for RDH activity assays includes 25 g / L D-psicose as the catalytic substrate, 200 μL of crude RDH enzyme solution, and 200 μL of 0.4 mol / L NADH. The remaining volume is made up to 1 mL with Tris-HCl buffer (50 mM, pH 7.0). After catalysis at 40°C for 20 minutes, the reaction is immediately removed and placed in a spectrophotometer to monitor the change in reading at 340 nm for 1 minute. RDH activity is defined as the amount of enzyme required to consume 1 μmol of NADH per minute, which is one unit (U / mL).
[0040] 2. HPLC detection method of D-psicose and allol
[0041] (1) Sample processing: The sample was centrifuged at 12000 rpm for 10 min, the supernatant was collected, and the supernatant was collected again at 12000 rpm for 10 min. The supernatant was appropriately diluted and filtered through a 0.22 μm membrane before use in HPLC detection.
[0042] (2) HPLC detection conditions were as follows: Hi-Plex Ca column, size 300 mm × 7.7 mm, ultrapure water mobile phase, flow rate 0.6 mL min-1, column temperature 80 °C, differential detector, detection temperature 35 °C, injection volume 10 μL.
[0043] The raw materials used in the embodiment are:
[0044] The culture medium involved in the following examples is as follows:
[0045] (1) LB liquid medium: peptone 10 g / L, yeast powder 5 g / L, NaCl 10 g / L.
[0046] (2) LB solid medium: peptone 10 g / L, yeast powder 5 g / L, NaCl 10 g / L, agar 15 g / L.
[0047] (3) TB culture medium:
[0048] A: Yeast powder 24g, peptone 12g, glycerol 4g
[0049] B: KH2PO4 2.3g, K2HPO4 16.4g
[0050] A was dissolved in 900 mL of ultrapure water and sterilized by autoclave; B was dissolved in 100 mL of ultrapure water and sterilized by autoclave, and 900 mL of A and 100 mL of B were mixed to prepare 1 L of TB medium.
[0051] (4) TY medium: yeast extract 8 g / L, tryptone 12 g / L, K3PO4 4.02 g / L, NaCl 3 g / L, citric acid monohydrate 2.1 g / L, ammonium ferric citrate 0.3 g / L, glycerol 10 g / L, (NH4)2SO4 2.5 g / L, MgSO4·7H2O 0.5 g / L, pH adjusted to 7.2 with aqueous ammonia.
[0052] (5) Feed medium: 400 g / L glycerol, 50 g / L yeast extract, and 25 g / L tryptone.
[0053] Among them, peptone and yeast powder were purchased from Oxoid Company, and the other medicines were purchased from Sinopharm (Shanghai) Chemical Reagent Co., Ltd.
[0054] The strain E. coli BL21 (D3) and plasmid pETDuet1 involved in the following examples are both commercial strains and plasmids.
[0055] The plasmid pET-28a / Cbfdh involved in the following examples is stored in this laboratory and disclosed in the following literature: Ni Hanmeng, Hu Mengkai, Zhang Hengwei, et al. Semi-rational design to improve the activity and thermal stability of formate dehydrogenase (Cb FDH) [J]. Journal of Food and Biotechnology, 2023, 42(10): 1-8.
[0056] Example 1 Selection of mutation sites in ribitol dehydrogenase from Klebsiella oxytoca and construction of V1 mutant
[0057] The disulfide bond prediction and modification of the protein model were performed using Disulfide by Design2 software. The possible disulfide bond formation sites and the corresponding protein spatial configuration after mutation were predicted through simulation calculations, and the various parameters of the predicted disulfide bonds, such as χ 3 The torsion angle, Cα-Cβ-Cγ angle, bond energy, and total B-factor were further calculated using the FOLDX software to evaluate the effect of the predicted mutation site on the protein structural stability.
[0058] Three groups of disulfide bond construction sites were initially selected, namely L12C / K15C, L12C / K37C, and L12C / A39C. The construction method is as follows: Using L12C-F / L12C-R as primers and the synthetic Kordh gene as a template, PCR amplification was performed to obtain an rdh gene fragment containing the L12C mutation point, which was 750bp in size. The purified rdh gene fragment containing the mutation point L12C was homologously recombined with the pETDuet1 linearized plasmid digested with EcoRI and SalI, and the ligation product was transformed into E. coli BL21 competent cells. The recombinant plasmid was double-enzyme digested and verified. The successfully verified plasmid was sent to Suzhou Jinweizhi Co., Ltd. for sequencing analysis. The sequencing results were analyzed by SnapGene 3.2.1 software. The strain with correct sequencing was named E. coli BL21 / pETDuet1-rdh L12C Then, the mutation was performed. Extract the plasmid pETDuet1-rdh L12C , using K15C-F / K15C-R, K37C-F / K37C-R, A39C-F / A39C-R as primers, and plasmid pETDuet1-rdh L12C Using PCR as a template, we amplified rdh gene fragments containing the L12C / K15C, L12C / K37C, and L12C / A39C mutations, each 750 bp in size. Purified rdh gene fragments containing the L12C mutation were homologously recombined with pETDuet1 linearized plasmids digested with EcoRI and SalI. The ligation products were then transformed into E. coli BL21 competent cells. Recombinant plasmids were double-digested and verified. Successful recombinant plasmids were sent to Suzhou GeneWeizhi Co., Ltd. for sequencing analysis. Sequencing results were analyzed with SnapGene 3.2.1 software. Strains with correct sequencing results were designated E. coli BL21 / pETDuet1-rdh L12C / K15C 、E.coli BL21 / pETDuet1-rdh L12C / K37C 、E.coli BL21 / pETDuet1-rdh L12C / A39C The primers are listed in the table below (bold letters indicate mutation sites).
[0059] The half-life of the three recombinant strains was then determined. The half-life is the time it takes for the enzyme activity to reach half of the initial activity. The determination method is: incubate at the optimal temperature of 40°C, take samples at regular intervals, and measure their enzyme activity. L12C / K15C 、E.coli BL21 / pETDuet1-rdh L12C / K37C 、E.coliBL21 / pETDuet1-rdh L12C / A39CThe half-lives of the strains were 1.25, 1.42, and 2.08 times longer than those of the original strain E. coli BL21 / pETDuet1-rdh, respectively. Therefore, the optimal disulfide bond construction sites, L12C / A39C, were selected and designated V1.
[0060] The researchers then selected sites that improved catalytic efficiency and compared the catalytic abilities of the wild-type and mutants using transformation experiments. A total of six feasible mutation sites were selected: E106G, H133W, S224W, V247F, S129L, and A209L.
[0061] Primer name <![CDATA[Primer sequence (5 / -3 / )]]> L12C-F CTCCTCTATGAATACTTCCTGTAGCGGTAAAGTCGCCGCC L12C-R GGCGGCGACTTTACCGCTACAGGAAGTATTCATAGAGGAG K15C F ACTTCCCTTAGCGGTTGCGTCGCCGCCATTACC K15C-R GGTAATGGCGGCGACGCAACCGCTAAGGGAAGT K37C-F GAACCCTGCTGGGCTGCGGCGCAAAAGTGG K37C-R CCACTTTTGCGCCGCAGCCCAGCAGGGTTC A39C-F CCTGCTGGGCGCCGGCAAAAGTGGTGCTTATCG A39C-R CGATAAGCACCACTTTGCAGCCGGCGCCCAGCAGG
[0062] Example 2: Construction of recombinant E. coli BL21 / pETDuet1-rdh and its mutants
[0063] (1) Construction of recombinant E. coli BL21 / pETDuet1-rdh
[0064] Using primers rdh-F and rdh-R, the synthesized rdh gene was used as a template for PCR amplification to obtain a 750bp fragment of the rdh gene (GenBank: LR133932.1). The purified rdh gene fragment was then homologously ligated with the pETDuet1 linearized plasmid digested with BamHI and EcoRI. The ligation product was then transformed into E. coli BL21 competent cells. The recombinant plasmid was double-digested and verified. Successful recombinant plasmids were sent to Suzhou GeneWeizhi Co., Ltd. for sequencing analysis. Sequencing results were analyzed using SnapGene 3.2.1 software. The strain with the correct sequence was named E. coli BL21 / pETDuet1-rdh. The primers are as follows:
[0065] rdh-F:GTATAAGAAGGAGATATA CATATG ATGAACCACTCTGTCTCCTCTATGAA(EcoRI)
[0066] rdh-R:GCCGATATCCAATTG AGATCT TCAGAGATCCACGCTGTTCGGC(Sal I)
[0067] (2) Construction of mutant strains
[0068] The primers rdh-F / E106G-R, E106G-F / rdh-R, rdh-F / H133W-R, H133W-F / rdh-R, rdh-F / S224W-R, S224W-F / rdh-R, rdh-F / V247F-R, V247F-F / rdh-R, rdh-F / S129L-R, S129L-F / rdh-R and rdh-F / A209L-R, A209L-F / rdh-R were used, and the synthesized Kordh gene was used as the template PC. R amplification obtained rdh gene fragments containing E106G, H133W, S224W, V247F, S129L, and A209LE106G mutation points, each of which was 750 bp in size. The purified rdh gene fragments containing E106G, H133W, S224W, V247F, S129L, and A209LE106G mutation points were homologously recombined with the pETDuet1 linearized plasmid digested with EcoRI and SalI, and the ligation products were transformed into E. coli BL21 competent cells. The recombinant plasmids were double-enzyme digested and verified. The successfully verified ones were sent to Suzhou Jinweizhi Co., Ltd. for sequencing analysis. The sequencing results were analyzed with SnapGene 3.2.1 software. The strains with correct sequencing were named E. coli BL21 / pETDuet1-rdh E106G 、E.coli BL21 / pETDuet1-rdh H133W 、E.coli BL21 / pETDuet1-rdh S224W 、E.coli BL21 / pETDuet1-rdh V247F 、E.coli BL21 / pETDuet1-rdh S129L and E. coli BL21 / pETDuet1-rdh A209L The primers are listed in the following table (bold letters indicate mutation sites):
[0069]
[0070] Example 3: Expression and enzymatic properties of wild-type ribitol dehydrogenase and mutant enzymes
[0071] The recombinant E. coli BL21 / pETDuet1-rdh and its mutants constructed in Example 2 were streaked onto solid LB plates containing 50 μg / mL kanamycin. After incubation at 37°C for 12-24 h, single colonies were picked and transferred to 10 mL LB liquid medium supplemented with 50 μg / mL ampicillin. The plates were incubated at 37°C and 180 rpm for 12-24 h. The plates were then inoculated with a 1% (v / v) inoculum into 50 mL LB liquid medium supplemented with 50 μg / mL ampicillin. In LB liquid medium, after culturing at 37°C and 180 rpm for 2 h, IPTG was added to a final concentration of 0.5 mmol / L, and the expression was continued at 28°C and 180 rpm for 16 h. Finally, the induced bacterial solution was centrifuged at 4°C to collect the bacteria. The bacteria were washed twice with 0.1 mol / L PBS buffer at a pH of 7.4, and then resuspended in 0.1 mol / L PBS buffer at a pH of 7.4 to obtain a concentrated bacterial solution. The concentrated bacterial solution was disrupted using an ultrasonic disruptor to obtain a disrupted solution. The disrupted solution was centrifuged at 4°C for 20 min, and the supernatant was collected. This supernatant is the crude enzyme solution.
[0072] SDS-PAGE analysis of the cell supernatant showed that both the wild-type ribitol dehydrogenase and its mutant were successfully expressed. Protein purification was performed using nickel affinity chromatography, and the purified enzyme was dialyzed against 0.05 M Tris-HCl buffer, pH 7.0, for subsequent activity assays.
[0073] This example studies the differences in the enzymatic properties of wild-type ribitol dehydrogenase and its mutants at different pH values (4.0-10.0, interval 1.0) and temperatures (30, 35, 40, 45, 50, 55, and 60°C). Figure 1 The results showed that the wild-type ribitol dehydrogenase and its mutants had high activity in the pH range of 6.0-9.0, and the conversion rate was the best at pH 7.0. Figure 2 As shown, the optimal reaction temperature of the wild-type ribitol dehydrogenase and its mutants was 40°C.
[0074] Finally, after reacting for 1 hour at the optimal temperature of 40°C and the optimal pH of 6.0, the enzyme reaction was immediately terminated by water bath at 100°C for 5 minutes. The results of enzyme activity assay of wild-type ribitol dehydrogenase and its mutants showed that wild-type ribitol dehydrogenase RDH and mutant enzyme RDH E106G 、RDH H133W 、RDH S224W 、RDH V247F 、RDH S129L and RDH A209LThe specific enzyme activities were 7.3, 8.6, 6.1, 4.1, 3.4, 7.1 and 6.9 U / mL, respectively. E106G The specific enzyme activity was improved and was 1.18 that of the wild-type RDH.
[0075] Example 4: Optimal mutant E. coli BL21 / pETDuet1-rdh E106G-V1 Construction, enzyme activity determination, and whole-cell conversion into allol
[0076] The results of enzyme activity assay showed that the mutant RDH E106G The specific enzyme activity of RDH was improved to 1.18 of that of wild-type RDH. V1 The mutant has improved thermal stability, with a half-life 2.08 times that of the wild type. Therefore, the E106G mutation site was combined with V1 mutation to further improve the enzyme activity of ribitol dehydrogenase while maintaining its stability.
[0077] RDH v1 As a template (nucleotide sequence as shown in SEQ ID No. 6), rdh-F / E106G-R and E106G-F / rdh-R were used as primers, and PCR amplification was performed to obtain rdh gene fragments containing V1 and E106G double mutation sites, each of which was 750 bp in size. The purified rdh gene fragments containing V1 and E106G double mutation sites were homologously recombined with the pETDuet1 linearized plasmid digested with EcoRI and SalI, and the ligation products were transformed into E. coli BL21 competent cells. The recombinant plasmid was double-enzyme digested and verified. The successfully verified strains were sent to Suzhou Jinweizhi Co., Ltd. for sequencing analysis. The sequencing results were analyzed by SnapGene 3.2.1 software. The strains with correct sequencing were named E. coli BL21 / pETDuet1-rdh V1 / E106G .
[0078] Then, the ribitol dehydrogenase was induced and expressed and the enzyme activity was determined according to the method described in Example 3. The results showed that RDH V1 / E106G The specific enzyme activity was 8.9 U / mL, which was 1.22 times that of the wild-type RDH.
[0079] The constructed recombinant E. coli BL21 / pETDuet1-rdh V1 / E106GStreak activation was performed on a solid LB plate containing 50 μg / mL ampicillin. After culturing at 37°C for 12-24 hours, a single colony was picked and transferred to 10 mL LB liquid medium supplemented with 50 μg / mL ampicillin. The culture was continued at 37°C and 180 r / min for 12-24 hours. Then, a 1% (v / v) inoculum was inoculated into 50 mL LB liquid medium supplemented with 50 μg / mL ampicillin. After culturing at 37°C and 180 r / min for 2 hours, IPTG was added to a final concentration of 0.5 mmol / L. Expression was induced at 25°C and 180 r / min for 16 hours. Finally, the induced bacterial solution was centrifuged at 4°C to collect the bacteria. Under the premise of controlling the same bacterial concentration (OD 600 =4.0), 20 g / L substrate D-psicose, 0.2 mol / L NADH, 1% 50 mM Co 2+ , reacted at 45℃ for 30min. The results showed that E.coli BL21 / pETDuet1-rdh V1 / E106G The strain synthesized 3.76 g / L of allol, indicating that the strain can be further modified to increase its allol synthesis capacity.
[0080] Example 5: Construction of NADH / NAD + Coenzyme recycling system promotes the biosynthesis of allol
[0081] Using fdh-F and fdh-R as primers, the laboratory-preserved plasmid pET-28a / Cbfdh was used as a template to amplify the fdh gene fragment, which was 1095 bp in size. The purified fdh gene fragment was then amplified with the pETDuet1-rdh fragment obtained by reverse PCR. V1 / E106G The linearized plasmid was ligated for homologous recombination, and the ligation product was transformed into E. coli BL21 competent cells. The recombinant plasmid was double-enzyme digested and verified. The successfully verified plasmid was sent to Suzhou GeneWeizhi Co., Ltd. for sequencing analysis. The sequencing results were analyzed with SnapGene 3.2.1 software. The strain with the correct sequencing was named E. coli BL21 / pETDuet1-rdh V1 / E106G -fdh. The primers are as follows:
[0082] fdh-F:ACAGCCAGGATCC GAATTC AATGAAGATCGTGTTAGTCCTTTACGACG
[0083] fdh-R:GCGGCCGCAAGCTT GTCGAC TTATTATTTTTTATCGTGTTTCCCGTAGGC
[0084] Anti-F: GGTACCCTCGAGTTCTGGTAAAGAAAC
[0085] Anti-R: CATATGTATATCTCCTTCTTATACTTAACTAATATACTAAGATGG
[0086] The constructed recombinant E. coli BL21 / pETDuet1-rdh V1 / E106G and E. coli BL21 / pETDuet1-rdh V1 / E106G -fdh was streaked and activated on a solid LB plate containing 50μg / mL ampicillin. After culturing at 37℃ for 12-24h, a single colony was picked and transferred to 10mL LB liquid medium supplemented with 50μg / mL ampicillin. The culture was continued at 37℃ and 180r / min for 12-24h. Then, 1% (v / v) inoculum was inoculated into 50mL LB liquid medium supplemented with 50μg / mL ampicillin. After culturing at 37℃ and 180r / min for 2h, IPTG was added to a final concentration of 0.5mmol / L. The expression was induced at 25℃ and 180r / min for 16h. Finally, the induced bacterial solution was centrifuged at 4℃ and the bacteria were collected. Under the premise of controlling the same bacterial concentration (OD 600 =4.0), 20 g / L substrate D-psicose, 0.2 mol / L NADH, 1% 50 mM Co 2+ , reacted at 45℃ for 30min. The results showed that with the addition of sodium formate and cofactor NADH, E.coli BL21 / pETDuet1-rdh V1 / E106G -fdh and E.coli BL21 / pETDuet1-rdh V1 / E106G The strains synthesized 8.66 g / L and 4.12 g / L of allol, respectively. This shows that the addition of sodium formate and cofactor NADH is conducive to the construction of NADH / NAD + The coenzyme recycling regeneration system improves the efficiency of the whole-cell catalytic synthesis of allol. Secondly, the additional addition of cofactors increases the yield of allol. It can be seen that insufficient cofactor supply will be detrimental to the synthesis of allol.
[0087] Example 6: Optimization of the ratio of co-substrates D-psicose and sodium formate
[0088] The constructed recombinant E. coli BL21 / pETDuet1-rdh V1 / E106G-fdh was streaked and activated on a solid LB plate containing 50 μg / mL ampicillin. After incubation at 37°C for 12-24 hours, a single colony was picked and transferred to 10 mL LB liquid medium supplemented with 50 μg / mL ampicillin, and cultured at 37°C and 180 r / min for 12-24 hours. Thereafter, the inoculum was inoculated into 50 mL LB liquid medium supplemented with 50 μg / mL ampicillin at a 1% (v / v) inoculum. After incubation at 37°C and 180 r / min for 2 hours, IPTG was added to a final concentration of 0.5 mmol / L, and expression was continued to be induced at 25°C and 180 r / min for 16 hours. Finally, the induced bacterial solution was centrifuged at 4°C to collect the bacteria. Under the premise of keeping other conversion conditions the same, the effect of cosubstrate concentration on allol yield was studied under ten conditions with a D-psicose to sodium formate ratio (mM / mM) of 50:0, 50:1, 10:1, 5:1, 5:2, 5:4, 5:8, 1:2, 1:3 and 1:4. The results are shown in Figure 2. Figure 3 As shown, the optimal D-psicose:sodium formate (mM / mM) ratio is 1:2.
[0089] Example 7: Whole-cell catalytic biosynthesis of allol
[0090] The recombinant strain was E.coli BL21 / pETDuet1-rdh V1 / E106G -fdh was used to optimize the whole-cell transformation conditions, including transformation temperature, pH, and bacterial OD. Figure 4 、 5 As shown in Figures 6 and 7, the optimal conditions for whole-cell catalysis are: temperature 45°C, pH 7.0, and bacterial OD 30. Then, culture and transformation were carried out in a 5 L fermenter.
[0091] Recombinant E. coli BL21 / pETDuet1-rdh V1 / E106G -fdh was streaked and activated on a solid LB plate containing 50μg / mL ampicillin. After culturing at 37℃ for 12-24h, a single colony was picked and transferred to 10mL LB liquid medium supplemented with 50μg / mL ampicillin. The plate was cultured at 37℃ and 180r / min for 12-24h. Then, a 1% (v / v) inoculation volume was inoculated into 200mL LB liquid medium supplemented with 50μg / mL ampicillin. The plate was cultured at 37℃ and 180r / min for 18h to obtain a seed solution. The plate was then transferred to a 5L fermenter containing 2L fermentation medium (TY medium) at a 10% inoculation volume. The fermentation conditions were: temperature at 37℃, rotation speed at 600rpm, and ventilation volume at 4vvm. OD 600When the pH value is about 7-9, the feed medium is added at a constant rate, and the feeding time is controlled at about 12 hours. After 8 hours of fermentation, IPTG inducer (final concentration 0.5mM) is added, and the fermentation tank temperature is set to 25°C. After 24 hours of induction culture, the fermentation is stopped and the cells are collected by centrifugation at 4°C.
[0092] Whole cell transformation system (1L): After centrifugation and suspension of the collected bacteria with water (OD 600 The reaction was carried out in a 5L fermenter at a temperature of 45°C, a substrate concentration of 50 g / L, and a ratio of psicose to sodium formate (mM / mM) of 1:2. The whole-cell catalysis was carried out. After 6 hours, the substrate was added to a cumulative concentration of 100 g / L. After 18 hours of reaction, the yield of allol reached 61.2 g / L, and the conversion rate also reached 61.2% ( Figure 7 ).
[0093] Comparative Example 1
[0094] Referring to the method of Example 3, the purified fdh gene fragment was homologously recombined with the pETDuet1-rdh linearized plasmid obtained by inverse PCR, and the ligation product was transformed into E. coli BL21 competent cells to obtain recombinant bacteria E. coli BL21 / pETDuet1-rdh-fdh. V1 / E106G -fdh and recombinant strain E. coli BL21 / pETDuet1-rdh-fdh were transformed into whole cells in shake flasks respectively. The transformation conditions were as follows: bacterial OD 600 The reaction temperature was 30, the substrate concentration was 50 g / L, the ratio of psicose to sodium formate (mM / mM) was 1:2, and the substrate was added after 6 h to a cumulative concentration of 100 g / L. In contrast, the recombinant strain E. coli BL21 / pETDuet1-rdh-fdh could produce about 51.6 g / LD-allulose, while the recombinant strain E. coli BL21 / pETDuet1-rdh V1 / E106G -fdh can produce about 60.9 g / LD-allol.
[0095] Although the present invention has been disclosed above in terms of preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.
Claims
1. A ribitol dehydrogenase mutant, characterized in that The mutant is obtained by subjecting the ribitol dehydrogenase parent with the amino acid sequence shown in SEQ ID No. 5 to at least one of the following mutations: (1) Leucine at position 12 mutated to cysteine, and alanine at position 39 mutated to cysteine; (2) Glutamic acid at position 106 was mutated to glycine.
2. The ribitol dehydrogenase mutant according to claim 1, characterized in that The mutant is obtained by mutating the 12th leucine of the ribitol dehydrogenase parent as shown in SEQ ID No. 5 to cysteine, the 39th alanine to cysteine, and the 106th glutamic acid to glycine to obtain the mutant KoRDH. E106G-V1 .
3. A gene encoding the ribitol dehydrogenase mutant according to claim 1 or 2.
4. A recombinant vector carrying the gene according to claim 3.
5. A recombinant cell expressing the ribitol dehydrogenase mutant according to claim 1 or 2, or containing the gene according to claim 3, or transformed with the recombinant vector according to claim 4.
6. A recombinant Escherichia coli, characterized in that The recombinant Escherichia coli uses E. coli BL21 (DE3) as a host to heterologously express the formate dehydrogenase from Candida boidinii and the ribitol dehydrogenase mutant KoRDH according to claim 2. E106G-V1 .
7. The recombinant Escherichia coli according to claim 6, characterized in that The amino acid sequence of the formate dehydrogenase derived from Candida boidinii is shown as SEQ ID No. 1; alternatively, the nucleotide sequence encoding the formate dehydrogenase derived from Candida boidinii is shown as SEQ ID No.
2.
8. A method for biosynthesizing allol, characterized in that: The method uses psicose as a substrate and utilizes the recombinant Escherichia coli described in claim 6 or 7 as a whole-cell catalyst to form a reaction system to synthesize psicone.
9. The method according to claim 8, characterized in that The reaction system contained an initial substrate concentration of 50 g / L and a bacterial biomass of OD 600 =30, a psicose:sodium formate (mM / mM) ratio of 1:2, a substrate flow addition strategy was adopted, and the substrate was added from the 6th hour until the substrate concentration reached 100 g / L. No pH adjustment was required. The conversion temperature was 45°C and the conversion time was 18 h.
10. Use of the recombinant Escherichia coli according to claim 6 or 7 or the method according to claim 8 or 9 in the preparation of allol or a product containing allol.