Zymomonas mobilis transcriptional activation system and application thereof

Abstract

The invention relates to the technical field of biology, in particular to a Zymomonas mobilis transcriptional activation system and application thereof.The transcriptional activation system comprises crRNA of a target gene promoter regulatory region and a sequence of a coding effect protein complex, dCas12a losing nuclease activity and a transcriptional activation factor SoxS double mutant (R93A / S101A) are subjected to fusion expression, and the Zymomonas mobilis transcriptional activation system is obtained. Or through mediation of SpyTag / SpyCatcher, the two are coupled, so that an effect protein complex is constructed, and effective transcriptional activation can be carried out on different exogenous promoters and zymomonas mobilis endogenous promoters.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to a Zymomonas mobilis transcription activation system and application thereof. Background Art

[0002] As the biomanufacturing industry transitions toward green and sustainable development, developing efficient production systems for biomass energy and bio-based materials has become a key research direction. Zymomonas mobilis is widely considered a promising industrial base cell due to its streamlined genome, strong environmental tolerance (such as high resistance to alcohols and organic acids), and high substrate conversion efficiency.

[0003] Currently, genetic manipulation of this strain primarily utilizes CRISPR-Cas12a and the endogenous type I-F CRISPR-Cas system for gene editing. However, a lack of programmable transcriptional activation tools prevents dynamic regulation of gene expression without altering the genomic sequence. Traditional gene overexpression techniques typically involve cloning the CDS of the target gene into an overexpression plasmid. This approach is simple and can achieve high levels of expression, but it may provoke host immune responses and is limited by the length of the CDS sequence. The CRSIPRa transcriptional activation system, on the other hand, allows for highly specific and simultaneous regulation of multiple genes without altering the endogenous genomic context. CRISPR-mediated gene expression regulation primarily relies on mutating the nuclease domain of the Cas protein, thereby inactivating its nuclease activity and enabling it to bind to its target site under the guidance of crRNA without cleaving it. However, previously reported CRISPR transcriptional activation systems used in other microorganisms have been difficult to directly transfer to Z. mobilis due to species-specific compatibility issues. Therefore, the development of a programmable transcriptional activation system in Z. mobilis is of great significance. Summary of the Invention

[0004] In view of this, the present invention proposes a Zymomonas mobilis transcription activation system and application thereof.

[0005] The technical solution of the present invention is achieved as follows:

[0006] In a first aspect, the present invention provides a Zymomonas mobilis transcriptional activation system, which comprises a crRNA targeting the promoter regulatory region of a target gene and a sequence encoding an effector protein complex; the components of the effector protein complex include the following (a1) or (a2):

[0007] (a1) Fusion protein of dCas12a and R93A / S101A double-mutated SoxS (denoted as dCas12-SoxS), in which dCas12a and SoxS are connected by a Linker-1 with a length of 8-20 amino acids;

[0008] (a2) A fusion protein of dCas12a and 2×SpyTag (denoted as dCas12a-2×SpyTag), wherein dCas12a and 2×SpyTag are connected via a Linker-2 with a length of 8 to 20 amino acids; and a fusion protein of R93A / S101A double-mutated SoxS and SpyCatcher (denoted as SoxS-SpyCatcher), wherein SoxS and SpyCatcher are connected via a Linker-3 with a length of 8 to 20 amino acids; the fusion protein dCas12a-2×SpyTag and SoxS-SpyCatcher are covalently bound via SpyTag / SpyCatcher spontaneously forming an isopeptide bond;

[0009] The gene sequence encoding the dCas12a is shown in SEQ ID NO: 1; the gene sequence encoding the R93A / S101A double mutant SoxS is shown in SEQ ID NO: 2; the gene sequence encoding the 2×SpyTag is shown in SEQ ID NO: 3; and the gene sequence encoding the SpyCatcher is shown in SEQ ID NO: 4.

[0010] In a second aspect, the present invention provides the application of the transcription activation system in gene expression regulation.

[0011] In a third aspect, the present invention provides a Zymomonas mobilis transcriptional activation effector protein complex, comprising: a fusion protein of dCas12a and R93A / S101A double-mutated SoxS (denoted as dCas12-SoxS), wherein dCas12a and SoxS are connected by a Linker-1 with a length of 8-20 amino acids; the gene sequence encoding the dCas12a is shown in SEQ ID NO: 1; the gene sequence encoding the R93A / S101A double-mutated SoxS is shown in SEQ ID NO: 2.

[0012] In a fourth aspect, the present invention provides a Zymomonas mobilis transcriptional activation effector protein complex, comprising:

[0013] A fusion protein of dCas12a and 2×SpyTag (denoted as dCas12a-2×SpyTag), wherein dCas12a and 2×SpyTag are connected by a Linker-2 with a length of 8 to 20 amino acids; and a fusion protein SoxS-SpyCatcher (denoted as SoxS-SpyCatcher) of SoxS with a double mutation of R93A / S101A and SpyCatcher, wherein SoxS and SpyCatcher are connected by a Linker-3 with a length of 8 to 20 amino acids; the fusion protein dCas12a-2×SpyTag is covalently bound to SoxS-SpyCatcher through SpyTag / SpyCatcher to form an isopeptide bond; the gene sequence encoding the dCas12a is shown in SEQ ID NO: 1; the gene sequence encoding the R93A / S101A double mutation SoxS is shown in SEQ ID NO: 2; the gene sequence encoding the 2×SpyTag is shown in SEQ ID NO: 3; the gene sequence encoding the SpyCatcher is shown in SEQ ID NO: 4.

[0014] In a fifth aspect, the present invention provides the application of the transcriptional activation effector protein complex in gene expression regulation.

[0015] The beneficial effects of the present invention include at least the following:

[0016] The present invention provides a transcriptional activation system developed in Zymomonas mobilis, which includes a crRNA targeting the promoter regulatory region of the target gene and a sequence encoding an effector protein complex. The dCas12a that loses nuclease activity is fused with the transcription activator SoxS double mutant (R93A / S101A) for expression, or the two are coupled through the mediation of SpyTag / SpyCatcher to construct an effector protein complex, which can effectively activate transcription of different exogenous promoters and endogenous promoters of Zymomonas mobilis. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0018] Figure 1 Schematic diagram of dCas12a-SoxS-mut (R93A / S101A) transcriptional activation;

[0019] Figure 2 Schematic diagram of dCas12a-2×SpyTag and SoxS-SpyCatcher transcriptional activation;

[0020] Figure 3 Schematic diagram of the dCas12a-SoxS-mut fusion expression cassette;

[0021] Figure 4 Plasmid maps for reporter gene testing;

[0022] Figure 5 Activation efficiency test results for exogenous promoters J23109, J23110, J23112, J23113, J23115, and J23117 when using GS-Y-Linker for the dCas12a-SoxS (R93A / S101A) system; target-1 indicates that the guide RNA targets the 70bp region upstream of the TSS, and target-2 indicates that the guide RNA targets the 81bp region upstream of the TSS;

[0023] Figure 6 The activation efficiency test results of the dCas12a-SoxS (R93A / S101A) system using GS-Y-Linker, GS-Linker, XTEN-Linker and the control group (NC) on promoters J23110, J23115, and J23117. The vertical axis is the relative fluorescence intensity change fold, and the benchmark is the NC group.

[0024] Figure 7 The results of the activation efficiency test of the dCas12a-SoxS (R93A / S101A) system on the endogenous promoters ZMO0300, ZMO1644, and ZMO1561; where: A is the activation efficiency when using XTEN-Linker; B is the activation efficiency when using GS-Y-Linker; in the ZMO0300 group, target-1 is the 75bp sense strand upstream of the TSS, and target-2 is the 86bp antisense strand upstream of the TSS; in the ZMO1644 group, target-1 is the 145bp sense strand upstream of the TSS, and target-2 is the 93bp sense strand upstream of the TSS; in the ZMO1561 group, target-1 is the 86bp sense strand upstream of the TSS, and target-2 is the 97bp antisense strand upstream of the TSS;

[0025] Figure 8 Results of the activation efficiency test of the dCas12a-2×SpyTag and SoxS-SpyCatcher systems on the endogenous promoters ZMO0300, ZMO1644, and ZMO1561. Three target sites were selected for each promoter for testing. DETAILED DESCRIPTION

[0026] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and in no way limit the scope of protection of the present invention. The experimental methods for which detailed conditions are not specified in the following examples are generally carried out under conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. The experimental materials used in the examples of the present invention can be obtained from commercial channels unless otherwise specified. The experimental methods in the following examples are all conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained from commercial channels unless otherwise specified.

[0027] In the present invention, "Zymomonas mobilis" refers only to strains of Zymomonas mobilis, such as Zymomonas mobilis ZM4 strain (ATCC 31821). The ZM4-dCas12a strain of the present invention is obtained with reference to "Shen Wei: Construction and Application of Zymomonas mobilis Dual Reporter Gene System and CRISPR-Cas12a Genome Editing System [D]. Hubei University; 2020." method.

[0028] The term "encoding" includes reference to nucleotides and / or amino acids that correspond to other nucleotides or amino acids in a transcriptional and / or translational sense.

[0029] A "fusion protein" is a hybrid protein expressed by a nucleic acid molecule comprising the nucleotide sequences of at least two genes. In this way, a fusion protein comprises at least two amino acid sequences that are not related to each other in nature.

[0030] “R93A / S101A double mutant SoxS” or “SoxS double mutant (R93A / S101A)” or “SoxS-mut(R93A / S101A)” or “SoxS(R93A / S101A)” all have the same meaning. The R93A / S101A mutation uncouples the transcriptional activation function of SoxS from its endogenous DNA binding ability, so that the above-mentioned transcriptional activation effector protein complex can still effectively activate transcription, but will not non-specifically bind to endogenous SoxS targets in the host genome.

[0031] Example 1

[0032] 1. Construction of a dCas12a transcriptional activation system with a SoxS double mutant (R93A / S101A) as a transcriptional activator

[0033] In order to construct a programmable transcriptional activation system in Zymomonas mobilis, the present invention selected the SoxS double mutant (R93A / S101A) as a transcriptional activator. SoxS is a key transcriptional activator for bacteria to cope with oxidative stress and antibiotic pressure. The SoxS double mutant (R93A / S101A) not only retains complete CRISPRa activity, but also reduces the non-targeted activation of endogenous SoxS-dependent genes, making the SoxS double mutant (R93A / S101A) only rely on dCas12a targeting to activate the target gene.

[0034] (one) Construction of homologous recombination plasmid GS-Y-SoxS-mut and recombinant strain GS-Y :Use GS-Y-Linker to connect SoxS-mut (R93A / S101A) and dCas12a (such as Figure 3 shown)

[0035] First, the SoxS gene was amplified from the genome of Escherichia coli E.Coli K12 strain, and SoxS was mutated into a SoxS double mutant (R93A / S101A) by designing primers. The SoxS double mutant (R93A / S101A) was integrated into dCas12a by homologous recombination, and the two were connected using a protein linker (GS-Y-Linker, amino acid sequence as shown in SEQ ID NO: 5) for fusion expression to obtain the homologous recombinant plasmid GS-Y-SoxS-mut. The specific steps are as follows:

[0036] 1. Extract the genomes of ZM4 and ZM4-dCas12a strains respectively

[0037] 2 mL of overnight culture solution was collected and the genome was extracted using a kit.

[0038] 2. Obtain the chloramphenicol resistance gene cat fragment and the replication origin ori fragment respectively

[0039] The chloramphenicol resistance gene cat fragment was amplified from the pEZ15A plasmid constructed in the laboratory's early patent CN110408642A and recovered by gel. The ori fragment was amplified from the pUC57 plasmid (universal plasmid) and recovered by gel.

[0040] 3. Obtain upstream and downstream homology arm (US and DS) sequences respectively

[0041] Design primers with homology to the above-mentioned cat fragment and ori fragment. Using the ZM4-dCas12a genome as a template, PCR amplify the last 1kb sequence (US sequence) of the dCas12a gene after removing the stop codon and gel recovery. Using the ZM4 genome as a template, PCR amplify the 1kb sequence (DS sequence) downstream of the ZMO0038 gene and gel recovery.

[0042] 4. Obtain the SoxS-mut (R93A / S101A) gene

[0043] The SoxS gene was amplified from the Escherichia coli MG1655 genome and recovered by gel amplification. A SoxS double mutant (R93A / S101A), i.e., SoxS-mut(R93A / S101A), was mutated using the following primers: SoxS-mut-F: GCGCGGCAGTTTGATCGCACTCCCGCGGATTATCGCCACCGCC (as shown in SEQ ID NO: 18); SoxS-mut-R: CGCGGGAGTGCGATCAAACTGCCGCGCGAAAACGCGGGAGAAG (as shown in SEQ ID NO: 19). These primers cover the R93 and S101 sites, respectively, and the bases were replaced by inverse PCR, resulting in the mutations to R93A and S101A.

[0044] 5. Obtain homologous recombination GS-Y-SoxS-mut integration plasmid

[0045] The linear fragments US, DS, ori, SoxS-mut, and cat (mixed at a molar ratio of 1:1:1:1:1) obtained above were subjected to a one-step Gibson assembly of the cloned enzyme and placed in a 50°C metal bath for 30 minutes. The reaction system is as follows:

[0046] Table 1 Gibson assembly based on one-step cloning enzyme

[0047] Reagents volume US linear segment 0.03pM DS linear segment 0.03pM ori linear fragment 0.03pM cat linear fragment 0.03pM SoxS-mut linear fragment 0.03pM 2×CEMix 5μL <![CDATA[ddH2O]]> To10μL

[0048] The plasmid was transformed into competent E. coli DH5α cells, and the positive clones on the plate were verified by PCR. After overnight culture, the plasmid was extracted using a plasmid extraction kit.

[0049] The primers used in steps 2-5 above (construction of GS-Y-SoxS-mut integration plasmid) are as follows:

[0050] US-F: sequence shown in SEQ ID NO: 20;

[0051] US-GS-YR: (as shown in SEQ ID NO: 21);

[0052] DS-F and DS-R: sequences are shown in SEQ ID NOs: 22-23, respectively; Cat-F and Cat-R: sequences are shown in SEQ ID NOs: 24-25, respectively; Ori-F and Ori-R: sequences are shown in SEQ ID NOs: 26-27, respectively;

[0053] GS-YF: (as shown in SEQ ID NO: 28); SoxS-R: sequence as shown in SEQ ID NO: 29;

[0054] The underlined parts in primers US-GS-YR and GS-YF are the homologous overlapping arms, and the underlined and wavy parts are the GS-Y-Linker gene sequences.

[0055] 6. Construction of recombinant strain GS-Y

[0056] (1) Preparation of competent cells:

[0057] Take out the frozen ZM-dCas12a bacteria from the -80℃ freezer, take 100μL and inoculate it into a cryovial containing 1mL RMG5, and place it in a 30℃ incubator to activate the strain. After culturing until turbidity, transfer it to a 250mL blue-capped bottle containing 200mL RMG5 liquid medium to make the initial OD 600nm In the range of 0.025 to 0.3, culture in a 30°C incubator until OD 600nm When the pH exceeds 0.3, harvest the cells at room temperature and 100 rpm. Wash once with sterile water and twice with 10% (v / v) glycerol. Finally, slowly resuspend the cells in 1-2 mL of 10% glycerol and aliquot 55 μL of competent medium into a 1.5 mL EP tube. (RMG5 solid medium: 50 g / L glucose, 10 g / L yeast extract, 2 g / L KH2PO4, 3 g / L agar; RMG5 liquid medium: 50 g / L glucose, 10 g / L yeast extract, 2 g / L KH2PO4).

[0058] (2) Conversion

[0059] Add 500 ng of the plasmid for homologous recombination to 55 μL of competent medium in a 1.5 mL EP tube. Mix gently and transfer to a 1 mm electroporation cuvette. Set the electroporator to 200 Ω, 25 μF capacitance, and 1.6 kV. Place the cuvette in the electroporator for electroporation. Immediately after electroporation, add 1 mL of RMG5 liquid medium, mix thoroughly, and transfer to a sterile EP tube. Seal the tube with parafilm and incubate in a 30°C incubator for 4-6 hours. Evenly spread 100 μL of the bacterial solution onto an RMG5 + chloramphenicol plate (containing 100 μg / mL chloramphenicol). Seal the plate with parafilm and invert it in a 30°C incubator.

[0060] (3) PCR verification

[0061] After a single colony grows on the plate, PCR verification is performed on the single colony using primers that verify successful editing (YZ-F and YZ-R: sequences are shown in SEQ ID NOs: 30-31, respectively). The PCR system and PCR procedure are as follows:

[0062] Colony PCR system

[0063] Reagents volume F-primer (10 μM) 0.4μL R-primer (10 μM) 0.4μL 2×T5SuperPCRMix(Tsingke) 5μL <![CDATA[Template(Single colony dissolved in 10 μL ddH2O)]]> 1 μL <![CDATA[ddH2O]]> 3.2 μL Total volume 10 μL

[0064] PCR procedure

[0065]

[0066] The correct positive clones were sequenced and verified, activated in the RMG5+chloramphenicol medium, and maintained in glycerol.

[0067] (two) Construction of homologous recombination plasmid GS-SoxS-mut and recombinant strain GS :Use GS-Linker to connect SoxS-mut (R93A / S101A) and dCas12a

[0068] The method steps differ from those in the above-mentioned "Construction of homologous recombination plasmid GS-Y-SoxS-mut and recombinant strain GS-Y" in that GS-Linker (amino acid sequence shown in SEQ ID NO: 6) is used instead of GS-Y-Linker; correspondingly, the primers used are different as follows:

[0069] US-GS-R (sequence shown in SEQ ID NO: 32) was used to replace US-GS-YR;

[0070] GS-F (sequence shown in SEQ ID NO: 33) was used to replace GS-YF.

[0071] (three) Construction of homologous recombination plasmid XTEN-SoxS-mut and recombinant strain XTEN: Use XTEN-Linker to connect SoxS-mut (R93A / S101A) and dCas12a

[0072] The method steps described above differ from those in the "Construction of homologous recombination plasmid GS-Y-SoxS-mut and recombinant strain GS-Y" in that XTEN-Linker (amino acid sequence shown in SEQ ID NO: 7) is used instead of GS-Y-Linker; correspondingly, the primers used are different as follows:

[0073] Primer US-XTEN-R: (sequence shown in SEQ ID NO: 34) was used to replace primer US-GS-YR;

[0074] Primer XTEN-F: (sequence shown in SEQ ID NO: 35) was used to replace primer GS-YF.

[0075] 2. Construction of a SPY-coupled CRISPRa transcriptional activation system

[0076] The present invention introduces the SPY system, derived from the fibronectin-binding protein of Streptococcus pyogenes, into strain ZM4-dCas12a to recruit more copies of transcription activators and increase the rate of transcriptional activation. The SPY system consists of two parts, the SpyTag short peptide and the SpyCatcher protein, which can perform highly specific covalent recombination in vivo and in vitro, with a rapid reaction and without the need for additional cofactors and enzymes.

[0077] (I) Construction of homologous recombination plasmid 2×SpyTag-dCas12a:

[0078] Refer to the above-mentioned “Construction of homologous recombination plasmid GS-Y-SoxS-mut” method, but after integrating the 2×SpyTag gene into dCas12a, the two are connected by protein Linker (amino acid as shown in SEQ ID NO: 8) (replacing the above-mentioned GS-Y-linker). The specific steps are: extract the genomes of strains ZM4 and ZM4-dCas12a, and obtain the chloramphenicol resistance gene cat fragment, the replication origin ori fragment and the upstream and downstream homologous arm sequences, as well as the 2×SpyTag gene sequence, the synthesis of the 2×SpyTag gene and the SpyCatcher gene and the codon optimization for the Zmobilis genome are completed by a third-party company (Jin Weizhi). These linear fragments are assembled by Gibson with a one-step cloning enzyme and transformed into Escherichia coli DH5α cells. The positive clones on the plate are verified by PCR, and the plasmid is extracted with a plasmid extraction kit after overnight culture. The difference between the primers used is:

[0079] Primer US-2×SpyTag-R: (sequence shown in SEQ ID NO: 36) was used to replace primer US-GS-YR;

[0080] 2×SpyTag-F: (sequence shown in SEQ ID NO: 37) and 2×SpyTag-R: (sequence shown in SEQ ID NO: 38) were used to replace primers GS-YF and SoxS-R.

[0081] (II) Construction of the fusion expression plasmid SpyCatcher-SoxS-mut:

[0082] The endogenous plasmid pZM39 vector was amplified from the p39-Ptet-araC-T7P-Cm plasmid constructed in the laboratory's early patent CN114774453A and recovered by gel. The SoxS-mut gene was amplified from the recombinant plasmid GS-Y-SoxS-mut and recovered by gel. The SpyCatcher gene was synthesized by Jin Weizhi Company. Then, referring to the method in the above-mentioned "Construction of Homologous Recombination Plasmid GS-Y-SoxS-mut", the protein Linker (-GGSGSGLQ-) was used to replace the above-mentioned GS-Y-linker, and a one-step Gibson assembly of the clone enzyme was performed. The clones were transformed into the competent Escherichia coli DH5α cells, and the positive clones on the plate were verified by PCR. The plasmid was extracted after overnight culture. The primers used are as follows:

[0083] 39-p-FK-F and 39-p-FK-R: (sequences shown in SEQ ID NOs: 39-40, respectively); Sox-F and Sox-R: (sequences shown in SEQ ID NOs: 41-42, respectively); SpyCatcher-F and SpyCatcher-R: (sequences shown in SEQ ID NOs: 43-44, respectively)

[0084] 3. Construction of fluorescent reporter gene test plasmid

[0085] The exogenous promoters J23109, J23110, J23112, J23113, J23115, and J23117, and the endogenous promoters ZMO0300, ZMO1644, and ZMO1561 used in the present invention were constructed as follows:

[0086] 1. Insertion of guide RNA

[0087] Select a sequence upstream of the promoter to be tested and 23 bp downstream of the PAM site and TTTN site as the targeting primer sequence for constructing the guide RNA in the target plasmid to guide the nuclease to the target site. The specific primer sequences are as follows (the first 4 bases of each primer are set as a linker to complement the vector after enzyme digestion):

[0088] Exogenous promoter test plasmid guide RNA primers:

[0089] On-target-1-F and On-target-1-R: (sequences shown in SEQ ID NOs: 45-46, respectively);

[0090] On-target-2-F and On-target-2-R: (sequences shown in SEQ ID NOs: 47-48, respectively);

[0091] Endogenous promoter ZMO0300, ZMO1644, ZMO1561 test plasmid guide RNA primers:

[0092] 0300-gR-1-F and 0300-gR-1-R: (sequences shown in SEQ ID NOs: 49-50, respectively);

[0093] 0300-gR-2-F and 0300-gR-2-R: (sequences shown in SEQ ID NOs: 51-52, respectively);

[0094] 0300-gR-3-F and 0300-gR-3-R: (sequences shown in SEQ ID NOs: 53-54, respectively);

[0095] 1644-gR-1-F and 1644-gR-1-R: (sequences shown in SEQ ID NOs: 55-56, respectively);

[0096] 1644-gR-2-F and 1644-gR-2-R: (sequences shown in SEQ ID NOs: 57-58, respectively);

[0097] 1561-gR-1-F and 1561-gR-1-R: (sequences shown in SEQ ID NOs: 59-60, respectively);

[0098] 1561-gR-2-F and 1561-gR-2-R: (sequences shown in SEQ ID NOs: 61-62, respectively);

[0099] The guide RNA primer sequence was connected to the kanamycin editing plasmid vector containing the CRISPR-Cas12a expression unit (using the editing plasmid containing the CRISPR expression unit in the laboratory's previous patent CN110358767A, referring to the method disclosed in "Construction and Application of Plasmid pUC19-CM-D [J] Anhui Agricultural Science, 2010, No. 19", and inserting Kan into the editing plasmid r Marker gene), the steps are as follows:

[0100] First, the vector was linearized using the restriction endonuclease BsaⅠ. The guide RNA primer pair was then annealed (1 μL of each 10 μM primer was added to 10 μL with water, denatured at 95°C for 5 minutes, and then cooled to room temperature for later use). The annealed product was ligated to the linearized vector using T4 DNA ligase and then transformed into the E. coli cloning strain DH5α for plasmid construction. Recombinants were screened by colony PCR and finally verified by sequencing. The BsaⅠ digestion and T4 DNA ligase enzyme systems were as follows:

[0101] Table 1 BsaⅠ enzyme digestion reaction system

[0102]

[0103] Table 2 T4 DNA ligase enzyme reaction system

[0104]

[0105] 2. Test plasmid construction

[0106] The plasmid vector obtained after T4 DNA ligase ligation was subjected to reverse PCR amplification, and the reporter gene mCherry (NCBI Sequence ID: PV290159.1, Range 1: 2965 to 3674), J3 sequence (as shown in SEQ ID NO: 63) and promoter sequence (as shown in SEQ ID NO: 9-17, respectively) were PCR amplified (all synthesized by GENEWIZ). All fragments were connected using a one-step cloning kit. The reporter gene test plasmid map is shown in Figure 2. Figure 4 As shown, the plasmid was transformed into competent E. coli DH5α cells, the positive clones on the plate were verified by PCR, and the plasmid was extracted after overnight culture.

[0107] The primers for constructing the exogenous promoters J23109, J23110, J23112, J23113, J23115, and J23117, and the endogenous promoters ZMO0300, ZMO1644, and ZMO1561 test plasmids are as follows:

[0108] PEZ-FK-F and PEZ-FK-R: (plasmid vector reverse amplification primers, sequences shown in SEQ ID NOs: 64-65, respectively);

[0109] Mc-F and Mc-R: (mCherry reporter gene amplification primers, sequences shown in SEQ ID NOs: 66-67, respectively);

[0110] J3-F and J3-R: (sequences shown in SEQ ID NOs: 68-69, respectively);

[0111] The above three pairs of primers are universal primers for constructing exogenous promoters J23109, J23110, J23112, J23113, J23115, and J23117, and endogenous promoters ZMO0300, ZMO1644, and ZMO1561 test plasmids. The specific primers for constructing these promoter test plasmids are as follows:

[0112] J23109 test plasmid primers: 23109-F and 23109-R: (sequences shown in SEQ ID NOs: 70-71, respectively);

[0113] J23110 test plasmid primers: 23110-F and 23110-R: (sequences shown in SEQ ID NOs: 72-73, respectively);

[0114] J23112 test plasmid primers: 23112-F and 23112-R: (sequences shown in SEQ ID NOs: 74-75, respectively);

[0115] J23113 test plasmid primers: 23113-F and 23113-R: (sequences shown in SEQ ID NOs: 76-77, respectively);

[0116] J23115 test plasmid primers: 23115-F and 23115-R: (sequences shown in SEQ ID NOs: 78-79, respectively);

[0117] J23117 test plasmid primers: 23117-F and 23117-R: (sequences shown in SEQ ID NOs: 80-81, respectively);

[0118] ZMO0300 test plasmid primers: 0300-F and 0300-R: (sequences shown in SEQ ID NOs: 82-83, respectively);

[0119] ZMO1644 test plasmid primers: 1644-F and 1644-R: (sequences shown in SEQ ID NOs: 84-85, respectively);

[0120] ZMO1561 test plasmid primers: 1561-F and 1561-R: (sequences shown in SEQ ID NOs: 86-87, respectively).

[0121] 3. Plasmid transformation

[0122] The homologous recombination plasmid 2×SpyTag-dCas12a was electroporated into the ZM-dCas12a competent state, and the strain with successful integration (2×SpyTag and dCas12a) was made competent and electroporated with the fusion expression plasmid SpyCatcher-SoxS-mut to obtain The recombinant strain was designated as 2×Spy Finally, the fluorescent reporter gene test plasmid was electroporated. After colony PCR and sequencing verification, the cells were cultured in deep-well plates and analyzed by flow cytometry.

[0123] In the fluorescent reporter gene test of the dCas12a transcriptional activation system with the SoxS double mutant (R93A / S101A) as the transcriptional activator, the homologous recombinant plasmid GS-Y-SoxS-mut, GS-SoxS-mut or XTEN-SoxS-mut was electroporated and integrated into the ZM-dCas12a genome. The recombinant strains were designated as GS-Y, GS, and XTEN. The cells were then electroporated with the fluorescent reporter gene test plasmid described above. After colony PCR and sequencing verification, the cells were cultured in deep-well plates and analyzed using flow cytometry.

[0124] 4. Deep-well plate culture and flow cytometric analysis

[0125] The constructed recombinant strains were detected and analyzed using a flow cytometer CytoFLEX FCM (Beckman Coulter, Inc, USA). The cells were first washed twice with phosphate buffered saline (PBS) and then resuspended in PBS to a concentration of OD 600 The mCherry signal was approximately 0.1, and mCherry was detected at a wavelength of 561 nm. At least 20,000 events were analyzed for each sample, with three biological replicates per sample. The measured data were processed using FlowJo software (FlowJo, LLC, USA).

[0126] Example 2

[0127] The Anderson family synthetic promoters belong to σ 70 Family promoters, which have clear -10 and -35 regions, can be targeted more accurately. Figure 1 The elements shown in the figure were used to construct test plasmids of 6 different exogenous promoters (J23109, J23110, J23112, J23113, J23115 or J23117), and the control group (guide RNA was not inserted into the target-off test plasmid). The specific steps are as shown in Example 1. The 70bp site upstream of the TSS site (Transcription Start Site) was selected as the target target-1, and the 81bp site upstream of the TSS was selected as the target target-2. The constructed test plasmids were electroporated into the test strain GS-Y (i.e., the dCas12a-SoxS (R93A / S101A) system connected using GS-Y-Linker), and the recombinant strain successfully transferred into the test plasmid was cultured in a 48-well deep well plate. Three parallel replicates were set for each test strain, and flow cytometry was used for detection after 8 hours of culture.

[0128] The results are as follows Figure 5The GS-Y-Linker-linked dCas12a-SoxS (R93A / S101A) system targeting 70 bp upstream of the TSS showed stronger activation than that targeting 81 bp upstream of the TSS. Promoters J23110 and J23117 showed the highest activation rates, with the J23110 promoter activating the reporter gene by 1.79±0.052-fold and the J23117 promoter activating the reporter gene by 1.723±0.1-fold.

[0129] Example 3

[0130] According to the method in Example 1, dCas12a and SoxS (R93A / S101A) were connected using XTEN-Linker, that is, XTEN-SoxS (R93A / S101A) was integrated into dCas12a via homologous recombination plasmid XTEN-SoxS-mut to obtain the recombinant strain XTEN. The same method was used to connect dCas12a and SoxS (R93A / S101A) using GS-Linker to obtain the recombinant strain GS. Exogenous promoters J23110, J23115, and J23117 were selected for testing, and the target site was 81 bp upstream of TSS.

[0131] The results are as follows Figure 6 GS-Y-Linker had the best activation effect on J23117, activating the reporter gene by 1.39±0.036 times; XTEN-Linker had the best activation effect on J23110, activating the reporter gene by 1.41±0.083 times.

[0132] Example 4

[0133] According to the method in Example 1, test plasmids containing the promoter sequences of the ZMO0300, ZMO1644, and ZMO1651 genes (endogenous promoters in the Zmobilis genome) were constructed. Two target sites (gR-1 / gR-2) were selected for each endogenous promoter for transcriptional activation test. The target sites selected for the ZMO0300 promoter were the 75 bp sense chain upstream of the TSS and the 86 bp antisense chain upstream of the TSS; the target sites selected for the ZMO1644 promoter were the 145 bp sense chain upstream of the TSS and the 93 bp sense chain upstream of the TSS; and the target sites selected for the ZMO1561 promoter were the 86 bp sense chain upstream of the TSS and the 97 bp antisense chain upstream of the TSS.

[0134] The test results are as follows Figure 7Neither the XTEN nor the GS-Y recombinant strains significantly activated the endogenous ZMO1644 promoter, possibly because the ZMO1644 promoter's σ factor belongs to the σ54 family or because a suitable target site was not found. However, they activated ZMO0300 and ZMO1651 to some extent. The XTEN recombinant strain activated the ZMO0300 promoter by 2.39±0.068-fold and the ZMO1561 promoter by 2.03±0.093-fold; the GS-Y recombinant strain activated the ZMO0300 promoter by 1.96±0.075-fold and the ZMO1561 promoter by 1.59±0.017-fold.

[0135] Example 5

[0136] According to the method in Example 1, the recombinant strain 2×Spy was constructed and the activation test of the endogenous promoter ZMO0300 test plasmid was performed. Three target sites were selected for each promoter for testing. Figure 8 As shown, after the SPY system was introduced into ZM4-dCas12a, the fluorescent reporter gene could be activated by 3.36±0.307 times when targeting the 86bp antisense strand upstream of the ZMO0300 promoter TSS.

[0137] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A Zymomonas mobilis transcriptional activation system, characterized in that: It includes a crRNA targeting the promoter regulatory region of the target gene and a sequence encoding an effector protein complex; the components of the effector protein complex include the following (a1) or (a2): (a1) dCas12-SoxS, a fusion protein of dCas12a and R93A / S101A double-mutated SoxS, wherein dCas12a and SoxS are connected by a Linker-1 of 8-20 amino acids in length; (a2) a fusion protein of dCas12a and 2×SpyTag, dCas12a-2×SpyTag, wherein dCas12a and 2×SpyTag are connected via a Linker-2 having a length of 8 to 20 amino acids; and a fusion protein of R93A / S101A double-mutated SoxS and SpyCatcher, SoxS-SpyCatcher, wherein SoxS and SpyCatcher are connected via a Linker-3 having a length of 8 to 20 amino acids; the fusion protein dCas12a-2×SpyTag is covalently bound to SoxS-SpyCatcher via an isopeptide bond formed by SpyTag / SpyCatcher; The gene sequence encoding the dCas12a is shown in SEQ ID NO: 1; The gene sequence encoding the R93A / S101A double mutant SoxS is shown in SEQ ID NO: 2; The gene sequence encoding the 2×SpyTag is shown in SEQ ID NO: 3; The gene sequence encoding the SpyCatcher is shown in SEQ ID NO:

4.

2. The transcriptional activation system according to claim 1, characterized in that The Linker-1, Linker-2 and Linker-3 are independently selected from one of SEQ ID NOs: 5-8.

3. Use of the transcriptional activation system according to claim 1 in regulating gene expression.

4. The use according to claim 3, characterized in that To activate σ 70 family promoter and at least one of a promoter endogenous to Zymomonas mobilis.

5. The use according to claim 4, characterized in that Used to activate at least one of the following promoters: The J23109 promoter sequence is shown in SEQ ID NO: 9, the J23110 promoter sequence is shown in SEQ ID NO: 10, The J23112 promoter sequence is shown in SEQ ID NO: 11, the J23113 promoter sequence is shown in SEQ ID NO: 12, The J23115 promoter sequence is shown in SEQ ID NO: 13, the J23117 promoter sequence is shown in SEQ ID NO: 14, The ZMO0300 promoter has a sequence shown in SEQ ID NO:15, the ZMO1644 promoter has a sequence shown in SEQ ID NO:16, and the ZMO1561 promoter has a sequence shown in SEQ ID NO:

17.

6. A Zymomonas mobilis transcriptional activation effector protein complex, characterized in that: include: dCas12-SoxS, a fusion protein of dCas12a and R93A / S101A double-mutated SoxS, in which dCas12a and SoxS are connected by a Linker-1 of 8-20 amino acids in length; The gene sequence encoding the dCas12a is shown in SEQ ID NO: 1; the gene sequence encoding the R93A / S101A double mutant SoxS is shown in SEQ ID NO:

2.

7. A Zymomonas mobilis transcriptional activation effector protein complex, characterized in that: include: The fusion protein of dCas12a and 2×SpyTag, dCas12a-2×SpyTag, is connected by a Linker-2 with a length of 8 to 20 amino acids. and SoxS-SpyCatcher, a fusion protein of SoxS with R93A / S101A double mutations and SpyCatcher, wherein SoxS and SpyCatcher are connected by a Linker-3 with a length of 8 to 20 amino acids; The fusion protein dCas12a-2×SpyTag is covalently bound to SoxS-SpyCatcher via an isopeptide bond formed by SpyTag / SpyCatcher; The gene sequence encoding the dCas12a is shown in SEQ ID NO: 1; the gene sequence encoding the R93A / S101A double mutant SoxS is shown in SEQ ID NO: 2; the gene sequence encoding the 2×SpyTag is shown in SEQ ID NO: 3; and the gene sequence encoding the SpyCatcher is shown in SEQ ID NO:

4.

8. Use of the transcriptional activation effector protein complex according to claim 6 or 7 in gene expression regulation.

9. The use according to claim 8, characterized in that To activate σ 70 family promoter and at least one of a promoter endogenous to Zymomonas mobilis.

10. The use according to claim 9, characterized in that Used to activate at least one of the following promoters: The J23109 promoter sequence is shown in SEQ ID NO: 9, the J23110 promoter sequence is shown in SEQ ID NO: 10, The J23112 promoter sequence is shown in SEQ ID NO: 11, the J23113 promoter sequence is shown in SEQ ID NO: 12, The J23115 promoter sequence is shown in SEQ ID NO: 13, the J23117 promoter sequence is shown in SEQ ID NO: 14, The ZMO0300 promoter sequence is shown in SEQ ID NO: 15, the ZMO1644 promoter sequence is shown in SEQ ID NO: 16, and the ZMO1561 promoter whose sequence is shown in SEQ ID NO:17.

Images