Double-target synergistic nucleic acid composition and application thereof in electrochemical detection of hematopoietic stem cells

Abstract

A nucleic acid composition is used for electrochemical detection of hematopoietic stem cells, CD133 and CD45 on the surfaces of the hematopoietic stem cells are selected as targets, and an electrochemical detection means for accurate recognition and quantitative analysis of the hematopoietic stem cells is constructed by cooperatively activating trans-cleavage activity of Cas12a with the help of double targets. The composition provided by the invention is used for high-sensitivity, qualitative and quantitative detection of hematopoietic stem cells, and overcomes the defects that methods such as a colony culture method and a flow cytometry detection method are not only susceptible to interference, but also relatively high in experimental technical requirements and cost, and tedious in data processing.

Description

Technical Field

[0001] The present invention relates to a composition for detection, in particular to a nucleic acid composition for detecting stem cells, which uses CD133 and CD45 on the surface of hematopoietic stem cells as targets to achieve qualitative and quantitative detection of cells. Background Art

[0002] Hematopoietic stem cells (HSCs), a core member of the adult stem cell family, are primarily found in the bone marrow, peripheral blood, and umbilical cord blood. They possess the dual properties of self-renewal and multipotential differentiation. They maintain the stability of the stem cell pool through asymmetric division and can differentiate into myeloid and lymphoid progenitor cells, subsequently generating a variety of mature blood cells. Their function changes with age: rapid proliferation during the embryonic stage to establish the hematopoietic system, maintaining homeostasis in adulthood, and functional decline in old age due to telomere shortening, epigenetic alterations, and microenvironmental degradation. These age-related functional changes provide important insights into age-related blood diseases.

[0003] The significance of multi-target detection in hematopoietic stem cell detection is that it can more comprehensively and accurately evaluate their functions and characteristics, thereby providing important support for clinical applications and disease treatment. Hematopoietic stem cells have the characteristics of self-renewal, multidirectional differentiation and homing, and are key cells for maintaining blood system homeostasis and repairing damage. Through multi-target detection, multiple markers (such as CD45, CD133, etc.) can be analyzed simultaneously to more accurately evaluate the quantity and quality of hematopoietic stem cells and optimize the clinical application of hematopoietic stem cell transplantation. In addition, multi-target detection can also be used to monitor the recovery of hematopoietic function after transplantation, predict the success rate of transplantation, and provide richer biological information for the diagnosis, treatment monitoring and prognosis evaluation of blood system diseases.

[0004] In recent years, CRISPR-Cas12a technology has shown significant application prospects in cell surface protein detection. With its efficient trans-cleavage activity, the CRISPR-Cas12a system can recognize specific nucleic acid sequences and activate cleavage, thereby achieving signal amplification and significantly improving detection sensitivity. Combined with electrochemical biosensors or fluorescence imaging technology, the CRISPR-Cas12a system can convert the detection of cell surface proteins into measurable electrical or fluorescent signals, providing a new tool for highly sensitive and specific cell marker detection, and offering more efficient and accurate detection methods for disease diagnosis, drug development, and cell function research.

[0005] Currently, the main methods for detecting and collecting hematopoietic stem cells include colony culture method, flow cytometry detection, etc. However, these methods are not only susceptible to interference, but also have high experimental technical requirements and costs, and also have the disadvantage of cumbersome data processing.

[0006] Electrochemical methods are of great significance in the application of molecular recognition and biosensing. Their advantages such as high sensitivity, strong specificity, simple operation, and low cost make them show broad application prospects in the field of life sciences. Commonly used electrochemical techniques include cyclic voltammetry (CV), differential pulse voltammetry (DPV), square wave voltammetry (SWV), linear sweep voltammetry (LSV), and electrochemical impedance spectroscopy (EIS). Among them, square wave voltammetry (SWV) has attracted much attention due to its high sensitivity and high efficiency. These methods have been widely used in various fields such as industry, agriculture, environment, medicine, food, and life sciences. Combined with new functional nanomaterials and evolving discipline theories, electrochemical methods provide more efficient and accurate solutions for life science research, health monitoring, and environmental testing. Summary of the Invention

[0007] An object of the present invention is to provide a composition for detecting hematopoietic stem cells, which uses dual targets to synergistically activate the trans-cleavage activity of Cas12a and perform efficient qualitative detection of cells by electrochemical means.

[0008] Another object of the present invention is to provide a composition for detecting hematopoietic stem cells, which uses electrochemical means to perform efficient quantitative detection of cells.

[0009] Another object of the present invention is to provide a reagent composition or kit for detecting hematopoietic stem cells.

[0010] A simple and sensitive electrochemical analysis method is proposed for the detection of hematopoietic stem cells. The present invention selects CD133 and CD45 on the surface of hematopoietic stem cells as targets, and constructs an electrochemical detection method for the accurate identification and quantitative analysis of hematopoietic stem cells by synergistically activating the trans-cleavage activity of Cas12a with the help of dual targets.

[0011] The nucleic acid composition of the present invention comprises:

[0012] One end of P1 and P2 contains aptamer sequences of CD133 and CD45, respectively, which can recognize and bind to hematopoietic stem cells, and the other end complementarily binds to the two ends of crRNA for subsequent electrochemical signal amplification.

[0013] The P1 sequence is: 5'-TACCAGTGCCGTTTCCCCGGAGGGTCACCCCTGACGCATTCGGTTGACTTTTTTTTTTTTCCAGCCAATA-3';

[0014] The P2 sequence is: 5′-ACCGTGTCCAATCTTTTTTTTTTTCGCTCGATAGATCGAGCTTC GCTCGATGTGGTGTTGTGGGGGCTTGTATTGGTCGATCACGCTCTAGAGCACTG-3′;

[0015] The T sequence is: 5′-TCAGCCGCTGTCACACGCACAGCCTGGACTGA-3′;

[0016] The sequence of crRNA is: 5'-UAAUUUCUACUCUUGUAGAUUGGACACGGUUAUUGGC UGG-3'.

[0017] When P1 and P2 are present in the solution at the same time, one end of P1 or P2 containing the aptamer sequence can bind to the hematopoietic stem cells, and the other end can complementarily bind to the two ends of the crRNA in the CRISPR-Cas12a system, synergistically activating the trans-cleavage activity of Cas12a for subsequent electrochemical signal amplification.

[0018] The T-strand acts as a trans-cleavage active cleavage signal strand, onto which chemical groups are attached to respond to electrochemical detection, such as methylene blue (MB) modification at its 3' end. The MB-modified short strand after cleavage can bind to a hydroxylated ITO electrode, generating a significant electrochemical signal.

[0019] The hydroxylated ITO electrode can capture short chains modified with the electrochemical signal substance methylene blue (MB), generating a corresponding electrochemical signal. Therefore, sensitive detection of hematopoietic stem cells can be achieved by measuring the electrochemical signal of MB on the ITO surface.

[0020] When there are no hematopoietic stem cells in the reaction system, P1 and P2 are removed by centrifugation, the trans-cutting activity of Cas12a is not activated, the signal chain T is not cut, and the long DNA chain is not easy to approach the hydroxylated ITO electrode due to its negative charge. Therefore, no electrochemical signal is detected in the final reaction system.

[0021] Electrochemical signal detection was performed using a three-electrode system on a CHI-660C electrochemical workstation. The auxiliary electrode was a platinum wire, the reference electrode was a saturated calomel electrode, the working electrode was an ITO electrode, and the buffer was 20 mM Tris-HCl. The solution was thoroughly deoxygenated using high-purity nitrogen gas, and a nitrogen flow was used throughout the electrochemical detection process to maintain the solution anaerobic. The parameters for square wave voltammetry (SWV) were as follows: potential scan range, Potential step, 4 mV; amplitude, 25 mV; frequency, 15 Hz.

[0022] Compared with the prior art, the technical solution of the present invention has the following beneficial effects:

[0023] The nucleic acid composition of the present invention is based on the recognition of hematopoietic stem cell surface markers CD133 and CD45, and is combined with an electrochemical method for co-activating CRISPR / Cas for highly sensitive, qualitative and quantitative detection of hematopoietic stem cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is a schematic diagram of the principle of detecting hematopoietic stem cells according to the present invention;

[0025] Figure 2 Figure 2 is a graph showing the agarose gel electrophoresis verification results of the synergistic activation of Cas12a in a solution system;

[0026] Figure 3 Figure 2 is the electrochemical signal response result diagram of each experimental group;

[0027] Figure 4 The graph shows the electrochemical signal intensity response results of various numbers of cells. DETAILED DESCRIPTION

[0028] The technical solution of the present invention is described in detail below with reference to the accompanying drawings. The embodiments of the present invention are intended only to illustrate the technical solution of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that the technical solution of the invention may be modified or replaced with equivalents without departing from the spirit and scope of the technical solution of the present invention, and all such modifications or equivalents should be included in the scope of the claims of the present invention.

[0029] Figure 1 This is a schematic diagram of the principle of detecting hematopoietic stem cells according to the present invention. The specific method includes:

[0030] According to the above mechanism, the method scheme adopted by the present invention mainly includes the following steps:

[0031] (a) Preparation of ITO electrodes: First, the ITO electrodes were cleaned with ethanol and then deionized water. The ITO electrodes were then immersed in a solution (28% NH3·H2O:30% H2O2:H2O = 1:1:6, v / v / v) and heated in an 85°C water bath for 25–30 minutes to obtain a hydroxylated surface. The electrodes were then rinsed with deionized water and dried with nitrogen. The dried ITO electrodes were then immersed in a 1 mM NaOH solution for 4–5 hours, rinsed with deionized water, and dried with nitrogen to obtain hydroxyl-functionalized ITO electrodes.

[0032] (b) Feasibility verification of synergistic activation of Cas12a in a solution system: anneal the DNA chains used in the system. The specific operation is to place the DNA chains (P1, P2) in a 90°C metal bath for 5 to 10 minutes and then slowly cool to room temperature. Then, crRNA (200nM) and Cas12a (40pM) are reacted with 10×DNaseI Reaction Buffer at 37°C for 30 to 40 minutes. After the reaction, they are reacted with P1 (200nM), P2 (200nM), M chain (800nM), and TE Buffer at 37°C for 1 hour. Then, electrophoresis is performed for 30 to 40 minutes under 1×TAE buffer and 80 to 120V voltage. The agarose is imaged using the Doc XR+ gel imaging system.

[0033] (c) Feasibility verification of electrochemical analysis of hematopoietic stem cells. 2×10 5 Hematopoietic stem cells were incubated with P1 (1 μM) and P2 (1 μM) at 37 ° C for 20 to 30 minutes. Then, the hematopoietic stem cell solution combined with the P1 and P2 chains was centrifuged at 1200 rpm for 5 minutes, the supernatant was removed and the centrifugation and washing were repeated once. Subsequently, crRNA (200nM) and Cas12a (40pM) were reacted with 10×DNaseI Reaction Buffer at 37 ° C for 30 to 40 minutes, added to the above centrifuged cells, and then reacted with P1 (200nM), P2 (200nM), T chain (1 μM), and TE Buffer 37 ° C for 1 hour. Finally, the reaction solution was centrifuged at 1200 rpm for 5 minutes to collect the supernatant for subsequent electrochemical signal detection.

[0034] (d) Detection of electrochemical signals. Electrochemical measurements were performed using a three-electrode system on a CHI-660C electrochemical workstation. The auxiliary electrode was a platinum wire, the reference electrode was a saturated calomel electrode, the working electrode was the ITO electrode obtained in (a), and the buffer was 20 mM Tris-HCl. The solution was thoroughly deoxygenated by high-purity nitrogen gas, and a nitrogen flow was used throughout the electrochemical detection process to keep the solution anaerobic. The parameters of square wave voltammetry (SWV) are as follows: potential scan range, Potential step, 4 mV; amplitude, 25 mV; frequency, 15 Hz.

[0035] in:

[0036] The P1 sequence is: 5'-TACCAGTGCCGTTTCCCCGGAGGGTCACCCCTGACGCATTCGGTTGACTTTTTTTTTTTTCCAGCCAATA-3';

[0037] The P2 sequence is: 5′-ACCGTGTCCAATCTTTTTTTTTTTCGCTCGATAGATCGAGCTTC GCTCGATGTGGTGTTGTGGGGGCTTGTATTGGTCGATCACGCTCTAGAGCACTG-3′;

[0038] The M sequence is: 5'-AACAACAACTCTTCTCCGAGCCGGTCGAAATAGTGAAACAACA GGGCCGTCGAACACGAGCATGGTGCGTGGACCTAGGATGACCTGAGTACTGTCC-3';

[0039] The T sequence is: 5′-TCAGCCGCTGTCACACGCACAGCCTGGACTGA-MB-3′;

[0040] The sequence of crRNA is: 5'-UAAUUUCUACUCUUGUAGAUUGGACACGGUUAUUGGC UGG-3'.

[0041] In step (c), the 3' end of the T sequence is modified by MB.

[0042] Feasibility verification of synergistic activation of Cas12a in solution system of Example 1

[0043] Anneal the DNA chains used in the system. The specific operation is as follows:

[0044] DNA strands (P1 and P2) were reacted in a 90°C metal bath for 5–10 minutes and then slowly cooled to room temperature. Next, crRNA (200 nM) and Cas12a (40 pM) were reacted with 10× DNase I Reaction Buffer at 37°C for 30–40 minutes. Following this reaction, P1 (200 nM), P2 (200 nM), and the M strand (800 nM) were reacted with TE Buffer at 37°C for 1 hour. Electrophoresis was then performed in 1× TAE buffer at 80–120 V for 30–40 minutes. The agarose gel was imaged using the Doc XR+ gel imaging system.

[0045] The P1 sequence is: 5'-TACCAGTGCCGTTTCCCCGGAGGGTCACCCCTGACGCATTCGGTTGACTTTTTTTTTTTTCCAGCCAATA-3';

[0046] The P2 sequence is: 5′-ACCGTGTCCAATCTTTTTTTTTTTCGCTCGATAGATCGAGCTTC GCTCGATGTGGTGTTGTGGGGGCTTGTATTGGTCGATCACGCTCTAGAGCACTG-3′;

[0047] The M sequence is: 5'-AACAACAACTCTTCTCCGAGCCGGTCGAAATAGTGAAACAACA GGGCCGTCGAACACGAGCATGGTGCGTGGACCTAGGATGACCTGAGTACTGTCC-3';

[0048] The sequence of crRNA is: 5'-UAAUUUCUACUCUUGUAGAUUGGACACGGUUAUUGGC UGG-3'.

[0049] In order to verify the cleavage activity of Cas12a, the long-chain DNA, i.e., the M chain, was used as the cleavage substrate chain for agarose electrophoresis characterization study. The agarose gel electrophoresis verification results of the synergistic activation of Cas12a in the solution system are shown in Figure 2. Figure 2 As shown, lane 1 is the band corresponding to T, lane 2 is the band corresponding to the CRISPR-Cas12a system without P1 and P2, lane 3 is the band corresponding to the CRISPR-Cas12a system with only P1, lane 4 is the band corresponding to the CRISPR-Cas12a system with only P2, and lane 5 is the band corresponding to the CRISPR-Cas12a system containing P1 and P2 simultaneously. The electrophoresis result shows that only when P1 and P2 are present simultaneously in the solution system (lane 5), the trans-cleavage activity of Cas12a can be activated to cut the M chain. Thus, the feasibility of P1 and P2 synergistically activating the trans-cleavage activity of Cas12a in the solution system was verified.

[0050] Example 2

[0051] The electrochemical qualitative analysis of hematopoietic stem cells is as follows:

[0052] (a) Preparation of ITO electrodes: First, the ITO electrodes were cleaned with ethanol and then deionized water. The ITO electrodes were then immersed in a solution (28% NH3·H2O:30% H2O2:H2O = 1:1:6, v / v / v) and heated in an 85°C water bath for 25–30 minutes to obtain a hydroxylated surface. The electrodes were then rinsed with deionized water and dried with nitrogen. The dried ITO electrodes were then immersed in a 1 mM NaOH solution for 4–5 hours, rinsed with deionized water, and dried with nitrogen to obtain hydroxyl-functionalized ITO electrodes.

[0053] (b) Feasibility verification of electrochemical analysis of hematopoietic stem cells. 2×10 5 Hematopoietic stem cells were incubated with P1 (1 μM) and P2 (1 μM) at 37 ° C for 20 to 30 minutes. Then, the hematopoietic stem cell solution combined with the P1 and P2 chains was centrifuged at 1200 rpm for 5 minutes, the supernatant was removed and the centrifugation and washing were repeated once. Subsequently, crRNA (200nM) and Cas12a (40pM) were reacted with 10×DNase I Reaction Buffer at 37 ° C for 30 to 40 minutes, added to the above centrifuged cells, and then reacted with P1 (200nM), P2 (200nM), T chain (1 μM), and TE Buffer 37 ° C for 1 hour. Finally, the reaction solution was centrifuged at 1200 rpm for 5 minutes to collect the supernatant for subsequent electrochemical signal detection.

[0054] (c) Detection of electrochemical signals: Electrochemical measurements were performed using a three-electrode system on a CHI-660C electrochemical workstation. The auxiliary electrode was a platinum wire, the reference electrode was a saturated calomel electrode, the working electrode was the ITO electrode obtained in (a), and the buffer was 20 mM Tris-HCl. The solution was thoroughly deoxygenated using high-purity nitrogen gas, and a nitrogen flow was used throughout the electrochemical detection process to maintain the solution anaerobic. The parameters of square wave voltammetry (SWV) were as follows: potential scan range, Potential step, 4 mV; amplitude, 25 mV; frequency, 15 Hz.

[0055] in:

[0056] The P1 sequence is: 5'-TACCAGTGCCGTTTCCCCGGAGGGTCACCCCTGACGCATTCGGTTGACTTTTTTTTTTTTCCAGCCAATA-3';

[0057] The P2 sequence is: 5′-ACCGTGTCCAATCTTTTTTTTTTTCGCTCGATAGATCGAGCTTC GCTCGATGTGGTGTTGTGGGGGCTTGTATTGGTCGATCACGCTCTAGAGCACTG-3′;

[0058] The T sequence is: 5′-TCAGCCGCTGTCACACGCACAGCCTGGACTGA-3′, and its 3′ end is modified with MB;

[0059] The sequence of crRNA is: 5'-UAAUUUCUACUCUUGUAGAUUGGACACGGUUAUUGGC UGG-3'.

[0060] Figure 3The present method was shown to be useful for detecting 2×10 5 The electrochemical signal obtained when the hematopoietic stem cells are present in the system (experimental group). When hematopoietic stem cells are present in the system, P1 and P2 can recognize and bind to the surface of hematopoietic stem cells, synergistically activate the trans-cleavage activity of Cas12a to cut the T chain into a short chain, which is captured by the hydroxylated ITO electrode. There is an obvious current peak during electrochemical detection; in the blank control group, there is no hematopoietic stem cell, lacks an activation chain, and the methylene blue-modified long chain is not easily captured by the hydroxylated ITO electrode, so there is only a very small background emission peak.

[0061] Example 3 Electrochemical Quantitative Detection of Hematopoietic Stem Cells

[0062] (a) Preparation of ITO electrodes: First, the ITO electrodes were cleaned with ethanol and then deionized water. The ITO electrodes were then immersed in a solution (28% NH3·H2O:30% H2O2:H2O = 1:1:6, v / v / v) and heated in an 85°C water bath for 25–30 minutes to obtain a hydroxylated surface. The electrodes were then rinsed with deionized water and dried with nitrogen. The dried ITO electrodes were then immersed in a 1 mM NaOH solution for 4–5 hours, rinsed with deionized water, and dried with nitrogen to obtain hydroxyl-functionalized ITO electrodes.

[0063] (b) Electrochemical quantitative analysis of hematopoietic stem cells. Different numbers of hematopoietic stem cell suspensions were collected for standby use. Different numbers of cell suspensions were incubated with P1 (1 μM) and P2 (1 μM) at 37 ° C for 20 to 30 minutes. Then, the hematopoietic stem cell solution combined with the P1 and P2 chains was centrifuged at 1200 rpm for 5 minutes, and the supernatant was removed and the centrifugation and washing were repeated once. Subsequently, crRNA (200 nM) and Cas12a (40 pM) were reacted with 10 × DNase I Reaction Buffer at 37 ° C for 30 to 40 minutes, added to the above centrifuged cells, and then reacted with P1 (200 nM), P2 (200 nM), T chain (1 μM), and TE Buffer 37 ° C for 1 hour. Finally, the reaction solution was centrifuged at 1200 rpm for 5 minutes to collect the supernatant for subsequent electrochemical signal detection.

[0064] (c) Detection of electrochemical signals: Electrochemical measurements were performed using a three-electrode system on a CHI-660C electrochemical workstation. The auxiliary electrode was a platinum wire, the reference electrode was a saturated calomel electrode, the working electrode was the ITO electrode obtained in (a), and the buffer was 20 mM Tris-HCl. The solution was thoroughly deoxygenated using high-purity nitrogen gas, and a nitrogen flow was used throughout the electrochemical detection process to maintain the solution anaerobic. The parameters of square wave voltammetry (SWV) were as follows: potential scan range, Potential step, 4 mV; amplitude, 25 mV; frequency, 15 Hz.

[0065] in:

[0066] The P1 sequence is: 5'-TACCAGTGCCGTTTCCCCGGAGGGTCACCCCTGACGCATTCGGTTGACTTTTTTTTTTTTCCAGCCAATA-3';

[0067] The P2 sequence is: 5′-ACCGTGTCCAATCTTTTTTTTTTTCGCTCGATAGATCGAGCTTC GCTCGATGTGGTGTTGTGGGGGCTTGTATTGGTCGATCACGCTCTAGAGCACTG-3′;

[0068] The T sequence is: 5′-TCAGCCGCTGTCACACGCACAGCCTGGACTGA-3′, and its 3′ end is modified with MB;

[0069] The sequence of crRNA is: 5'-UAAUUUCUACUCUUGUAGAUUGGACACGGUUAUUGGC UGG-3'.

[0070] Based on the feasibility of this method for detecting hematopoietic stem cells, this example conducted electrochemical analysis on a series of different numbers of hematopoietic stem cells. The results are as follows: Figure 4 As we predicted, the measured peak current increased with the increase in the concentration of added hematopoietic stem cells. This was due to the synergistic activation of more P1 and P2, which stimulated the activation of more Cas12a trans-cleavage activity, causing more T chains to be cut into short chains. More short chains of modified methylene blue MB can be captured by the hydroxylated ITO electrode, and the resulting peak current also increased.

Claims

1. A nucleic acid composition for electrochemical detection of hematopoietic stem cells, characterized in that include: The P1 sequence is: 5'-CCCUCCUACAUAGGGTTTTTTTTTTCCAGCCAATA-3', The P2 sequence is: 5'-ACCGTGTCCAATCTTTTTTTTTTTCGCTCGATAGATCGAGCTTC GCTCGATGTGGTGTTGTGGGGGCTTGTATTGGTCGATCACGCTCTAGAGCACTG-3', and the T sequence is: 5'-TCAGCCGCTGTCACACGCACAGCCTGGACTGA-3', The sequence of crRNA is: 5′-UAAUUUCUACUCUUGUAGAUUGGACACGGUUAUUGGC UGG-3′; One end of P1 and P2 contains aptamer sequences of CD45 and CD133, respectively, which can recognize and bind to hematopoietic stem cells. The other end complementarily binds to the two ends of crRNA for subsequent electrochemical signal amplification. The detection of hematopoietic stem cells is achieved by measuring the electrochemical signals of chemical groups on the electrode surface.

2. The nucleic acid composition according to claim 1, characterized in that Based on the established relationship between electrochemical signal intensity and cell number, the number of cells contained in the sample to be tested is determined accordingly to achieve quantitative detection.

3. The nucleic acid composition according to claim 1, characterized in that The 3' end of the T strand was modified with methylene blue.

4. The nucleic acid composition according to claim 1, characterized in that The electrode is an ITO electrode with a carboxyl surface treatment, which can capture short chains modified with methylene blue, an electrochemical signal substance, to generate corresponding electrochemical signals.

5. The nucleic acid composition according to claim 1, characterized in that Electrochemical measurements were performed using a three-electrode system.

6. The nucleic acid composition according to claim 1, characterized in that The auxiliary electrode is a platinum wire.

7. The nucleic acid composition according to claim 1, characterized in that The reference electrode was a saturated calomel electrode.

8. The nucleic acid composition according to claim 1, characterized in that Square wave voltametry was used for detection, and the potential scanning range was The potential step was 4 mV, the amplitude was 25 mV, and the frequency was 15 Hz.

9. Use of the nucleic acid composition according to claim 1 in detecting the number of hematopoietic stem cells.

Images