Yeast genome editing system without interval loop iteration

Abstract

The invention belongs to the field of gene engineering, and particularly relates to a non-interval loop iteration yeast genome editing system. The system is composed of Cas and gRNA double plasmids, wherein the gRNA plasmids comprise auxotrophy gRNA-URA3, gRNA-HIS3 and gRNA-LEU2, and the gRNA plasmids comprise gRNA-URA3, gRNA-HIS3 and The resistance is gRNA-BleoR, gRNA-HygR, gRNA-NrsR, gRNA-BleoR, gRNA-HygR and gRNA-NrsR; through coordinated use with a Cas selection marker, the method realizes interval-free, cyclic and iterative efficient editing operation on a yeast genome, and can be used as a practical tool for multi-gene continuous iterative editing of saccharomyces cerevisiae and other fungi. The method has extremely high editing efficiency, an experimental terminal eliminates Cas and gRNA plasmids to realize traceless operation, and the method is low in off-target rate, universal, accurate and easy to operate and can be applied to large-scale gene knockout, knockin, site-specific mutagenesis and the like.

Description

[0001] This application claims priority to the patent with application number 202411330975.0, patent name "A yeast genome editing system with uninterrupted loop iteration", application date 2024-09-24, and applicant Suzhou Jiaogan Technology Co., Ltd. Technical Field

[0002] The present invention belongs to the field of genetic engineering, and in particular relates to a yeast genome editing system with seamless cyclic iteration. Background Art

[0003] CRISPR / Cas technology, due to its exceptional gene-editing capabilities, has become the tool of choice for synthetic biology pathway modification. CRISPR, short for Clustered Regularly Interspaced Short Palindromic Repeats, is an adaptive immune system of archaea and bacteria. When a virus first invades, the bacteria record the viral protospacer sequence and transcribe it to form a Cas-RNA complex. When exogenous genes containing the same protospacer sequence, such as plasmid DNA, bacteriophage, or viral nucleic acid, invade again, the Cas-RNA complex is activated to cleave the exogenous gene and inactivate it. Based on this mechanism, CRISPR / Cas technology was developed to specifically recognize host genes. CRISPR / Cas9 is the first reported and maturely applied system. It consists of two core components: guide RNA (gRNA) and endonuclease (Cas9). gRNA and Cas are expressed in the host. There is a scaffold sequence on the gRNA that is connected to Cas, through which the gRNA-Cas complex is formed with Cas. Under the guidance of the gRNA (20bp) that is complementary to the target gene base, Cas9 reaches the vicinity of the target gene and cuts the target gene near the PAM by recognizing the target gene target site prototype spacer adjacent motif (PAM). The broken double strand significantly stimulates the endogenous DNA repair reaction, resulting in DSBs being repaired by homologous recombination (HR). Figure 2 When using CRISPR / Cas for gene editing, in order to introduce customized sequences, the Cas / gRNA plasmid and a repair DNA sequence, also known as donor DNA, are simultaneously transformed during the yeast transformation stage. The 5' and 3' ends of this DNA segment contain sequences homologous to the ends of the target gene, with an inserted gene fragment in the middle. DSBs are repaired through HR to achieve knockout or replacement of the target gene.

[0004] Based on the above mechanism, a variety of CRISPR / Cas systems have been developed, including single-gene or multi-gene simultaneous editing modes, but the current systems have certain limitations. For example, in a single-gene editing system, in order to ensure seamless operation and conduct a new round of editing after a round of gene editing is completed, it is necessary to gradually lose the resistance or nutritional selection marker through multiple subcultures or reverse selection before the next round of gene manipulation can be carried out. This step is time-consuming (72-96 hours), becoming the rate-limiting step for iterative editing of multiple genes, seriously restricting the efficiency of gene editing; while the multi-gene simultaneous editing system has a high off-target rate and cannot effectively ensure that several target genes are deleted or knocked in at the same time during a round of gene editing. Often, one positive colony completes the editing of gene A, and another colony realizes the editing of gene B, but the proportion of positive strains in which genes A and B are successfully edited simultaneously is low. This system also faces the time-consuming step of losing marker genes during the next round of editing. However, the current editing systems based on CRISPR / Cas technology are mostly focused on the efficiency of multiple genome integration, and there is not much research and attention on the intermediate interval issues in the continuous editing of each gene. It cannot effectively guide the iterative editing of multiple genes without intervals, thereby improving the overall efficiency of large-scale gene editing. Summary of the Invention

[0005] To solve the above problems, the present invention provides a gapless iterative system for editing the yeast genome, characterized in that the system consists of a double plasmid of Cas plasmid and gRNA plasmid.

[0006] Furthermore, the gRNA plasmid selection marker cycle pattern consists of an auxotrophic cycle marker or a resistance cycle marker.

[0007] Furthermore, the nutritional deficiency type circulation marker is uracil-deficient gRNA-URA3, histidine-deficient gRNA-HIS3 or leucine-deficient gRNA-LEU2.

[0008] Furthermore, the nucleotide sequence of URA3 in the auxotrophic circulating marker is shown as SEQ ID No. 1, the nucleotide sequence of HIS3 is shown as SEQ ID No. 2, and the nucleotide sequence of LEU2 is shown as SEQ ID No. 3.

[0009] Furthermore, the resistance circulating marker is bleomycin resistance gRNA-BleoR, hygromycin resistance gRNA-HygR or nourseoin resistance gRNA-NrsR.

[0010] Furthermore, the nucleotide sequence of BleoR in the resistance cycle marker is shown as SEQ ID No. 4, the nucleotide sequence of HygR is shown as SEQ ID No. 5, and the nucleotide sequence of NrsR is shown as SEQ ID No. 6.

[0011] Furthermore, the gRNA plasmid backbone is pRS42H, and its sequence is shown in SEQ ID NO.7.

[0012] Furthermore, the nuclease is Cas9; the nucleotide sequence of the Cas9 plasmid is shown in SEQ ID No.8.

[0013] Furthermore, the nutritional deficiency cycle marker of the Cas plasmid paired with the gRNA plasmid is methionine-deficient Cas-MET15, and the resistance cycle marker of the Cas plasmid paired with the gRNA plasmid is kanamycin resistance Cas-KanR.

[0014] Furthermore, a donor DNA plasmid is also included; the donor DNA plasmid includes: a pUC19 plasmid backbone sequence, 500-800bp of homology arm HAU and HAD sequences upstream and downstream of the target gene open reading frame ORF, and other sequences; the pUC19 plasmid backbone sequence is shown in SEQ ID No. 22.

[0015] The other sequences vary depending on the purpose of gene editing; if the target gene is to be knocked out, the other sequences consist of addressable landing pads (LPs), including a unique 20bp Cas9 targeting sequence (UTS) followed by a protospacer adjacent motif (PAM) sequence NGG; if the target gene is to be replaced, the other sequences consist of the replacement gene.

[0016] The present invention has the following beneficial effects:

[0017] The yeast genome editing system with uninterrupted iteration provided by the present invention can be used for multi-gene editing operations in Saccharomyces cerevisiae and other fungi, and has strong versatility. Due to the design of two sets of gRNA plasmid selection marker cycle modes, there is no need for time-consuming steps such as multiple subcultures after each round of editing (generally requiring 3-5 generations and taking 72-96 hours) or reverse selection to gradually eliminate resistance or nutritional selection markers. This enables unlimited continuous iterative knock-in and knock-out operations of multiple genes, increasing the efficiency of large-scale gene editing to 3 times that of existing systems, and allowing the flexibility to select a marker cycle mode according to laboratory conditions. A single-gene editing mode is designed with the advantages of extremely high editing efficiency, low off-target rate, accuracy and ease of operation, and can be used for applications such as knockout of target genes, knock-in of long fragments (less than 7k bp) and site-directed mutagenesis. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0019] Figure 1 This is a schematic diagram of the core elements of the Cas plasmid and two sets of gRNA plasmid selection marker recycling mode.

[0020] Figure 2 Schematic diagram of gene knockout.

[0021] Figure 3 Schematic diagram of gene knock-in.

[0022] Figure 4 Schematic diagram of the Cas and gRNA plasmid elimination process.

[0023] Figure 5 This is the SST2 gene knockout verification diagram.

[0024] Figure 6 This is the GPA1 gene knockout verification diagram.

[0025] Figure 7 This is the GPA2 gene knockout verification diagram.

[0026] Figure 8 This is the PEP4 gene knockout verification diagram.

[0027] Figure 9 This is the validation diagram of the pPGK1-GFP-tADH1 fragment knock-in.

[0028] Figure 10 This is the verification diagram of the knock-in of the pCCW12-T1R1-tSSA1 fragment.

[0029] Figure 11 This is the verification diagram of the knock-in of the pCCW12-T1R3-tSSA1 fragment. DETAILED DESCRIPTION

[0030] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0031] The present invention provides a non-interval loop iteration system for editing yeast genomes, which is composed of a double plasmid of Cas plasmid and gRNA plasmid ( Figure 1 ):

[0032] 1. Design of gRNA and Construction of Circulating gRNA Plasmid System

[0033] Benchling (https: / / www.benchling.com) was used to design gRNA sequences with high specificity, high efficiency, and low off-target rates. gRNA sequences with high "off-target" and "on-target" scores and positioned closer to the 5' end of the target gene were selected. Since only 20 bp of the specific gRNA sequence was added to the backbone sequence during gRNA plasmid preparation, two complementary single-stranded DNA fragments were directly synthesized and annealed to form a double strand. The double-stranded gRNA fragment was then integrated into the backbone sequence via Gibson assembly to form a new gRNA plasmid.

[0034] 2. Preparation of Donor DNA

[0035] Based on different gene editing purposes, donor DNA comes in two forms.

[0036] The first is to knock out the target gene. The donor DNA can only consist of upstream and downstream homology arm sequences of the target gene and several connected genes (complete knockout). In this case, in order to facilitate subsequent genome editing at this site, in addition to the upstream and downstream homology arms, the composition of the donor DNA can add addressable landing pads (LPs) in the middle part. Specifically, CRISPR / Cas is used to form DSBs at the open reading frame (ORF) of the knocked-out gene. The donor DNA serves as a template for homology-directed repair (HDR), including a unique 20bp Cas9 targeting sequence (UTS) followed by a PAM sequence NGG (N can be A, T, G or C), flanked by 500bp of homology arm sequences upstream and downstream of the knocked-out gene ORF ( Figure 2 The resulting knockout represents a precise replacement of the ORF, with a unique UTS to allow for future editing at that site.

[0037] The second type is to replace the target gene. The donor DNA consists of upstream and downstream homology arms and the ORF of the replacement gene ( Figure 3 To improve the knock-in efficiency of the replacement gene, the upstream and downstream homology arms are generally set to 800 bp; for sequences less than 3 k bp, 500 bp homology arms are sufficient.

[0038] 3. Yeast Transformation and Screening of Positive Clones

[0039] The exogenous gene is transformed into yeast by chemical transformation and cultured in an inverted manner at 30°C for 48-72 hours. Positive clones are verified after single colonies have grown. Positive clones are verified by colony PCR combined with sequencing.

[0040] 4. Elimination of gRNA and Cas plasmids

[0041] The final edited strain is gradually removed by multiple passages in the absence of selection pressure (resistance screening mode) or SD medium (nutrient deficiency mode). Taking the resistance mode as an example, the plasmid elimination steps are as follows: take 0.5 μL of the positive strain and inoculate it into 500 μL YPD liquid medium for cultivation; wait until the bacterial solution becomes turbid (18-24 hours), take 0.5 μL of the above bacterial solution and inoculate it into YPD medium and continue to culture; repeat the above operation 5 times; streak the last bacterial solution onto YPD solid medium, pick a single colony after growing a colony and transfer it to 100 μL ddH2O, and inoculate (10 μL) into 1 mL YPD liquid medium containing geneticin (G418, KanR corresponding antibiotic), hygromycin B (HyB, HygR corresponding antibiotic) / bleomycin (Bleo, BleoR corresponding antibiotic) / nourseothricin (NTC, NrsR corresponding antibiotic) and no antibiotic. If the strain grows on YPD medium without antibiotics but cannot grow on YPD medium containing antibiotics, it means that the gRNA plasmid and Cas plasmid in the strain have been successfully eliminated ( Figure 4 ).

[0042] The present invention is further described below with reference to specific embodiments to illustrate the implementation process of the invention.

[0043] The gRNA backbone plasmid is pRS42H, which contains a yeast 2μ plasmid replication origin. The expression of gRNA is controlled by the yeast SNR52 promoter (pSNR52) and the SUP4 terminator (tSUP4). The expression of the three-cycle auxotrophic (URA3, HIS3, LEU2) or resistance (BleoR, HygR, NrsR) selection marker is controlled by the TEF promoter. The sequence information of pRS42H_gRNA_HygR is as follows (SEQ ID NO.7), where N can represent the HygR resistance gene as shown in capital letters (as shown in SEQ ID NO.5), etc. The underlined bold part is the gRNA sequence insertion site (that is, when constructing a specific gRNA plasmid, the underlined sequence can be replaced with the designed targeting gRNA sequence). Replacing the HygR shown in the N position with other auxotrophic / resistance genes can obtain a three-cycle selection marker plasmid system. The specific primers used to construct different resistance or auxotrophic gRNA plasmids are as follows:

[0044] NrsR-F:actaattacatgactcgagattatgacatggcatagaca

[0045] NrsR-R:acatccgaacataaaaccatgggtactactttggatga

[0046] BleoR-F:actaattacatgactcgagattaatcttgttcttcagcaa

[0047] BleoR-R:acatccgaacataaaaccatggctaagttgacttctgc

[0048] URA3-F:actaattacatgactcgagattagttttgctggccgcatc

[0049] URA3-R:acatccgaacataaaaccatgtcgaaagctacatataa

[0050] HIS3-F:actaattacatgactcgagactacataagacacctttgg

[0051] HIS3-R:acatccgaacataaaaccatgacagacagaaagccct

[0052] LEU2-F:actaattacatgactcgagattaagcaaggattttcttaa

[0053] LEU2-R:acatccgaacataaaaccatgtctgccctaagaagat

[0054] URA3 Report Ad (SEQ ID NO.1) Report:

[0055] atgtcgaaagctacatataaggaacgtgctgctactcatcctagtcctgttgctgccaagctatttaatatcatgcacgaaaagcaaacaaacttgtgtgcttcattggatgttcgtaccaccaaggaattactggagttagttgaagcattaggtcccaaaatttgtttactaaaaacacatgtggatatcttgactgatttttccatggagggcacagttaagccgctaaaggcattatccgccaagtacaattttttactcttcgaagacagaaaatttgctgacattggtaatacagtcaaattgcagtactctgcgggtgtatacagaatagcagaatgggcagacattacgaatgcacacggtgtggtgggcccaggtattgttagcggtttgaagcaggcggcggaagaagtaacaaaggaacctagaggccttttgatgttagcagaattgtcatgcaagggctccctagctactggagaatatactaagggtactgttgacattgcgaagagcgacaaagattttgttatcggctttattgctcaaagagacatgggtggaagagatgaaggttacgattggttgattatgacacccggtgtgggtttagatgacaagggagacgcattgggtcaacagtatagaaccgtggatgatgtggtctctacaggatctgacattattattgttggaagaggactatttgcaaagggaagggatgctaaggtagagggtgaacgttacagaaaagcaggctgggaagcatatttgagaagatgcggccagcaaaactaa

[0056] Sequence of HIS3 auxotrophic gene (SEQ ID NO.2):

[0057] atgacagagcagaaagccctagtaaagcgtattacaaatgaaaccaagattcagattgcgatctctttaaagggtggtcccctagcgatagagcactcgatcttcccagaaaaagaggcagaagcagtagcagaacaggccacacaatcgcaagtgattaacgtccacacaggtatagggtttctggaccatatgatacatgctctggccaagcattccggctggtcgctaatcgttgagtgcattggtgacttacacatagacgaccatcacaccactgaagactgcgggattgctctcggtcaagcttttaaagaggccctaggggccgtgcgtggagtaaaaaggtttggatcaggatttgcgcctttggatgaggcactttccagagcggtggtagatctttcgaacaggccgtacgcagttgtcgaacttggtttgcaaagggagaaagtaggagatctctcttgcgagatgatcccgcattttcttgaaagctttgcagaggctagcagaattaccctccacgttgattgtctgcgaggcaagaatgatcatcaccgtagtgagagtgcgttcaaggctcttgcggttgccataagagaagccacctcgcccaatggtaccaacgatgttccctccaccaaaggtgttcttatgtag

[0058] LEU2 auxotrophic gene (SEQ ID NO.3) sequence:

[0059]

[0060] Sequence of BleoR resistance gene (SEQ ID NO.4):

[0061] tcagtcctgctcctcggccacgaagtgcacgcagttgccggccgggtcgcgcagggcgaactcccgcccccacggctgctcgccgatctcggtcatggccggcccggaggcgtcccggaagttcgtggacacgacctccgaccactcggcgtacagctcgtccaggccgcgcacccacacccaggccagggtgttgtccggcaccacctggtcctggaccgcgctgatgaacagggtcacgtcgtcccggaccacaccggcgaagtcgtcctccacgaagtcccgggagaacccgagccggtcggtccagaactcgaccgctccggcgacgtcgcgcgcggtgagcaccggaacggcactggtcaacttggccat

[0062]

[0063] Sequence of the NrsR resistance gene (SEQ ID NO.6):

[0064] Ttaggggcagggcatgctcatgtagagcgcctgctcgccgtccgaggcggtgccgtcgtacagggcggtgtccaggccgcagagggtgaaccccatccgccggtacgcgtggatcgccggtgcgttgacgttggtgacctccagccagaggtgcccggcgccccgctcgcgggcgaactccgtcgcgagccccatcaacgcgcgcccgaccccgtgcccccggtgctccggggcgacctcgatgtcctcgacggtcagccggcggttccagccggagtacgagacgaccacgaagcccgccaggtcgccgtcgtccccgtacgcgacgaacgtccgggagtccgggtcgccgtcctccccgtcgtccgattcgtcgtccgattcgtcgtcggggaacaccttggtcaggggcgggtccaccggcacctcccgcagggtgaagccgtccccggtggtggtgacgcggaaaacggtgtcggtggtgaaggacccatccagtgcctcgatggcctcggcgtcccccgggacactggtgcggtaccggtaagccgtgtcgtcaagagtggtacccat

[0065] Plasmid sequence information of pRS42H_gRNA_HygR (HygR: SEQ ID NO.7):

[0066]

[0067]

[0068]

[0069]

[0070] Cas9 was selected, and the plasmid was p414-pTEF1-Cas9-tCYC1-KanR (sequence as SEQ ID No. 8), which contains the CEN / ARS replication origin. The simian virus 40 nuclear localization sequence was added to the end of Cas9 to help the Cas9 protein localize to the yeast nucleus. The transcription of Cas9 is controlled by the yeast TEF1 promoter (pTEF1) and CYC1 terminator (tCYC1). Where N can represent the KanR resistance gene as shown in the capital letters in brackets. Replacing KanR with MET15 at the N position can obtain a Cas plasmid that matches the auxotrophic gRNA plasmid. The specific primers used to construct the Cas plasmid with KanR or MET15 selection markers are as follows:

[0071] KanR-F:cgccgggtcacccggccagcgacatggaggcccagaatac

[0072] KanR-R:ctttttattgtcagtactgattagaaaaactcatcgagca

[0073] MET15-F:cgccgggtcacccggccagcatgccatctcatttcgatac

[0074] MET15-R:ctttttattgtcagtactgatcatggtttttggccagcga

[0075] p414-pTEF1-Cas9-tCYC1-KanR sequence information (SEQ ID No. 8):

[0076]

[0077] MET15 auxotrophic gene sequence (as shown in SEQ ID No. 9):

[0078]

[0079] This example uses a gRNA plasmid resistance selection marker cycling pattern (gRNA-BleoR, gRNA-HygR, gRNA-NrsR). Saccharomyces cerevisiae BY4741 was selected as a model strain. Four genes (SST2, GPA1, GPA2, PEP4) of BY4741 were knocked out, GFP was knocked in at the X3 and XI-2 loci, and T1R1 and T1R3 genes were knocked in at the X2 and XII-5 loci, respectively. The specific implementation process of the present invention is described as an example.

[0080] Example 1: Continuous Iterative Knockout of Four Genes: SST2, GPA1, GPA2, and PEP4

[0081] 1. Design of gRNA and Assembly of gRNA Plasmid

[0082] Use Benchling (https: / / www.benchling.com) to design gRNA sequences with high specificity, high efficiency, and low off-target rates. Select gRNA sequences with high off-target and on-target scores and positioned closer to the 5' end of the target gene. Specific gRNA sequences for knockout of SST2, GPA1, GPA2, and PEP4 are shown in Table 1.

[0083] Table 1 gRNA sequence information for knocking out SST2, GPA1, GPA2, and PEP4 genes

[0084] gRNA Sequence (5'-3') SEQ ID No SST2 TGTTAAAGAAGCGGTCTCGT 10 GPA1 ATCAACGCCAGTGTTGCCGG 11 GPA2 TAATAACGCGATATCTCCCA 12 PEP4 TGGGTTCCAAGTAACGAATG 13

[0085] To prepare the gRNA plasmids, only the underlined bold portion of the backbone sequence (pRS42H_gRNA_HgyR) was replaced with a 20-bp specific gRNA sequence (Table 1) on the pRS42H_gRNA backbone sequence. Two complementary single-stranded DNAs (sequence information is provided below) were directly synthesized and annealed to form double strands. The double-stranded gRNA fragments were then integrated into the backbone sequence via Gibson assembly to form new gRNA plasmids. The four gRNA plasmids are gRNA(SST2)-HygR, gRNA(GPA1)-BleoR, gRNA(GPA2)-NrsR, and gRNA(PEP4)-HygR.

[0086] Designed complete complementary single-stranded DNA sequences targeting 4 genes:

[0087] gRNA(SST2)-F(SEQ ID No14):gcagtgaaagataaatgatctgttaaagaagcggtctcgtgttttagagctagaaatag

[0088] gRNA(SST2)-R(SEQ ID No15):ctatttctagctctaaaacacgagaccgcttctttaacagatcatttatctttcactgc

[0089] gRNA(GPA1)-F(SEQ ID No16):

[0090] gcagtgaaagataaatgatcatcaacgccagtgttgccgg gttttagagctagaaatag

[0091] gRNA(GPA1)-R(SEQ ID No17):ctatttctagctctaaaacccggcaacactggcgttgatgatcatttatctttcactgc

[0092] gRNA(GPA2)-F(SEQ ID No18):gcagtgaaagataaatgatctaataacgcgatatctcccagttttagagctagaaatag

[0093] gRNA(GPA2)-R(SEQ ID No19):ctatttctagctctaaaactgggagatatcgcgttattagatcatttatctttcactgc

[0094] gRNA(PEP4)-F(SEQ ID No20):gcagtgaaagataaatgatctgggttccaagtaacgaatggttttagagctagaaatag

[0095] gRNA(PEP4)-R(SEQ ID No21):ctatttctagctctaaaaccattcgttacttggaacccagatcatttatctttcactgc

[0096] Annealing system and program parameters are as follows: In a 25 μL reaction system, add 6.25 μL of each forward and reverse primer (10 μM), and add ddH2O to 25 μL. Program parameters are as follows: 98°C (2 min); 72°C (30 s); 60°C (2 min); 37°C (30 s); 12°C (30 s); and then cool at a rate of 0.1°C / s.

[0097] The PCR amplification procedure for the gRNA backbone sequence is as follows: In a 25 μL reaction system, add 2 ng / μL template DNA, 0.4 μM upstream and downstream primers, and 12.5 μL of 2× PrimeSTAR Max Premix (Takara). Add sterile ddH2O to 25 μL. For other systems, increase the volume or adjust the ratio of each reagent accordingly. PCR reaction parameters are shown in Table 2.

[0098] Table 2 PCR reaction program parameters

[0099] process Pre-denaturation transsexual annealing extend Incubation cool down Temperature (℃) 98 98 55 72 72 4 Time(s) 60 10 10 5-10s / Kb 600 ∞

[0100] After the PCR reaction, nucleic acid electrophoresis was performed, and the target gene was recovered using a DNA gel recovery kit (Guangzhou Feiyang Bioengineering Co., Ltd.), and the DNA concentration was determined. HiFi DNA Assembly Master Mix was used to perform Gibson assembly of each gene fragment to generate a new gRNA. Each assembly system contained 0.05 pmol / gene fragment. 2× Master Mix was added, mixed, and incubated at 50°C for 30-50 minutes in a PCR instrument. This product was then directly transformed into competent E. coli cells. A single colony grown on an LB plate was picked and added to 100 μL of sterile ddH2O. Mixed thoroughly, 1 μL of this colony mixture was added to 5 μL of PCR system as a template. Other components were added in equal proportions according to the PCR system described above. Correct assembly of the plasmid was verified by colony PCR. 20 μL of the confirmed single colony mixture was inoculated into 8 mL of LB liquid medium (containing 100 μL / mL ampicillin) and incubated at 37°C for 12-18 hours. Plasmids were extracted using a plasmid extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.), and the assembled fragments were verified by sequencing. The plasmids were stored at -20°C until use.

[0101] 2. Preparation of Donor DNA

[0102] Donor DNA is generally prepared through a plasmid system. The fragments that make up the donor DNA are subcloned into a vector to form a new plasmid, and then the target donor DNA is amplified by PCR from the newly constructed plasmid. The small molecular weight, high copy pUC19 is selected as the cloning vector to prepare donor DNA. The Donor NDA plasmid consists of four parts, namely the pUC19 backbone sequence (see below), the homology arms (HAU / HAD) 500-800bp upstream and downstream of the target gene ORF, and LPs (UTS-PAM-CGG). HAU / HAD is prepared by PCR amplification using the yeast crude genome as a template, and the parameters are the same as in Table 2; LPs consists of only a 24bp sequence and is directly designed into the target gene primer in the form of a primer (see below). The plasmid preparation process is basically the same as the gRNA plasmid. The plasmid is constructed by Gibson assembly and consists of three fragments, including the pUC19 backbone sequence, HAU and HAD sequences. The Gibson assembly parameters are the same as those for gRNA plasmid assembly. The accuracy of the donor DNA fragment was verified by colony PCR (using HAU-F and HAD-R primers, sequence information see below) and sequencing.

[0103] The sequence information of the pUC19 plasmid is as follows (SEQ ID No. 22), where the underlined "CG" indicates the insertion position of the donor DNA:

[0104]

[0105]

[0106] The primer information for preparing HAU / HAD and LPs (UTS-PAM-CGG) in the donor DNA sequence by PCR is as follows, where the LPs sequence is contained in HAU-R and HAD-F (overlap primers):

[0107] SST2:

[0108] HAU-F:

[0109] ctgcaggtcgacgcggccgcgtgcttataactttaagaaaaaccagcgtc

[0110] HAU-R:

[0111] accgaggtggactacgattgcattcttacaactctatctttaattaccaaattg

[0112] HAD-F:caatcgtagtccacctcggttaatttcattgagagtctta

[0113] HAD-R:ggatcctctagagcggccgctgcgtaatgtttacttaccc

[0114] GPA1:

[0115] HAU-F:ctgcaggtcgacgcggccgcagcaagccgaatctaaaaaaaaaaa

[0116] HAU-R:accgctgcttgtgtcaccatgctatatttcctaccttaatatatcaatt

[0117] HAD-F:atggtgacacaagcagcggttgaaggaactgtataattaaagtag

[0118] HAD-R:ggatcctctagagcggccgcgcctagtagatcttgattct

[0119] GPA2:

[0120] HAU-F:ctgcaggtcgacgcggccgcactgaatgaaaaagtgaaaa

[0121] HAU-R:accgttccgatgcaggataacagcgatatttgcttgaaaatacg

[0122] HAD-F:ttatcctgcatcggaacggttgaatgcacagctaaaacag

[0123] HAD-R:ggatcctctagagcggccgctcttctcagaatggtgcaag

[0124] PEP4:

[0125] HAU-F:ctgcaggtcgacgcggccgccgttttcaatatcttgagctcctca

[0126] HAU-R:gggcggagaagtaagaaaagtttagcgttagttttggtttttgtttgaat

[0127] HAD-F:cttttcttacttctccgccctatcc

[0128] HAD-R:ggatcctctagagcggccgcgtttcttgtcagattagaaaacgat

[0129] 3. Yeast Transformation

[0130] The BY4741 strain was inoculated into 5 mL of YPD liquid medium and cultured overnight at 30°C. The OD600 value was measured and transformed when the OD600 value was 0.8-1.0. The bacterial solution (1 mL) was centrifuged (6000 rpm, 1 min, room temperature) to collect the cells; 1 mL of sterile water was added to resuspend and wash the cells, centrifuged (6000 rpm, 1 min, room temperature), and the supernatant was discarded. 1 mL of LiTE was added to the above cells, resuspended, centrifuged (6000 rpm, 1 min, room temperature), and the supernatant was discarded. 320 μL of LiTE / PEG, 20 μL of single-stranded DNA, plasmid or other exogenous DNA were added to each tube and resuspended (negative control: an equal volume of sterile water was used instead of DNA). Cas9 and gRNA plasmids were transformed into yeast twice. First, transform the Cas9 plasmid. The plasmid content per mL of a bacterial solution with an OD6000 of 0.8-1.0 is approximately 1 μg. When co-transforming the gRNA plasmid and donor DNA, the content of both should be at least 2 μg per mL of a bacterial solution with an OD6000 of 0.8-1.0. Incubate at 30°C for 30 minutes. Heat shock the solution in a 42°C water bath for 30 minutes. Centrifuge (6000 rpm, 3 minutes, room temperature) and discard the supernatant. Resuspend the solution in sterile water (to clean the transformation reagent), centrifuge (6000 rpm, 1 minute, room temperature), and discard the supernatant. Add 1 mL of YPD and incubate at 30°C for 1.5 hours (activation). Centrifuge (6000 rpm, 1 minute, room temperature) and discard the supernatant. This activation step is not required for auxotrophic selection. Resuspend the solution in 125 μL of sterile water, plate the solution on a auxotrophic or antibiotic selective medium, and incubate the solution in an inverted manner at 30°C for 48-72 hours.

[0131] 4. Knockout result verification

[0132] In this example, the order of knockout of the four genes is SST2→GPA1→GPA2→PEP4, and the corresponding gRNA resistances are gRNA(SST2)-HygR, gRNA(GPA1)-BleoR, gRNA(GPA2)-NrsR and gRNA(PEP4)-HygR. Figure 5-8 The four genes SST2, GPA1, GPA2, and PEP4 were successfully iteratively knocked out in the gRNA plasmid selection marker cycle mode, with a knockout success rate of more than 97%, indicating that the gapless iterative yeast genome editing system constructed by the present invention can continuously and efficiently knock out yeast target genes.

[0133] Figure 5In the experiment, the primers used for PCR verification were F: ctgcaggtcgacgcggccgcgtgcttataactttaagaaaaaccagcgtc, R: ggatcctctagagcggccgctgcgtaatgtttacttaccc. At this time, the control size was about 3K (the total length of 2097bp of sst2 and 500bp of upstream and downstream homology arms), and the SST2 KO was approximately 1K (consisting only of 500bp of upstream and downstream homology arms and 24bp of LPs). Sequencing of the PCR product of the SST2 KO fragment verified that the sequence was consistent with the design.

[0134] Figure 6 The primers used for PCR verification were F: ctgcaggtcgacgcggccgcagcaagccgaatctaaaaaaaaaaa, R: ggatcctctagagcggccgcgcctagtagatcttgattct. At this time, the control size was approximately 2.5K (the total length of 1419bp of gpa1 and 500bp of upstream and downstream homology arms), and the GPA1 KO was approximately 1K (consisting only of 500bp of upstream and downstream homology arms and 24bp of LPs). Sequencing of the PCR product of the GPA1 KO fragment verified that the sequence was consistent with the design.

[0135] Figure 7 The primers used for PCR verification were F: ctgcaggtcgacgcggccgcactgaatgaaaaagtgaaaa, R: ggatcctctagagcggccgctcttctcagaatggtgcaag. At this time, the control size was approximately 2.35K (the total length of 1350bp of gpa2 and 500bp of upstream and downstream homology arms), and the GPA2 KO was approximately 1K (consisting only of 500bp of upstream and downstream homology arms and 24bp of LPs). Sequencing of the PCR product of the GPA2 KO fragment verified that the sequence was consistent with the design.

[0136] Figure 8 In the experiment, the primers used for PCR verification were F: ctgcaggtcgacgcggccgccgttttcaatatcttgagctcctca, R: ggatcctctagagcggccgcgtttcttgtcagattagaaaacgat. At this time, the control size was approximately 2.2K (the total length of 1218bp of pep4 and 500bp of upstream and downstream homology arms), and the PEP4 KO size was approximately 1K (consisting only of 500bp of upstream and downstream homology arms and 24bp of LPs). Sequencing of the PCR product of the PEP4 KO fragment verified that the sequence was consistent with the design.

[0137] Example 2: Continuous iterative targeted knock-in of three exogenous genes with different sequence lengths

[0138] The performance of the three-cycle gRNA plasmid system of the present invention in iterative gene knock-in was verified by knocking in GFP at the X3 and XI-2 sites, and knocking in gene fragments of different lengths such as T1R1 and T1R3 at the X2 and XII-5 sites.

[0139] 1. Design of gRNA and Assembly of gRNA Plasmid

[0140] Use Benchling (https: / / www.benchling.com) to design gRNA sequences with high specificity, high efficiency, and low off-target rates. Select gRNA sequences with high off-target and on-target scores and positioned closer to the 5' end of the target gene. Specific gRNA sequences designed for sites X2, X3, XI-2, and XII-5 are shown in Table 3.

[0141] Table 3 gRNA sequence information designed for X2, X3, XI-2 and XII-5 sites

[0142] gRNA Sequence (5'-3') SEQ ID No X2 CTCTCGAAGTGGTCACGTGC 23 X3 CTAATGTGTCCGCGTTTCTA 24 XI-2 GTTGACCAGTTGATCAGTTG 25 XII-5 TTGTCACAGTGTCACATCAG 26

[0143] The preparation process of gRNA plasmids was the same as that in Example 1. The resistance of the four gRNA plasmids was gRNA (X3)-HygR, gRNA (XI-2)-BleoR, gRNA (X2)-NrsR and gRNA (XII-5)-HygR.

[0144] Designed complete complementary single-stranded DNA sequences targeting X2, X3, XI-2, and XII-5 sites:

[0145] gRNA(X2)-F (SEQ ID No27):

[0146] gcagtgaaagataaatgatcctctcgaagtggtcacgtgcgttttagagctagaaatag

[0147] gRNA(X2)-R (SEQ ID No28):

[0148] ctatttctagctctaaaacgcacgtgaccacttcgagaggatcatttatctttcactgc

[0149] gRNA(X3)-F(SEQ ID No29):

[0150] gcagtgaaagataaatgatcctaatgtgtccgcgtttctagttttagagctagaaatag

[0151] gRNA(X3)-R(SEQ ID No30):

[0152] ctatttctagctctaaaactagaaacgcggacacattaggatcatttatctttcactgc

[0153] gRNA(XI-2)-F(SEQ ID No31):

[0154] gcagtgaaagataaatgatcgttgaccagttgatcagttggttttagagctagaaatag

[0155] gRNA(XI-2)-R(SEQ ID No32):

[0156] ctatttctagctctaaaaccaactgatcaactggtcaacgatcatttatctttcactgc

[0157] gRNA(XII-5)-F(SEQ ID No33):

[0158] gcagtgaaagataaatgatcttgtcacagtgtcacatcaggttttagagctagaaatag

[0159] gRNA(XII-5)-R(SEQ ID No34):

[0160] ctatttctagctctaaaacctgatgtgacactgtgacaagatcatttatctttcactgc

[0161] 2. Preparation of Donor DNA

[0162] The donor DNA preparation process and position on the pUC19 backbone sequence were the same as in Example 1. The sequence composition of GFP knocked into the X3 and XI-2 sites was HAU-pPGK1-GFP-tADH1-HAD, and the sequence composition of T1R1 and T1R3 knocked into the X2 and XII-5 sites was HAU-pCCW12-T1R1-tSSA1-HAD and HAU-pCCW12-T1R3-tSSA1-HAD, respectively, where HAU and HAD represent the upstream and downstream homology arm sequences of the insertion site, respectively.

[0163] The primer information for preparing HAU / HAD and pPGK1-GFP-tADH1 / pCCW12-T1R1-tSSA1 / pCCW12-T1R3-tSSA1 in the donor DNA sequence by PCR is as follows:

[0164] HAU(X3)-F:ctgcaggtcgacgcggccgcaatactctgcagaaaattaa

[0165] HAU(X3)-R:Aattacagtcgtacgacgccaaacgcggacacattagtct

[0166] HAD(X3)-F:Cccggccagcaatgaaacggatattgatat

[0167] HAD(X3)-R:ggatcctctagagcggccgcttaaaaacaaacgacagcac

[0168] pPGK1-GFP-tADH1-F(X3):ggcgtcgtacgactgtaattgcttttagttgtgta

[0169] pPGK1-GFP-tADH1-R(X3):ccgtttcattgctggccgggtgacccggcg

[0170] HAU(XI-2)-F:ctgcaggtcgacgcggccgcgggtttctgaaaaaagaagt

[0171] HAU(XI-2)-R:Aattacagtcgtacgacgccctgatcaactggtcaacgag

[0172] HAD(XI-2)-F:Cccggccagcacgactagcgctttcagata

[0173] HAD(XI-2)-R:ggatcctctagagcggccgcaagtaatacgaaaaaccca

[0174] pPGK1-GFP-tADH1-F(XI-2):ggcgtcgtacgactgtaattgcttttagttgtgta

[0175] pPGK1-GFP-tADH1-R(XI-2):cgctagtcgtgctggccgggtgacccggcg

[0176] HAU(X2)-F:ctgcaggtcgacgcggccgcacaatgtagtggtagtagcagcaga

[0177] HAU(X2)-R:cgtgaccacttcgagagcaagttgc

[0178] HAD(X2)-F:gcataatcggccctcacagagggat

[0179] HAD(X2)-R:ggatcctctagagcggccgctgacatctttctctatatcttatgtt

[0180] pCCW12-T1R1-tSSA1-F(X2):

[0181] ttgctctcgaagtggtcacgcacccatgaaccacacggttagtcc

[0182] pCCW12-T1R1-tSSA1-R(X2):

[0183] tctgtgagggccgattatgcataaataaagtagcagtacttca

[0184] HAU(XII-5)-F:ctgcaggtcgacgcggccgcttgcctggaacccaaccgtcttcga

[0185] HAU(XII-5)-R:atgtgacactgtgacaataaattcaaac

[0186] HAD(XII-5)-F:agtttgacagcaagcaagttcatcattc

[0187] HAD(XII-5)-R:ggatcctctagagcggccgctcccaaggcggtggccgcatttttc

[0188] pCCW12-T1R3-tSSA1-F(XII-5):

[0189] ttattgtcacagtgtcacatcacccatgaaccacacggttagtcc

[0190] pCCW12-T1R3-tSSA1-R(XII-5):

[0191] aacttgcttgctgtcaaactataaaattaaagtagcagtacttca

[0192] 3. Yeast Transformation

[0193] The yeast transformation process was consistent with that described in Example 1, wherein when co-transforming the gRNA plasmid and donor DNA, the gRNA plasmid in 1 mL of bacterial solution with an OD6000 of 0.8-1.0 was not less than 2 μg, and the donor DNA was not less than 3 μg.

[0194] 4. Knock-in fragment result verification

[0195] In this example, the order of three gene knock-in is GFP→T1R1→T1R3, and the corresponding gRNA resistances are gRNA(X3)-HygR, gRNA(XI-2)-BleoR, gRNA(X2)-NrsR and gRNA(XII-5)-HygR. Figure 9-11 The three gene fragments of GFP, T1R1 and T1R3 were successfully and continuously iteratively knocked into specific sites under the gRNA plasmid selection marker cycle mode, with a knockout success rate of more than 70%, indicating that the gapless iterative yeast genome editing system constructed in this discovery can continuously and efficiently target and knock in gene fragments below 7k bp.

[0196] Figure 9 The primers used for PCR verification were F:ggcgtcgtacgactgtaattgcttttagttgtgta, R:ccgtttcattgctggccgggtgacccggcg, and the GFP KI was the 1.99K pPGK1-GFP-tADH1 fragment. The control (BY4741) had no inserted sequence and could not amplify the corresponding fragment. Sequencing of the GFP KI fragment PCR product verified that the sequence was consistent with the design.

[0197] Figure 10The primers used for PCR verification were F: ttgctctcgaagtggtcacgcacccatgaaccacacggttagtcc, R: tctgtgagggccgattatgcataaaattaaagtagcagtacttca, and T1R1 KI was the 3.5K pCCW12-T1R1-tSSA1 fragment. Since the control (BY4741) had no inserted sequence, the corresponding fragment could not be amplified, and only a non-specific band of about 0.25K was produced. Sequencing of the T1R1 KI fragment PCR product verified that the sequence was consistent with the design.

[0198] Figure 11 The primers used for PCR verification were F: ttattgtcacagtgtcacatcacccatgaaccacacggttagtcc, R: aacttgcttgctgtcaaactataaaattaaagtagcagtacttca, T1R3 KI was 3.5K of the pCCW12-T1R3-tSSA1 fragment (a main band of 3.5K and a nonspecific band of 1.5K), while the control (BY4741) had no inserted sequence and could not amplify the corresponding fragment, only producing nonspecific bands of approximately 0.25K and 1.5K. Sequencing of the T1R3 KI fragment PCR product verified that the sequence was consistent with the design.

[0199] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A gapless iterative system for editing yeast genomes, characterized in that: The system consists of a double plasmid consisting of a Cas plasmid and a gRNA plasmid.

2. A gapless iterative system for editing yeast genome according to claim 1, characterized in that: The gRNA plasmid selection marker cycle pattern consists of an auxotrophic cycle marker or a resistance cycle marker.

3. A gapless iterative system for editing yeast genome according to claim 2, characterized in that: The nutritional deficiency type circulation marker is uracil-deficient gRNA-URA3, histidine-deficient gRNA-HIS3 or leucine-deficient gRNA-LEU2.

4. A gapless iterative system for editing yeast genome according to claim 3, characterized in that: The nucleotide sequence of URA3 in the auxotrophic circulating marker is shown in SEQ ID No. 1, the nucleotide sequence of HIS3 is shown in SEQ ID No. 2, and the nucleotide sequence of LEU2 is shown in SEQ ID No.

3.

5. The yeast genome editing system according to claim 2, characterized in that: The resistance circulating marker is bleomycin resistance gRNA-BleoR, hygromycin resistance gRNA-HygR or nourseoin resistance gRNA-NrsR.

6. The system for editing yeast genomes according to claim 5, characterized in that: The nucleotide sequence of BleoR in the resistance cycle marker is shown in SEQ ID No. 4, the nucleotide sequence of HygR is shown in SEQ ID No. 5, and the nucleotide sequence of NrsR is shown in SEQ ID No.

6.

7. The system for editing yeast genomes according to claim 2, wherein: The gRNA plasmid backbone is pRS42H, and its sequence is shown in SEQ ID NO.

7.

8. The yeast genome editing system according to claim 7, characterized in that: The nuclease is Cas9; the nucleotide sequence of the Cas9 plasmid is shown in SEQ ID No.

8.

9. The yeast genome editing system according to claim 8, characterized in that: The nutritional deficiency cycle marker of the Cas plasmid paired gRNA plasmid is methionine-deficient Cas-MET15, and the resistance cycle marker of the Cas plasmid paired gRNA plasmid is kanamycin resistance Cas-KanR.

10. The yeast genome editing system according to claim 1, characterized in that: Also included are Donor DNA plasmids; The Donor DNA plasmid includes: a pUC19 plasmid backbone sequence, and homology arm HAU and HAD sequences 500-800 bp upstream and downstream of the target gene open reading frame ORF; the pUC19 plasmid backbone sequence is shown in SEQ ID No. 22.

Images