Identification method and application of molecular marker for pesticide resistance of brown planthopper

Abstract

The invention relates to an identification method and application of a molecular marker for brown planthopper insecticide resistance, in particular to a molecular marker for identifying brown planthopper insecticide resistance by using nucleotide encoding the 414th site of SEQ ID NO: 1, and provides a method for identifying brown planthopper with insecticide resistance. A homozygous brown planthopper population carrying the 414th-site homozygous mutation and a homozygous brown planthopper population not carrying the 414th-site homozygous mutation are separated by utilizing the method, and the method can be used for screening and developing novel insecticides.

Description

TECHNICAL FIELD

[0001] The present application relates to the fields of molecular biology, construction of animal models and pest control, in particular, to a method for identifying a molecular marker of insecticide resistance of Nilaparvata lugens and application thereof. BACKGROUND

[0002] Nilaparvata lugens is an important pest in rice production. It is a long-distance migratory insect and is the primary pest in rice production in China and many Asian countries. It is a monophagous pest that can only feed and reproduce on rice and common wild rice.

[0003] For a long time, the control of Nilaparvata lugens mainly relies on chemical pesticides. However, there have been cases of resistance to insecticides or decreased sensitivity. In order to overcome the resistance of Nilaparvata lugens to imidacloprid and other insecticides, phenylpyrazole (fiprole) insecticides targeting the γ-aminobutyric acid (GABA) gated chloride channel in the central nervous system of insects, such as fipronil and ethiprole, have been widely used for the control of Nilaparvata lugens. However, it has been reported that field populations in China have developed moderate resistance to fipronil (23.8-43.3-fold resistance) and cross-resistance to ethiprole (47.1-100.9-fold) (literatures 1-2). In 2013, Thailand reported high-level resistance to ethiprole (308.5-fold) (literature 3). Subsequently, the use of fipronil and ethiprole has gradually decreased due to the widespread use of other neonicotinoid insecticides in the field. For example, field-collected Nilaparvata lugens populations have developed high-level resistance to imidacloprid and thiamethoxam and moderate resistance to clothianidin and dinotefuran, but still exhibit moderate resistance to ethiprole (resistance ratio = 11.5-71.8) (literature 4). Studies on the molecular mechanisms of resistance to ethiprole have shown that the decrease in target sensitivity caused by the A301S mutation in the γ-aminobutyric acid (GABA) protein, the target of phenylpyrazole (fiprole) insecticides, is associated with the increased resistance of Nilaparvata lugens to ethiprole (literature 5).

[0004] Cytochrome P450 monooxygenase is a superfamily of many genes that plays a crucial role in the detoxification metabolism of exogenous substances such as insecticides and plant toxins. In insects, P450 monooxygenase-mediated detoxification metabolism is one of the main mechanisms of insecticide resistance. CYP6CW1 gene is a P450 gene from Nilaparvata lugens, and studies have shown that the molecular mechanism of metabolic resistance of Nilaparvata lugens to imidacloprid is related to the overexpression of some P450 genes, including CYP6CW1 gene. This study demonstrated that the CYP6CW1-expressed protease can metabolize imidacloprid into other less toxic substances. Whether CYP6CW1 protein can metabolize fipronil and ethiprole and other phenylpyrazole (fiprole) insecticides has not been reported.

[0005] From a certain population of insects, a method of separating subpopulations carrying a mutation and not carrying the mutation by molecular marker method (literature 6) can be used. By molecular marker and genetic methods, subpopulations carrying and not carrying a certain molecular marker can be separated from a specific population, and the functional differences between the two populations in a certain aspect can be compared.

[0006] In order to better develop resistance management strategies and field application strategies for the brown planthopper, it is necessary to establish a method that can quickly and accurately determine the relationship between the CYP6CW1 gene mutation of the brown planthopper and the resistance of commonly used insecticides. At the same time, the two subpopulations isolated by this method can also be used to screen new compounds that have a control effect on the brown planthopper.

[0007] Non-patent literature: Literature 1: Wang YH., Wu CX, Zhao XP, Chen LP, Yu RX, Cang T, Wu SG, Wang Q. 2009. Current status of the pest resistance to Þpronil. Chin. Bull. Entomol. 46: 846-854. Literature 2: Zhao X, Ning Z, He Y, Shen J, Su J, Gao C et al, Differential resistance and cross-resistance to three phenylpyrazole insecticides in the planthopper Nilaparvata lugens (Hemiptera: Delphacidae). J Econ Entomol 104: 1364- 1368 (2011). Literature 3: Punyawattoe P, Han ZJ, Sriratanasa W, Arunmit S, Chaiwong J and Bullangpoti V, Ethiprole resistance in Nilaparvata lugens (Hemiptera: Delphacidae): possible mechanisms and cross-resistance. Appl Entomol Zool 48:205- 211 (2013). Document 4: Zhang X, Liao X, Mao K, Zhang K, Wan H, Li J. Insecticide resistance monitoring and correlation analysis of insecticides in field populations of the brown planthopper Nilaparvata lugens (Stal) in China 2012-2014. Pestic Biochem Physiol. 2016 132:13-20. Document 5: Garrood WT, Zimmer CT, Gutbrod O, Lüke B, Williamson MS, Bass C, Nauen R, Emyr Davies TG. Influence of the RDL A301S mutation in the brown planthopper Nilaparvata lugens on the activity of phenylpyrazole insecticides. Pestic Biochem Physiol. 2017, 142:1-8. Document 6: Itokawa K, Komagata O, Kasai S, Okamura Y, Masada M, Tomita T. Genomic structures of Cyp9m10 in pyrethroid resistant and susceptible strains of Culex quinquefasciatus. Insect Biochemistry and Molecular Biology. 2010, 40(9): 631-640. SUMMARY

[0008] The present application provides a molecular marker for identifying insecticide resistance of brown planthopper, and a brown planthopper population carrying a homozygous mutation and a brown planthopper population carrying no mutation are isolated from a field population of brown planthopper by a method of molecular marker and genetics. It is found by insecticide toxicity determination that the two populations isolated exhibit completely different sensitivity, especially to pyrazole insecticides such as ethiprole, dimehypo and fipronil. The method and the strain obtained by the method have the functions of screening new compounds and investigating whether the effect of existing insecticides on the control of brown planthopper is affected by the mutation of CYP6CW1 gene. Specifically, In a first aspect of the present application, a primer pair is provided, which comprises: C-414-F: CAGGCTTACGACATAGAAATGAC (SEQ ID NO: 3), C-414-R: GATCCAAGTGAATGCCGATAAC (SEQ ID NO: 4).

[0009] Preferably, the primer pair is used for detecting a molecular marker for insecticide resistance of brown planthopper, and the molecular marker comprises a nucleotide at position 414 of SEQ ID NO: 1, wherein the nucleotide at position 414 of SEQ ID NO: 1 is serine S or phenylalanine F or a serine / phenylalanine hybrid.

[0010] Preferably, the molecular marker comprises a full-length or a fragment of CYP6CW1 gene, and the fragment of CYP6CW1 gene comprises at least a nucleotide molecule encoding an amino acid at position 414.

[0011] Preferably, the molecular marker comprises TTC or TCC.

[0012] Further preferably, when the molecular marker is TCC, the nucleotide at position 414 of SEQ ID NO: 1 is serine S; and when the molecular marker is TTC, the nucleotide at position 414 of SEQ ID NO: 1 is phenylalanine F.

[0013] Preferably, the molecular marker can be used for identifying the resistance of brown planthopper to pyrazole insecticides.

[0014] More preferably, the brown planthopper with serine S at position 414 of SEQ ID NO: 1 is sensitive to insecticides; the brown planthopper with phenylalanine F at position 414 of SEQ ID NO: 1 has high-level resistance to insecticides; and the brown planthopper with phenylalanine F / serine S at position 414 of SEQ ID NO: 1 has certain resistance to pyrazole insecticides.

[0015] Preferably, the pyrazole insecticides include, but are not limited to, ethiprole, dimehypo, fipronil, etc.

[0016] In a second aspect of the present application, a kit is provided, which comprises the primer pair as described above.

[0017] In a third aspect of the present application, the use of the primer pair or the kit as described above is provided, which use comprises (1) identifying the resistance of the brown planthopper to the insecticide, wherein the insecticide comprises the pyrazole insecticide; (2) preventing or screening the brown planthopper from the insecticide.

[0018] Preferably, the pyrazole insecticide comprises but is not limited to ethiprole, dinotefuran, fipronil, etc.

[0019] Preferably, in the (1), the resistance of the brown planthopper to the insecticide is determined according to the detection result, wherein the brown planthopper with the 414th amino acid encoded by the molecular marker being serine S is the non-mutant brown planthopper, which is sensitive to the insecticide; the brown planthopper with the 414th amino acid encoded by the molecular marker being phenylalanine F is the homozygous mutant brown planthopper, which is resistant to the insecticide; the brown planthopper with the 414th amino acid encoded by the molecular marker being phenylalanine F / serine S is the heterozygous brown planthopper, which has a certain resistance to the insecticide, and the resistance of the heterozygous brown planthopper to the pyrazole insecticide is between that of the non-mutant brown planthopper and that of the homozygous mutant brown planthopper.

[0020] Preferably, in the (2), according to the result of (1), a) if the brown planthopper is the non-homozygous mutant brown planthopper population, the pyrazole insecticide can be applied or the pyrazole insecticide can be used in a small amount; b) if the brown planthopper is the homozygous mutant brown planthopper population or the homozygous mutant brown planthopper is the dominant population, an insecticide other than the pyrazole insecticide is applied; Preferably, the non-homozygous mutant brown planthopper comprises the non-mutant or 414S / 414F heterozygote; Preferably, the homozygous mutant brown planthopper being the dominant population means that the homozygous mutant brown planthopper accounts for at least more than one fourth, for example, more than one half in the brown planthopper.

[0021] In a fourth aspect of the present application, a method for identifying the resistance of the brown planthopper to the insecticide is provided, which method comprises detecting the gene of the brown planthopper using the primer pair or the kit as described above, wherein the insecticide comprises the pyrazole insecticide, and further preferably, the pyrazole insecticide comprises but is not limited to ethiprole, dinotefuran, fipronil, etc.

[0022] Preferably, the identification method comprises judging whether the brown planthopper is sensitive to the insecticide according to the detection result, wherein the brown planthopper with the 414th amino acid encoded by the molecular marker being serine S is the non-mutant brown planthopper, and the non-mutant brown planthopper is sensitive to the insecticide; the brown planthopper with the 414th amino acid encoded by the molecular marker being phenylalanine F is the homozygous mutant brown planthopper, and the homozygous mutant brown planthopper has the insecticide resistance; the brown planthopper with the 414th amino acid encoded by the molecular marker being phenylalanine F / serine S is the heterozygous brown planthopper, and the heterozygous brown planthopper has a certain insecticide resistance, which is between the non-mutant brown planthopper and the homozygous mutant brown planthopper.

[0023] In the fifth aspect of the present application, a method for controlling the brown planthopper is provided, which comprises controlling the brown planthopper according to the result of the identification method described above, 1) if the brown planthopper is the non-homozygous mutant brown planthopper population, a pyrazole insecticide or a small amount of pyrazole insecticide can be applied; 2) if the brown planthopper is the homozygous mutant brown planthopper population or the homozygous mutant brown planthopper is the dominant population, an insecticide other than pyrazole is applied.

[0024] Preferably, the non-homozygous mutant brown planthopper comprises the non-mutant or 414S / 414F heterozygote. Preferably, the homozygous mutant brown planthopper being the dominant population means that the homozygous mutant brown planthopper accounts for at least more than one fourth, for example, more than one half in the brown planthopper.

[0025] Preferably, the pyrazole insecticide comprises ethiprole, dinotefuran or fipronil.

[0026] In the sixth aspect of the present application, a screening method for the brown planthopper insecticide is provided, which comprises 1) isolating the homozygous mutant brown planthopper population and the wild-type homozygous brown planthopper population according to the result of the identification method described above, 2) applying a candidate insecticide to the homozygous mutant brown planthopper population and the wild-type homozygous brown planthopper population to screen the insecticide which has no difference in toxicity to the two populations or has stronger toxicity to the homozygous mutant brown planthopper population, and the candidate insecticide does not comprise a pyrazole insecticide.

[0027] Preferably, the pyrazole insecticide comprises ethiprole, dinotefuran or fipronil, etc.

[0028] Those skilled in the art can understand that, due to the coding correspondence between genes and proteins (enzymes), the 414th site can be understood as the description of the gene sometimes, and can be understood as the description of the protein (enzyme) sometimes, but those skilled in the art can clearly infer its meaning according to the context.

[0029] The technical effects of the present invention are: The present invention constructs two populations, one carrying a homozygous mutation at the 414th amino acid site encoded by the CYP6CW1 gene and the other not carrying this mutation. By means of molecular markers and genetic principles, the present invention achieves the separation of individuals carrying and not carrying the homozygous mutation at the 414th amino acid site encoded by the CYP6CW1 gene in the brown planthopper population. This not only overcomes the problems of insolubility, lack of post-translational modification and reduced activity, and insufficient spatial folding of the protein in in vitro expressed insect P450 recombinant proteins, but also makes up for the shortcomings of using CRISPR / Cas9 gene editing technology in brown planthoppers to investigate the relationship between amino acid mutations in the CYP6CW1 gene and pesticides, such as time consumption and high cost, and the off-target risk of the two technologies.

[0030] Brown planthoppers are easy to raise, reproduce quickly, and complete a generation in a relatively short time. The relationship between their CYP6CW1 gene and its amino acid mutations and pesticides can be determined only through subculture rearing and bioassays, and they can be used to screen unknown compounds. Their advantages are obvious to research in this field.

[0031] Compared with the constructed transgenic fruit flies, the insecticide toxicity test was conducted by isolating two brown planthopper subpopulations, one carrying the homozygous mutation at the 414th amino acid site encoded by the CYP6CW1 gene and the other not carrying this mutation, which can more objectively reflect the relationship between the homozygous mutation at the 414th amino acid site encoded by the CYP6CW1 gene and insecticide detoxification.

[0032] The two specific genotypes of brown planthopper populations screened based on the S414F mutation site molecular marker method can be used to screen and develop new insecticides.

[0033] The above merely summarizes some aspects of the present invention and is not and should not be considered to limit the present invention in any aspect.

[0034] All patents and publications mentioned in this specification are incorporated herein by reference in their entirety. Those skilled in the art will recognize that certain modifications may be made to the present invention without departing from the spirit or scope of the present invention. The following examples further illustrate the present invention and are not to be construed as limiting the scope of the present invention or the specific methods described herein. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Hereinafter, embodiments of the present invention will be described in detail with reference to the accompanying drawings, in which: Figure 1 is the comparison of nucleotide sequences of 9 clones of the full-length cDNA sequence of the CYP6CW1 gene of the brown planthopper population in Xing'an in 2023. Figures 1A-1GAll are part of the alignment map, where 1-9 clone sub-sequence nucleotide alignment, magenta is primer pair 1, green is primer pair 2; yellow mark is nucleotide polymorphic site.

[0036] Figure 2 is the agarose gel electrophoresis identification of the 414th mutation site molecular marker of CYP6CW1 gene, M is marker, where Figure 2A is the result of primer pair 1, annealing temperature 57.7 ℃, Marker is Trans DNA Marker II; Figure 2B is the result of primer pair 2, Marker is Trans DNA Marker II; Figure 2C is the result of primer pair 1, annealing temperature 60 ℃, Marker is Trans DNA Marker II; Figure 2D is the result of primer pair 1, annealing temperature 62 ℃, marker is DNA Marker 2000.

[0037] Figure 3 is the target fragment gene sequence base peak map and the 414th site genotype identification.

[0038] Figure 4 is the agarose gel electrophoresis identification map of the amplified DNA fragment containing GABA receptor A301S mutation, M is marker, Marker is Trans DNA Marker II.

[0039] Figure 5 is the identification of the genotype of GABA receptor A301S mutation in the population without the 414th site mutation and the population with the 414th site mutation homozygous genotype, where RR is resistant homozygote, SS is sensitive homozygote, SR is resistant heterozygote genotype, which is not detected in all populations.

[0040] Figure 6 is the difference of CYP6CW1 gene expression in the population carrying homozygous mutation and not mutation.

[0041] Figure 7 is the difference of detoxification enzyme activity in the population carrying homozygous mutation and not mutation. DETAILED DESCRIPTION

[0042] The advantages and features of the present application will become more apparent with the description of the specific embodiments. However, these embodiments are only exemplary and do not constitute any limitation on the scope of the present application. Those skilled in the art should understand that the details and forms of the technical solutions of the present application can be modified or replaced without departing from the spirit and scope of the present application, and such modifications and replacements all fall within the protection scope of the present application.

[0043] Screening of molecular marker and primer of mutation site 414 of CYP6CW1 gene in Example 1 According to the previous research of the applicant (see Chinese patent application No. 2024118475738), two major haplotype sequences of CYP6CW1 gene have been obtained from a field population of brown planthopper, one is CYP6CW1-F11 sequence (SEQ ID NO: 1) which does not contain the 414th mutation, and the other sequence CYP6CW1-B4 haplotype sequence (I110+A371+F414) (SEQ ID NO: 2) which has mutations at 110, 371 and 414 amino acid sites. By constructing different CYP6CW1 gene mutants into Drosophila, the transgenic Drosophila obtained confirms that the mutation at the 414th site plays the most important role in the resistance to ethiprole. Therefore, the 414th mutation site of CYP6CW1 gene of the brown planthopper is mainly marked in the present application, and the individuals carrying homozygous mutations and not carrying mutations are separated respectively according to the principle of genetics, so as to test whether a single molecular marker 414 amino acid site can effectively separate the brown planthoppers resistant to ethiprole and benzoylurea insecticides and the brown planthoppers sensitive to ethiprole, and to provide technical guidance and materials for the screening and development of new insecticides by using two different resistant brown planthoppers in the later stage.

[0044] (1) According to the CYP6CW1-F11 haplotype and CYP6CW1-B4 haplotype DNA sequences, and the cDNA sequences of different clones of CYP6CW1 of field brown planthopper population, three pairs of primers are designed to amplify a sequence containing the mutation of the 414th amino acid site of CYP6CW1 gene: In order to ensure the field applicability of the primers, the cDNA sequences of CYP6CW1 of the field brown planthopper population in recent years are amplified, and 9 sequences of CYP6CW1 are sequenced, and 9 sequences are obtained. By comparing the 9 sequences, the upstream and downstream primers for amplifying a sequence containing the mutation of the 414th amino acid site are designed. The principle of selecting the upstream and downstream primers is to select the place where the upstream and downstream primers are located without nucleotide polymorphic sites in the 9 sequences. This is because if the upstream and downstream primers contain multiple nucleotide polymorphic sites, the specificity of sequence amplification may be caused, the DNA fragments amplified may not contain the entire DNA information, and finally the result of the molecular marker site may be misjudged.

[0045] The brown planthopper population was collected in Xing'an rice field in 2023. The total RNA of the brown planthopper was extracted by using the RNAiso Plus reagent of Baorui Biotechnology (Beijing) Co., Ltd., and the extraction steps were performed according to the instructions; the synthesis of cDNA was performed by using the Transcriptor First Stand CDNA Syntheise Kit (Roche) reverse transcription kit. The cDNA synthesis includes a first round of reaction and a second round of reaction, which is performed according to the instructions; the cDNA full-length sequence of CYP6CW1 is amplified by using the upstream primer NlCYP6CW1-F: 5'-ATGCTCGGGCTGATAGTGACAGG (SEQ ID NO: 11)-3' and the downstream primer NlCYP6CW1-R: 5'-CTATACTTTTCTTGGCTCGAAGTGCAGCC (SEQ ID NO: 12)-3' and pfu DNA polymerase (2x Phusionmaster Mix thermo scientific) (Thermo Fisher Scientific), and the PCR product is purified by using the EasyPure PCR Purification Kit (Tianji Gold); the purified PCR product is connected to the blunt-end vector in the pEASY-Blunt Zero Cloning kit. The connected vector is transformed into Trans-T1 competent cells. In order to detect whether the monoclonal colony is a clone connected with the target gene CYP6CW1, the positive clone is detected by PCR amplification, the positive clone is added into the LB liquid medium containing one thousandth of ampicillin for overnight culture, the obtained bacterial solution is purified according to the instructions of the High Purity Plasmid Miniprep Kit of Tiangen, and finally the mass and concentration of the plasmid are determined by using the NanoDrop2000 spectrophotometer. Nine plasmids are selected for sequencing by using M13 upstream primer and M3 downstream primer by Shengong Bioengineering (Shanghai) Co., Ltd., and nine clone sequences of CYP6CW1 gene are obtained.

[0046] The cDNA sequences of the nine clones are compared (FIG. 1), and it is found that there are nucleotide polymorphisms at many nucleotide sites. The principle of designing molecular marker primers is that the amplified sequence should contain the mutation site 414, and the upstream and downstream primers should be designed as much as possible on the sequence without nucleotide polymorphism, and the length of the sequence should be as short as possible. 500bp, convenient for amplification; at the same time, it also meets the general principles of designing primers. Therefore, there are not many sequences that can be selected to design upstream and downstream primers. According to the above considerations, two pairs of primers are designed: The primer sequences are as follows: Primer pair 1: C1-414-F: CAGGCTTACGACATAGAAATGAC (SEQ ID NO:3) C1-414-R: GATCCAAGTGAATGCCGATAAC (SEQ ID NO:4) Primer pair 2: C2-414-F: GTACCAAATGACGGAAAACAG (SEQ ID NO:5) C2-414-R: ACATTGATCTGACTGCCCTTCTC (SEQ ID NO:6).

[0047] (2) PCR amplification was performed using the above primers and the DNA crude extract of the single head of the brown planthopper as a template, and the amplification product was sent to Shengong for sequencing to determine whether mutation occurred at the 414th site.

[0048] In the present application, the method for obtaining the DNA crude extract of the single head of the brown planthopper is optimized by using

M5 super light speed mix kit

M5 super light speed mix kit

[0049] 2) Boil in boiling water for 5 minutes.

[0050] 3) Centrifuge at 12000 rpm for 2 minutes, and then aspirate the supernatant into a PCR tube for preservation.

[0051] 1-3 microliters are taken for PCR template. The remaining crude extract sample is stored at -20℃.

[0052] In addition, the present application also optimizes the amplification PCR system and the annealing temperature: The PCR reaction system comprises the following (total volume is 30 μL): Brown planthopper DNA crude extract 2.5 μL 2xM5Hiper super light speed mix

M5 super light speed mix kit

[0053] Figure 2A The agarose gel electrophoresis of the PCR amplification product of primer pair 1 at the annealing temperature of 57.7℃ shows that a single DNA band with the expected size cannot be obtained, and the specificity of the PCR primer at this annealing temperature is not high, and the amplification effect of some individuals is even poor. Therefore, the PCR amplification conditions are further optimized, and the annealing temperature is changed to 60℃ and 62℃, Figure 2C and Figure 2D respectively show the PCR amplification results at the annealing temperature of 60℃ and 62℃, and the agarose gel electrophoresis shows that a single band with the expected size can be obtained at the annealing temperature of 62℃; and the effect at the annealing temperature of 60℃ is better than that at 57.7℃, but is poorer than that at 62℃.

[0054] Figure 2B The agarose gel electrophoresis shows the amplification product results of primer pair 2, and the results show that a single DNA band with the expected size cannot be obtained, therefore, the primer pair is no longer attempted to be optimized.

[0055] Therefore, the primer pair 1 designed in the application can amplify a single DNA band (367bp) with the expected size at the PCR condition of the annealing temperature of 62℃. Figure 2D The PCR product of the band with the purpose is sent to Beijing Shengong Bioengineering Co., Ltd. for sequencing. Beijing Shengong Bioengineering Co., Ltd. will purify each sample before sequencing. The sequence of the PCR product is analyzed by using chromas software, and the identification of the genotype of the 414th mutation site of the CYP6CW1 gene is shown in Figure 3 .

[0056] Example 2 Separation of populations carrying homozygous mutations and not carrying mutations The above method for molecularly marking the mutation at the 414th site is combined with genetic knowledge to separate populations carrying homozygous mutations and not carrying mutations.

[0057] (1) Select 100 4-5 instar nymphs to be individually reared in plastic tubes with rice seedlings planted in advance. After the adults emerge, one female and one male are individually paired and reared in a plastic cup (500 mL) with rice seedlings planted in advance. After 5 days of mating, the female and male are separately subjected to molecular labeling. The female DNA crude extract is collected from the upper part of the abdomen, and the male can be used as a whole.

[0058] (2) When one female and one male in a cup do not carry mutations, collect their offspring and raise them on new pest-free seedlings. This population is a non-mutation homozygous strain. When one female and one male in a cup carry mutation homozygotes, collect their offspring and raise them on new pest-free seedlings. This population is a mutation homozygous strain. When one female and one male in a cup are both heterozygotes, collect the offspring and mix them together to form a population for the second round of molecular labeling.

[0059] (3) In the second round of screening, 40 pairs of newly emerged females and males are selected from the offspring of heterozygotes and paired. After 5 days of mating, the female and male are separately subjected to molecular labeling. When one female and one male in a cup are both non-mutation homozygotes, collect their offspring and raise them on new pest-free seedlings. This population is a non-mutation homozygous strain. When one female and one male in a cup are both mutation homozygotes, collect their offspring and raise them on new pest-free seedlings. This population is a mutation homozygous strain.

[0060] (4) In the first round of pairing screening, 5 pairs of non-mutation homozygotes and 8 pairs of mutation homozygotes are obtained from 50 pairs of one female and one male. In the second round of pairing screening, 6 pairs of non-mutation homozygotes and 6 pairs of mutation homozygotes are obtained from 40 pairs of one female and one male. The non-mutation homozygotes obtained in the first round and the second round are combined, and this population is the CYP6CW1 gene non-mutation brown planthopper population in the present application. Similarly, the mutation homozygotes obtained in the first round and the second round are combined, and this population is the CYP6CW1 gene 414 mutation brown planthopper population in the present application.

[0061] Example 3: Determining the detoxification relationship between the mutation and ethiprole using populations carrying homozygous mutations and populations not carrying mutations The toxicity of each insecticide to the brown planthopper was determined by the bioassay method according to the Rice Brown Planthopper Resistance Monitoring Technical Procedures (NY / T1708-2009) industry standard.

[0062] (1) Ethiprole technical material is completely dissolved in acetone to form a clear liquid; a series of gradient concentrations are prepared by diluting the pesticide with deionized water containing 1‰ Triton X-100 additive. Deionized water containing 1‰ Triton X-100 additive is used as the control group.

[0063] (2) Select 20 TN1 seedlings of 10 days old and healthy, wash the root soil and impurities, wrap the young roots with sterile absorbent cotton, soak in the corresponding concentration of the liquid for 30 seconds, put into a transparent plastic cup (bottom diameter = 5 cm, height = 7.5 cm), 20 three-instar nymphs per cup, and seal with a 200-mesh nylon screen. After 2 hours, remove the individuals that were mechanically injured during the moving process. Each treatment has three replicates, and after completion, place the device in a constant temperature artificial climate chamber with a temperature of (27 ± 1) °C, humidity of 70%, and a light cycle of L:D = 16h:8h. Check and record the death of each pesticide treatment group after 96 hours.

[0064] Table 1. Toxicity determination of the isolated populations carrying the 414th homozygous mutation and not carrying the 414th mutation to ethiprole By molecular markers and genetic methods of the 414th mutation site, the homozygous population 414S without S414F mutation and the homozygous population 414F carrying S414F mutation were isolated from field population F. The sensitivity differences of the nymphs of field population F, 414S, 414F homozygous population, the hybrid offspring of 414S and 414F, and the offspring of the hybrid offspring self-cross were determined. According to the genetic law, the genotype of the hybrid offspring of 414S and 414F is 414S / 414F heterozygote; the genotype of the offspring of the hybrid offspring self-cross is one-fourth 414F homozygote, one-fourth 414S homozygote, and one-half 414S / 414F heterozygote.

[0065] As shown in Table 1, the homozygous population 414F carrying S414F mutation has a resistance to ethiprole as high as 1140.62 times compared with the homozygous population 414S without S414F mutation. The homozygous population 414S without S414F mutation is very sensitive to ethiprole, with an LC 50 value of 0.355 mg / L, while the LC 50The value is 7.397 mg / L, it can be seen that the sensitivity of the homozygous population 414S without S414F mutation to ethiprole is significantly increased, and the homozygous population 414F carrying S414F mutation has significantly increased resistance to ethiprole. The sensitivity of the two hybrid F1 generations with genotype 414S / 414F heterozygote to ethiprole is similar, and the resistance to ethiprole is 14.72 times and 16.59 times that of the 414S homozygous population, respectively. The resistance level of the nymph population obtained by self-crossing the hybrid offspring to ethiprole is higher than that of the hybrid generation, which is 39.31 times and 48.75 times that of the 414S homozygous population, respectively, because the population contains one-fourth of the 414F homozygous type and one-half of the 414S / 414F heterozygote. From the results, it can be concluded that the ethiprole resistance mediated by S414F mutation is not completely recessive, and the degree of dominance D is -0.23. The resistance level of the 414F homozygous brown planthopper to ethiprole is much higher than that of the 414S / 414F heterozygote, so the frequency of the 414F homozygous brown planthopper in the population is particularly important to the resistance level of ethiprole. According to the results in Table 1, when the 414F homozygous brown planthopper accounts for one-fourth of the population, the resistance multiple relative to the 414S sensitive population reaches a medium level, so it is recommended that when the 414F homozygous brown planthopper accounts for one-fourth of the population, the use of pesticides such as ethiprole for control should be cautious.

[0066] The homozygous population 414S without S414F mutation and the homozygous population 414F carrying S414F mutation can also be isolated from any other population by this method. For example, the applicant isolated the homozygous population 414S without S414F mutation and the homozygous population 414F carrying S414F mutation from the indoor sensitive population S by this molecular marker and method. The indoor virulence assay also showed that the homozygous population carrying S414F mutation isolated from the sensitive population S has much higher resistance to ethiprole than the homozygous population without S414F mutation.

[0067] Example 4: Using populations carrying homozygous mutations and not carrying mutations to determine the detoxification relationship of the mutation with other pesticides As the bioassay method of Example 3, the bioassay of the obtained brown planthopper populations was performed using the rice seedling dipping method. The sensitivity difference of the two populations to fipronil and ethiprole, which are also phenylpyrazole insecticides, and to other types of insecticides was measured (Table 2). This indicates that the resistance of the brown planthopper population to other insecticides can also be effectively verified by the molecular marker and genetic method of the S414F mutation. As can be seen from Table 2, the homozygous population carrying the S414F mutation has a high level of resistance to fipronil and ethiprole, which are also phenylpyrazole insecticides, relative to the homozygous population not containing the S414F mutation; and has a low level of resistance to imidacloprid and nitenpyram. The resistance of the brown planthopper to neonicotinoid insecticides such as imidacloprid is already very serious, with a field resistance level of thousands of times. It is proved from the experiment that the CYP6CW1 S414F mutation has a low level of resistance to insecticides such as imidacloprid, but is not the major gene of the brown planthopper's resistance to neonicotinoid insecticides such as imidacloprid. In addition, as can be seen from Table 2, the homozygous population carrying the S414F mutation and the homozygous population not containing the S414F mutation have no obvious difference in resistance to other insecticides such as teflubenzuron, and are even more sensitive, proving that insecticides such as teflubenzuron are very suitable for use to control the brown planthopper carrying the S414F mutation in the field. Therefore, the homozygous population carrying the S414F mutation and the homozygous population not containing the S414F mutation constructed in this patent can be used to screen new insecticides for the brown planthopper resistant to ethiprole and other phenylpyrazole insecticides. Because such insecticides can indiscriminately kill the brown planthopper carrying the S414F mutation and the brown planthopper not containing the S414F mutation, the frequency of the brown planthopper carrying the S414F mutation in the population can be reduced (no screening effect on the S414F mutation or more killing of the S414F mutation brown planthopper) by using such insecticides, so as to achieve the purpose of delaying the continuous rise of the resistance to phenylpyrazole insecticides and neonicotinoid insecticides.

[0068] Table 2. Toxicity determination of the isolated populations carrying the 414th homozygous mutation and not carrying the 414th mutation to other insecticides a RR (resistance ratio) = LC 50 value of the 414F population / LC 50 value of the 414S population Example 5: Exclusion of the contribution of known target resistance mutations to the resistance of ethiprole In order to prove whether the difference in toxicity of ethiprole between the population carrying the homozygous mutation and the population not carrying the mutation is related to other sites, such as the A301S mutation of the GABA receptor, the frequency of the A301S mutation in the two populations and the original field population was detected.

[0069] (1) According to the sequence of GABA-gated chloride channel gene, a pair of primers were designed to amplify a sequence containing A301S mutation according to the reference 5; The primer sequences are as follows: A301S-F: ATCCAGTTCGTGCGTTCGATG (SEQ ID NO: 7) A301S-R: AGCAACGACGCGAACACCAT (SEQ ID NO: 8) (2) Using the above primers, the DNA crude extract of the single head of the brown planthopper as a template for PCR amplification, the amplification product was sent to Shengong sequencing to determine whether the 301 site was mutated.

[0070] Among them, the method of extracting single head DNA of the brown planthopper is the same as the method adopted in Example 1 of the present application; The PCR reaction system is also the same as the PCR method in Example 1, The PCR reaction program is 95℃ 3min, 94℃ 25s, 57℃ 25s, 72℃ 30s 34 cycles, 72℃ 5min.

[0071] The PCR product was identified by agarose gel electrophoresis Figure 4 ), and the PCR product with the purpose band was sent to Beijing Shengong Bioengineering Co., Ltd. for sequencing. Beijing Shengong Bioengineering Co., Ltd. will purify each sample before sequencing. The sequence of the PCR product was analyzed by chromas software, and the identification of the genotype of GABA A301S mutation is shown in Figure 5 .

[0072] The identification results of the genotype of GABA receptor A301S mutation in Table 3 show that 5% of the resistant homozygous genotype of A301S mutation is detected in the original field population, however, the GABA receptor A301S mutation is not detected in the 414 mutant homozygous population (414F), and the A301S mutation is also not detected in the 414S population. This proves that the high level of resistance of the 414F homozygous mutant population to ethiprole relative to the 414S population not carrying this mutation is not related to the GABA receptor A301S mutation.

[0073] Table 3. Identification of genotype frequency of GABA receptor A301S mutation RR is resistant homozygote, SS is sensitive homozygote, and SR is resistant heterozygote genotype. Example 6: Excluding the contribution of CYP6CW1 gene expression amount and P450 enzyme activity difference to ethiprole resistance To investigate whether the high level of resistance to ethiprole in 414F homozygous population is related to the expression level of CYP6CW1 gene, the relative expression level of CYP6CW1 gene and the activity of multi-functional oxidase in the two populations were detected.

[0074] The qPCR primers of CYP6CW1 gene were as follows: q-CYP6CW1-F: 5'-CCTTCCTACCACCAGGATCGATC (SEQ ID NO: 9)-3'; q-CYP6CW1-R: 5'-CCGTTAGACTGGCCAGGCTGCTCC (SEQ ID NO: 10)-3'.

[0075] The RNA was extracted by Trizol reagent (TaKaRa), and the main steps were performed according to the kit instructions. The synthesis of cDNA used PrimeScriptTMRT reagent Kit with gDNA Eraser (Perfect Real Time) kit (TaKaRa), and the reaction was performed in two steps according to the kit instructions. The kit used for quantitative PCR was TB Green Premix ExTaq (Tli RNaseH Plus) (TaKaRa), and the instrument used was Applied Biosystems 7500 Real-Time PCR System. The reaction system was performed according to the kit instructions.

[0076] The standard two-step PCR amplification program was used, (1) 95℃ 30 sec, pre-denaturation; (2) 95℃ 5 sec, denaturation; 60℃ 34 sec, annealing; 40 cycles. The relative expression level of the gene was selected as 2 -ΔΔCtFrance. Refer to the existing literature (Zimmer, C. T.; Garrood, W. T.; Singh, K. S.; Randall, E.; Lueke, B.; Gutbrod, O.; Matthiesen, S.; Kohler, M.; Nauen, R.; Davies, T. E.; Bass, C. Neofunctionalization of duplicated P450 genes drives the evolution of insecticide resistance in the brown planthopper. Curr. Biol. 2018, 28, 268−274.e5.) to use actin as an internal reference gene. The statistical analysis of the relative expression of the genes uses independent sample T test (SPSS 20.0, *P < 0.05; **P < 0.01; ***P < 0.001).

[0077] PNOD enzyme activity measurement: P450 activity was measured by determining p-nitrophenetole oxidase (PNOD) activity using p-nitrophenetole (p-NA) as a substrate. Fifteen third- to fourth-instar nymphs of each strain were homogenized on ice with 1 ml of buffer (0.1 M PBS, pH 7.5, 1 mM DTT, 1 mM PTU, 1 mM PMSF, 1 mM EDTA and 10% glycerol) and then centrifuged at 14,000 g for 20 min at 4°C. The supernatant was collected and used for P450 activity determination. The enzyme reaction system included 5-10 microliters of enzyme solution, phosphate buffer (0.1 M, pH 7.5), a final concentration of 0.2 mM p-NA and 9.6 mM NADPH, with a total reaction volume of 100 μL, and was incubated at 30°C for 30 min. The production of p-nitrophenol (p-NP) was determined by measuring the 405 nm absorbance (OD:405) of each well in a full-wavelength enzyme plate (Biotek) and comparing it with the p-NP standard curve. The determination of total protein in the enzyme solution was performed using the method in the literature (Bradford, M. M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein, utilizing the principle of protein-dyebinding. Analytical Biochemistry, 72, 248-254) by measuring the light absorption value of the sample at 595 nm with an enzyme marker.

[0078] The results show that the relative expression of CYP6CW1 gene in 414F homozygous population is significantly less than that in 414S population and original field population F Figure 6 ); the PNOD activity of 414F homozygous population is also significantly less than that in 414S population and original field population F Figure 7 ). Therefore, the resistance of 414F homozygous population to ethiprole is not related to the expression of CYP6CW1 gene, and is also not related to the total enzyme activity of P450 protein (if it is related to the expression of CYP6CW1 gene, it should be that the lower the expression, the lower the resistance to ethiprole), so it is speculated that it is related to the enhanced metabolic ability of ethiprole caused by S414 mutation of CYP6CW1 gene.

[0079] Example 7: Detection of the correlation between the mutation frequency of CYP6CW1 gene 414 and the resistance to ethiprole Because the above Example 3 shows that the homozygous population 414F carrying 414 mutation has more than 1000 times resistance to ethiprole than the homozygous population 414S not carrying 414 mutation, it is proved that the resistance of brown planthopper to ethiprole may be related to S414F mutation. In order to further prove the correlation between this mutation and the resistance to ethiprole, the F1 offspring female or male obtained by crossing the homozygous population 414 and the population not carrying 414 mutation are backcrossed with the male or female of the population not carrying 414 mutation to obtain F2 offspring, and then the same bioassay method is used to treat the nymphs of each backcross line with ethiprole.

[0080] During the treatment process, dead (dead within 48 hours) and surviving nymphs (after 96 hours) are collected. For the backcross lines of 414S and 414F, the concentration of ethiprole treatment is 1.6 ppm; after ethiprole treatment, genotyping is performed on the dead and surviving individuals to detect the genotype of each individual S414F mutation. The genotyping method is the same as that in Example 1. The results in Table 4 show that in the backcross experiment between 414S and 414F populations, there is a significant correlation between carrying 414-F (TTC) mutation and the dominance of ethiprole resistance (P<0.0001).

[0081] Table 4. Backcross between 414S and 414F (ethiprole treatment concentration 0.2 ppm) a: 414S / 414F shows 414-TCC / TTC heterozygote, and 414S / 414S shows 414-TCC / TCC homozygote; b: p value in two-sided Fisher's exact test.

[0082] In summary, CYP6CW1 gene is one of the main detoxification enzyme genes of brown planthopper, and the mutation of the 414th amino acid of the protein coded by CYP6CW1 gene is a natural mutation of the brown planthopper population in the field. Therefore, the mutation of CYP6CW1 gene is verified for the detoxification function of insecticides by constructing a transgenic fruit fly carrying the mutant CYP6CW1 gene, and the brown planthopper population carrying and not carrying the homozygous mutation is separated to verify the detoxification function of the mutation on insecticides, and the result is more reliable and credible. The brown planthopper strains carrying and not carrying the homozygous mutation constructed in the application have different resistance to ethiprole: the sensitivity of the brown planthopper strain without S414F mutation to ethiprole is relatively high, which is significantly higher than that of the original field population, while the sensitivity of the strain with S414F mutation to ethiprole is significantly decreased, and the resistance is not only 61.7 times of the original field population, but also 1140 times of the brown planthopper strain without S414F mutation. The two genotypic populations separated in the application are from the same population, and are the offspring of more than 10 pairs of the same genotype of female and male, so the genetic background of the two populations tends to be consistent. In addition, by detecting the genotype frequency of A301S mutation of the target GABA receptor of the two populations, it is found that the frequency of A301S mutation of the population with S414F homozygous mutation and the population without S414F mutation is very low, and the expression amount of CYP6CW1 gene in the population with S414F homozygous mutation is not higher than that in the population without S414F mutation, so it is proved that the difference in resistance to ethiprole of the two populations is not related to the expression amount of CYP6CW1 gene and the mutation of GABA target. In addition, it is further proved by genetic linkage that S414F of CYP6CW1 gene is closely related to the resistance to ethiprole.

[0083] In addition, the two different genotypes of the strain in the application were used to detect other pesticides which were not clear whether related to CYP6CW1 gene mutation, including two other pesticides of the benzoylurea insecticide, fipronil and dinotefuran, and imidacloprid, nitenpyram and triflumezopyrim, and the results are shown in Table 2. The S414F homozygous mutant population showed high level of resistance to fipronil and dinotefuran relative to the population without S414F mutation, which indicated that S414F mutation could lead to resistance to benzoylurea insecticides including ethiprole, fipronil and dinotefuran. The S414F homozygous mutant population showed lower sensitivity to imidacloprid and nitenpyram relative to the population without S414F mutation, showing resistance. This indicates that the brown planthopper with S414F homozygous mutation not only has greatly increased resistance to ethiprole, but also has slightly increased resistance to other neonicotinoid insecticides. Therefore, in the selection of pesticides for the control of brown planthoppers in the field, attention should be paid to the use of neonicotinoid insecticides such as imidacloprid and nitenpyram after the application of ethiprole. In addition, if the sensitivity of the S414F homozygous mutant population to a certain compound is increased compared with the population without S414F mutation, it indicates that the CYP6CW1 gene S414F homozygous mutation contributes little to the detoxification of this pesticide in the brown planthopper, and can be used to control the brown planthopper resistant to the above-mentioned pesticides, reduce the frequency of CYP6CW1 gene S414F mutation in the brown planthopper population, thereby reducing the resistance level of the population to ethiprole and neonicotinoid insecticides, and achieving the purpose of resistance management. For example, triflumezopyrim mentioned in the present application, the sensitivity of the S414F homozygous mutant population to triflumezopyrim is increased relative to the population without S414F mutation, so the next round of pesticides can be selected to use insecticides such as triflumezopyrim after the application of ethiprole for control, which can reduce the frequency of CYP6CW1 gene S414F mutation in the brown planthopper population, that is, it can improve the field control effect and achieve the purpose of resistance management, and delay the production of resistance. Therefore, it is necessary to continue to determine the toxicity of various pesticides, especially new pesticides, to the CYP6CW1 gene S414F homozygous mutant population and the population without S414F mutation constructed in the present application, and screen pesticides for the control of brown planthoppers resistant to ethiprole and neonicotinoid insecticides, which is very meaningful for the management of resistance of brown planthoppers.

[0084] In summary, the method and strain of constructing two different genotypes of CYP6CW1 gene brown planthopper strain based on S414F mutation can be used for the determination of insecticide resistance and the screening of new insecticides for the control of brown planthoppers.

[0085] The preferred embodiments of the application are described in detail above, but the application is not limited to the specific details in the above embodiments, and various simple modifications can be made to the technical solutions of the application within the scope of the technical concept of the application, and these simple modifications all belong to the protection scope of the application.

[0086] It should be further noted that any technically feasible combination of the various technical features described in the above embodiments is possible, provided that there is no contradiction, and the disclosure of the present application should be deemed to include all such technically feasible combinations.

[0087] Furthermore, any combination of the various embodiments of the present application is possible, provided that there is no contradiction, and the disclosure of the present application should be deemed to include all such technically feasible combinations.

Claims

1. A pair of primers, characterized in that, The primer pair comprises: a forward primer: CAGGCTTACGACATAGAAATGAC (SEQ ID NO: 3), a reverse primer: GATCCAAGTGAATGCCGATAAC (SEQ ID NO: 4); The primer pair is used for detecting a molecular marker of a brown planthopper insecticide resistance, and the molecular marker comprises a nucleotide at position 414 of SEQ ID NO: 1, wherein the nucleotide at position 414 of SEQ ID NO: 1 is serine S or phenylalanine F or a serine / phenylalanine hybrid.

2. A kit characterized in that, The kit comprises the primer pair of claim 1.

3. Use of a primer pair according to claim 1 or a kit according to claim 2, characterized in that, The application comprises: (1) identifying a brown planthopper resistance to an insecticide, wherein the insecticide comprises a pyrazole insecticide; (2) preventing or screening a brown planthopper from an insecticide.

4. Use according to claim 3, characterized in that, The pyrazole insecticide comprises ethiprole, dinotefuran or fipronil.

5. A method for identifying resistance of a brown planthopper to an insecticide, characterized by, The identification method comprises detecting a gene of the brown planthopper by using the primer pair of claim 1 or the kit of claim 2, and the insecticide comprises a pyrazole insecticide.

6. The method of authentication of claim 5, wherein, The identification method comprises judging whether the brown planthopper is sensitive to the insecticide according to a detection result, wherein the brown planthopper with serine S at position 414 of the molecular marker is a non-mutant brown planthopper, and the non-mutant brown planthopper is sensitive to the insecticide; the brown planthopper with phenylalanine F at position 414 of the molecular marker is a homozygous mutant brown planthopper, and the mutant brown planthopper has the insecticide resistance; and the brown planthopper with serine S / phenylalanine F at position 414 of the molecular marker is a hybrid brown planthopper, and the hybrid brown planthopper has a pyrazole insecticide resistance between the non-mutant brown planthopper and the homozygous mutant brown planthopper.

7. The method of identification according to claim 5 or 6, characterized in that, The pyrazole insecticide comprises ethiprole, dinotefuran or fipronil.

8. A method for controlling the brown planthopper, characterized by, The prevention method comprises preventing the brown planthopper according to a result of the identification method of any one of claims 5-7, 1) if the brown planthopper is a non-homozygous mutant brown planthopper population, a pyrazole insecticide or a small amount of pyrazole insecticide can be applied; 2) if the brown planthopper is a homozygous mutant brown planthopper population or the homozygous mutant brown planthopper is a dominant population, an insecticide other than the pyrazole insecticide is applied. Preferably, the non-homozygous mutant brown planthopper comprises a non-mutant or 414S / 414F hybrid; Preferably, the homozygous mutant brown planthopper is a dominant population, which means that the homozygous mutant brown planthopper accounts for at least more than one fourth of the brown planthopper.

9. The control method according to claim 8, characterized by, The pyrazole insecticide comprises ethiprole, dinotefuran or fipronil.

10. A method for screening of a brown planthopper insecticide, characterized by, The screening method comprises 1) isolating a homozygous mutant brown planthopper population and a wild-type homozygous brown planthopper population according to the identification method of any one of claims 5-7, 2) applying a candidate insecticide to the homozygous mutant brown planthopper population and the wild-type homozygous brown planthopper population to screen an insecticide with no difference in toxicity to the two populations or stronger toxicity to the homozygous mutant brown planthopper population, wherein the candidate insecticide does not comprise a pyrazole insecticide.

Images