SiRNA with anti-skin cell aging and repairing effect and application thereof

Abstract

The present application relates to the field of molecular biology and biomedicine technology, and particularly relates to an siRNA with anti-skin cell aging and repair effect and application thereof.The siRNA comprises a guide chain and a passenger chain.The siRNA targets a bone bridge protein coding gene SPP1.The siRNA has excellent anti-aging effect and can be used for preparing anti-aging products.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of molecular biology and biomedicine, and particularly relates to a siRNA with anti-skin cell aging and repair effects and application thereof. BACKGROUND

[0002] Skin aging is a complex biological process driven by intrinsic aging, extrinsic photoaging and chronic inflammation. Among them, persistent low-grade inflammation can activate immune cells, promote the release of pro-inflammatory cytokines such as IL-1β and TNF-α, and then induce oxidative stress and accelerate the degradation of extracellular matrix, ultimately leading to collagen loss, elastic fiber damage and impaired skin barrier function, resulting in skin wrinkles, laxity and decreased repair capacity. Therefore, inhibiting chronic inflammation has become one of the important strategies to delay skin aging.

[0003] Natural active ingredient ursolic acid, as a pentacyclic triterpenoid compound, has been proven to slow down skin photoaging through anti-inflammatory and antioxidant effects, and can reduce the production of inflammatory factors by blocking the binding of SPP1 to its receptor and inhibiting the activation of ERK signaling pathway, which is the potential molecular mechanism of delaying skin photoaging. However, ursolic acid has significant application limitations, which restricts the exertion of its anti-aging effect. Specifically, ursolic acid has poor water solubility, poor stability and dispersibility in water-based formulations; it has low transdermal rate and is difficult to effectively reach the dermis, the key action site of aging; it has low bioavailability and lacks specificity, which may non-selectively affect multiple signaling pathways, leading to fluctuations in skin barrier function; and it has a short half-life and limited duration of drug effect, requiring frequent use to maintain effectiveness. These defects make it difficult to meet the precise intervention needs of skin anti-aging.

[0004] Therefore, there is still an urgent need for a product with good anti-aging and repair effects. SUMMARY

[0005] To provide a product with excellent anti-aging and repair effects, the present application provides the following technical solutions.

[0006] Researchers found that the up-regulated differential proteins were significantly enriched in PI3K / AKT, focal adhesion and ECM-receptor interaction signaling pathways closely related to cell aging by performing KEGG pathway analysis on the transcriptome data of senescent fibroblasts. Further cross-analysis showed that the coding gene SPP1 of Osteopontin (OPN) was a common core gene of the three pathways, suggesting that SPP1 may be a key regulatory factor in the process of skin cell aging.

[0007] SPP1, as a component of extracellular matrix and a multifunctional pro-inflammatory cytokine, plays a key role in skin inflammation and aging. It can significantly enhance the local inflammatory response in the skin by promoting the expression and release of inflammatory cytokines such as IL-6 and CXCL1. At the same time, SPP1 can bind to receptors such as CD44, integrin αvβ3, and α5β1, mediating the migration and adhesion of immune cells to the inflammatory site, and recruiting immune cells such as neutrophils and macrophages to infiltrate the skin, further exacerbating the local inflammatory state. In addition, SPP1 can up-regulate the expression of various matrix metalloproteinases such as MMP-1, MMP-9, and MMP-13, accelerating collagen degradation and extracellular matrix destruction, and participating in skin structure remodeling and aging. This makes SPP1 closely related to various skin diseases such as psoriasis, contact dermatitis, skin cancer, and photoaging, further indicating its core regulatory position in skin inflammation and aging.

[0008] Small interfering RNA (siRNA) can specifically degrade target mRNA, achieving efficient inhibition of protein expression. Compared with small molecule components such as ursolic acid, siRNA has significant advantages in target specificity, action durability, and designability, providing a new technical direction for precisely blocking skin aging drivers.

[0009] In a first aspect, the present application provides a siRNA.

[0010] A siRNA, comprising a guide strand and a passenger strand; the guide strand and the passenger strand are selected from at least one group from the following groups:

[0011] (1) Guide strand: SEQ ID NO: 1 ((5'→3'): UGUUGUAAAGCUGCUUUUCCU);

[0012] Passenger strand SEQ ID NO: 2 ((5'→3'): GAAAAGCAGCUUUACAACAAA);

[0013] (2) Guide strand: SEQ ID NO: 3 ((5'→3'): AAUUCACGGCUGACUUUGGAA);

[0014] Passenger strand SEQ ID NO: 4 ((5'→3'): CCAAAGUCAGCCGUGAAUUCC);

[0015] (3) Guide strand: SEQ ID NO: 5 ((5'→3'): AUGAGAAAUACGAAAUUUCAG);

[0016] Passenger strand SEQ ID NO: 6 ((5'→ 3'): GAAAUUUCGUAUUUCUCAUGA).

[0017] In some preferred embodiments, the guide strand and the passenger strand of the siRNA are selected from Group (1), which targets and cleaves the mRNA of the SPP1 gene (the CD's nucleotide sequence of the SPP1 gene is SEQ ID NO: 25, and its sequence number in the NCBI database (National Center for Biotechnology Information database) is NM_000582.3) with higher efficiency and has better anti-aging efficacy.The nucleotide sequence of SEQ ID NO: 25 is specifically: atgagaattgcagtgatttgcttttgcctcctaggcatcacctgtgccataccagttaaacaggctgattctggaagttctgaggaaaagcagctttacaacaaatacccagatgctgtggccacatggctaaaccctgacccatctcagaagcagaatctcctagccccacagacccttccaagtaagtccaacgaaagccatgaccacatggatgatatggatgatgaagatgatgatgaccatgtggacagccaggactccattgactcgaacgactctgatgatgtagatgacactgatgattctcaccagtctgatgagtctcaccattctgatgaatctgatgaactggtcactgattttcccacggacctgccagcaaccgaagttttcactccagttgtccccacagtagacacatatgatggccgaggtgatagtgtggtttatggactgaggtcaaaatctaagaagtttcgcagacctgacatccagtaccctgatgctacagacgaggacatcacctcacacatggaaagcgaggagttgaatggtgcatacaaggccatccccgttgcccaggacctgaacgcgccttctgattgggacagccgtgggaaggacagttatgaaacgagtcagctggatgaccagagtgctgaaacccacagccacaagcagtccagattatataagcggaaagccaatgatgagagcaatgagcattccgatgtgattgatagtcaggaactttccaaagtcagccgtgaattccacagccatgaatttcacagccatgaagatatgctggttgtagaccccaaaagtaaggaagaagataaacacctgaaatttcgtatttctcatgaattagatagtgcatcttctgaggtcaattaa.

[0018] In some embodiments, one or more stabilizing modifications are further included in the guide strand and / or passenger strand of the siRNA, thereby, resisting nuclease degradation, prolonging half-life, optimizing pharmacokinetics, reducing renal clearance, reducing immunogenicity, reducing side effects, etc.

[0019] In some embodiments, the stabilizing modifications include 2'-O-methyl modifications, 2'-fluoro modifications, or phosphorothioate modifications.

[0020] In some embodiments, the siRNA targets the gene SPP1 encoding osteopontin.

[0021] In a second aspect, the present application provides a composition.

[0022] A composition comprising the siRNA of the first aspect.

[0023] In some embodiments, the composition further comprises a pharmaceutically or cosmetically acceptable excipient or carrier.

[0024] In some embodiments, the carrier comprises a liposome or an exosome.

[0025] In a third aspect, the present application provides a DNA molecule.

[0026] A DNA molecule encoding the siRNA of the first aspect.

[0027] In a fourth aspect, the present application provides a recombinant expression vector.

[0028] A recombinant expression vector comprising the siRNA of the first aspect or the DNA molecule of the second aspect.

[0029] In a fifth aspect, the present application provides a recombinant cell.

[0030] A recombinant cell expressing the siRNA of the first aspect or the DNA molecule of the second aspect.

[0031] In some embodiments, the recombinant cell comprises the recombinant expression vector of the fourth aspect.

[0032] In a sixth aspect, the present application provides use of the foregoing siRNA, the foregoing composition, the foregoing DNA molecule, the foregoing recombinant expression vector, the foregoing recombinant cell.

[0033] Use of the siRNA of the first aspect, the composition of the second aspect, the DNA molecule of the third aspect, the recombinant expression vector of the fourth aspect, the recombinant cell of the fifth aspect in the manufacture of a medicament or a cosmetic for silencing the gene SPP1 encoding osteopontin.

[0034] In some embodiments, the drug or cosmetic is for repair and / or anti-aging.

[0035] In a seventh aspect, the present application provides a drug or cosmetic.

[0036] A drug or cosmetic comprising the siRNA of the first aspect or the composition of the second aspect.

[0037] Advantages

[0038] Compared with the prior art, certain embodiments of the present application have at least one of the following advantages:

[0039] (1) The siRNA ((1) SEQ ID NO: 1 and SEQ ID NO: 2, (2) SEQ ID NO: 3 and SEQ ID NO: 4, or (3) SEQ ID NO: 5 and SEQ ID NO: 6) provided by the present application has a good effect of knocking down the mRNA level of SPP1 gene, is conducive to significantly reducing inflammatory factors such as IL-6, CXCL1, MCP-1, MMP1, is conducive to improving the expression of collagen-related genes, avoids the loss or degradation of type I collagen protein, reduces the positive rate of cell senescence-related β-galactosidase (SA-β-Gal), reduces wrinkles, reduces the hemoglobin level of the skin, and has excellent anti-aging and repair effects.

[0040] (2) The present application preferably uses SEQ ID NO: 1 and SEQ ID NO: 2, which is more conducive to improving the efficiency of knocking down SPP1, is more conducive to significantly reducing inflammatory factors such as IL-6, CXCL1, MCP-1, MMP1, is more conducive to improving the expression of collagen-related genes, is more conducive to avoiding the loss or degradation of type I collagen protein, is more conducive to reducing the positive rate of cell β-galactosidase (SA-β-Gal), is more conducive to reducing wrinkles, is more conducive to reducing the hemoglobin level of the skin, has excellent anti-aging and repair effects, and has unexpected technical effects. BRIEF DESCRIPTION OF DRAWINGS

[0041] Figure 1Figure 6. KEGG pathway enrichment analysis of differentially expressed genes between high passage P27 group and low passage P4 group in Example 1. "Top 25 of KEGG Enrichment" represents the top 25 enriched Kyoto Encyclopedia of Genes and Genomes (KEGG) signaling pathways; "Rich Factor" represents the enrichment factor, which is an indicator of the degree of enrichment of differentially expressed genes; "Gen Number" represents the number of genes; "pvalue" represents the p-value, which is the probability of significance; "Arrhythmic right ventricular cardiomyopathy" represents arrhythmic right ventricular cardiomyopathy; "Focal adhesion" represents focal adhesion; "ECM-receptor interaction" represents ECM (extracellular matrix)-receptor interaction; "Hypertrophic Cardiomyopathy" represents hypertrophic cardiomyopathy; "PI3K-Akt signaling pathway" represents phosphatidylinositol 3-kinase-protein kinase B signaling pathway; "Small cell lung cancer" represents small cell lung cancer; "GnRH Secretion" represents gonadotropin-releasing hormone secretion; "Melanoma" represents melanoma; "Bladder cancer" represents bladder cancer; "Apelin signaling pathway" represents Apelin (ligand of angiotensin receptor AT1 related receptor protein) signaling pathway; "Axon regeneration" represents axon regeneration; "Endocrine resistance" represents endocrine resistance; "Viral carcinogenesis" represents viral carcinogenic factor; "Oxytocin signaling pathway" represents oxytocin signaling pathway; "Glycerolipid metabolism" represents glycerolipid metabolism; "Human papillomavirus infection" represents human papillomavirus infection; "Dilated cardiomyopathy" represents dilated cardiomyopathy; "p53 signaling pathway" represents p53 signaling pathway; "Non-small cell lung cancer" represents non-small cell lung cancer; "Ras signaling pathway" represents Ras protein signaling pathway; "Thyroid cancer" represents thyroid cancer; "Calcium signaling pathway" represents calcium signaling pathway; "Alcoholism" represents alcoholism."FoxO signaling pathway" refers to forkhead box O subfamily signaling pathway; "EGFR tyrosine kinase inhibitor resistance" refers to EGFR (epidermal growth factor receptor) tyrosine kinase inhibitor resistance.

[0042] Figure 2 Figure for SPP1 gene mRNA level detection results in Example 2, wherein A is the mRNA level chart of SPP1 gene in HaCaT-un-H2O2 treated control group (Ctrl) and HaCaT-H2O2 treated group (H2O2); B is the mRNA level chart of SPP1 gene in NHDFs-un-H2O2 treated control group (Ctrl) and NHDFs-H2O2 treated group (H2O2); C is the mRNA level chart of SPP1 gene in HaCaT-un-irradiation control group (Ctrl) and HaCaT-UVB irradiation group (UVB); D is the mRNA level chart of SPP1 gene in NHDFs-un-irradiation control group (Ctrl) and NHDFs-UVB irradiation group (UVB).

[0043] Figure 3 Figure for fluorescence quantitative PCR detection results of Example 4, wherein A is the mRNA level chart of SPP1 gene in human dermal fibroblasts (NHDFs), negative control group (siNC transfected cells), cells transfected with siSPP1-1, siSPP1-2 and siSPP1-3; B is the mRNA level chart of SPP1 gene in human epidermal keratinocytes (HaCaT), negative control group (siNC transfected cells), cells transfected with siSPP1-1, siSPP1-2 and siSPP1-3.

[0044] Figure 4Figure 5 is a statistical chart of the results of the fluorescent quantitative PCR detection of Example 5, in which A is a statistical chart of the expression levels of SPP1 of the negative control non-irradiation group (siNC in the figure and data not marked with UVB), the negative control irradiation group (siNC in the figure and data marked with UVB), the siSPP1-1 group, and the positive control group (UA in the figure and data marked with UVB); B is a statistical chart of the expression levels of IL-6 (interleukin-6), CXCL1 (C-X-C chemokine ligand 1), and MCP-1 (monocyte chemotactic protein-1) of the negative control non-irradiation group (siNC in the figure), the negative control irradiation group (siNC+UVB in the figure), the siSPP1-1 group (siSPP1-1+UVB in the figure), and the positive control group (UV+UVB in the figure); C is a statistical chart of the expression levels of MMP1 (matrix metalloproteinase 1), COL1A1, and COL3A1 of the negative control non-irradiation group (siNC in the figure), the negative control irradiation group (siNC+UVB in the figure), the siSPP1-1 group (siSPP1-1+UVB in the figure), and the positive control group (UV+UVB in the figure).

[0045] Figure 5 Figure 6 is a statistical chart of the results of the ELISA detection of Example 5, in which A is a statistical chart of the levels of the secretion of the inflammatory factor IL-6 of human dermal fibroblasts induced by the negative control non-irradiation group (siNC in the figure and data not marked with UVB), the negative control irradiation group (siNC in the figure and data marked with UVB), the siSPP1-1 group, and the positive control group (UA in the figure and data marked with UVB); B is a statistical chart of the levels of the secretion of the type I collagen precursor (PIP) of human dermal fibroblasts induced by the negative control non-irradiation group (siNC in the figure and data not marked with UVB), the negative control irradiation group (siNC in the figure and data marked with UVB), the siSPP1-1 group, and the positive control group (UA in the figure and data marked with UVB).

[0046] Definitions of terms:

[0047] In the present application, “room temperature” refers to the ambient temperature, which can be 20-30°C; in some embodiments, 22-28°C; in some embodiments, 24-26°C; and in some embodiments, 25°C.

[0048] In the foregoing of the present application, all the numbers disclosed herein are approximate values. Based on the disclosed numbers, the value of each number can have a difference of ±10% or a reasonable difference recognized by those skilled in the art, such as ±1%, ±2%, ±3%, ±4%, or ±5%.

[0049] The terms "optional", "optionally", or "optional" mean that the subsequently described event or circumstance can or can not occur. For example, "optional surfactant" means that surfactant can or can not be present.

[0050] The term "and / or" is to be construed in the sense that it means either one or both of the items it connects.

[0051] In the description of the present specification, the description of the terms "one embodiment", "some embodiments", "an example", "a specific example", or "some examples" etc. means that the specific features, structures, materials or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the present application. In the present specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any suitable manner in one or more embodiments or examples. In addition, the person skilled in the art can combine and combine the different embodiments or examples described in the present specification and the features of the different embodiments or examples without contradiction.

[0052] "UVB" means ultraviolet light with a wavelength of 280-320 nm, also known as medium wave erythema effect ultraviolet light.

[0053] The U in the RNA nucleotide sequence is reserved in the claim and the body of the specification as a "true description of the actual molecular structure", and the accompanying sequence listing replaces the U in the RNA nucleotide sequence with T according to the format specification. DETAILED DESCRIPTION

[0054] In order for those skilled in the art to better understand the technical solutions of the present application, some non-limiting embodiments are further disclosed below to further illustrate the present application.

[0055] The reagents used in the present application can be purchased from the market or can be prepared by the methods described in the present application.

[0056] The experimental methods of the embodiments not specified in the specific conditions are generally according to the known means in the art.

[0057] First, the reagents used in the embodiments of the present application can be obtained from conventional commercially available products or the following sources or the following preparation methods

[0058] Human keratinocyte HaCaT: purchased from Hunan Fenghui Biotechnology Co., Ltd.

[0059] Human dermal fibroblasts NHDFs: purchased from Hunan Fenghui Biotechnology Co., Ltd.

[0060] PBS solution (i.e., PBS): Phosphate buffered saline solution, purchased from Gibco.

[0061] DMEM complete medium: Serum-free DMEM (Promocell) + 10% fetal bovine serum (Gibco).

[0062] OPTI medium: Purchased from Gibco.

[0063] Lipofectamine™ 3000 transfection reagent: Purchased from Thermo Fisher Scientific.

[0064] 0.25% (w / w) trypsin: Purchased from Gibco.

[0065] Example 1: Screening of target gene SPP1

[0066] 1. Experimental method

[0067] Through systematic analysis of cell sample data in a public transcriptome database (GEO database, accession number: GSE191055), candidate genes closely related to cell aging were quickly screened and determined. The database contains two types of human fibroblast samples: one is the high passage group, i.e., fibroblasts passaged 27 times (P27), which is used to simulate cells in the aging state; the other is the low passage group, i.e., fibroblasts passaged 4 times (P4), which is used as a non-aging control group.

[0068] First, using differential expression analysis method, the transcriptome data of P27 group and P4 group were compared, and genes with significant differences between the two groups were screened. The differential screening criteria were set as: log2 FoldChange greater than or equal to 1.5, and the significance level p value less than 0.05.

[0069] Subsequently, the differentially expressed genes were subjected to KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway enrichment analysis to evaluate their distribution characteristics and enrichment in different biological pathways. According to the analysis results, the signal pathways enriched by the significantly up-regulated genes in the high passage group (P27) were further screened as potential functional pathways closely related to cell aging.

[0070] Finally, cross comparison and correlation analysis were carried out on the above pathways to screen the common core genes. This method can effectively eliminate the redundant information that may exist in pathway analysis, and quickly focus on the key molecules that truly drive the aging process.

[0071] 2. Experimental results

[0072] The KEGG pathway enrichment analysis chart of the differentially expressed genes of the high passage P27 group and the low passage P4 group is shown in FIG. 2, wherein the larger the dot size, the more the number of genes enriched to the pathway, and the more the color deviates from red, the smaller the p value, that is, the higher the significance. Figure 1

[0073] The present application preferably selects three signal pathways that are highly related to cell aging, have the highest significance level and the most enriched genes, namely Focal adhesion, ECM-receptor interaction and PI3K-AKT signaling pathway, and performs cross analysis on them, and screens the genes that are commonly enriched by them, as shown in the following table. The present application finally determines the candidate gene SPP1 (Secreted Phosphoprotein 1, also known as Osteopontin) that exists in multiple pathways and has the largest difference ratio, as a key regulatory gene related to aging.

[0074] Table 1: Cross analysis result table in Example 1

[0075]

[0076] Example 2: Expression verification of target gene SPP1

[0077] Experimental method

[0078] 1.1 Construction of hydrogen peroxide (H2O2) induced cell aging model

[0079] (1) HaCaT-H2O2 treatment group: human keratinocytes HaCaT were inoculated in cell culture dishes and cultured at 37°C, 5% CO2 to 70-80% confluence. Discard the culture medium, and pretreat with serum-free DMEM for 2 h. Then add H2O2 solution with a final concentration of 200 μM, and act for 2 h. Discard the treatment solution, wash twice with PBS, replace with fresh serum-containing medium, and continue to culture for 24 h before collecting the cells for subsequent experiments.

[0080] (2) NHDFs-H2O2 treatment group: the difference from the HaCaT-H2O2 treatment group is that human keratinocytes HaCaT are replaced by human dermal fibroblasts NHDFs, and the rest of the operation is the same as that of the HaCaT-H2O2 treatment group.

[0081] (3) HaCaT-un-H2O2 treatment control group: the difference from the HaCaT-H2O2 treatment group is that H2O2 is replaced by PBS solution, and the rest of the operation is the same as that of the HaCaT-H2O2 treatment group.

[0082] ​(4) NHDFs-Non-H2O2 treatment control group: the difference from NHDFs-H2O2 treatment group is that H2O2 is replaced by PBS solution, and the rest of the operation is the same as NHDFs-H2O2 treatment group.

[0083] 1.2 Construction of cell senescence model induced by UV irradiation

[0084] (1) HaCaT irradiation group: human keratinocytes HaCaT were inoculated in cell culture dishes and cultured at 37°C, 5% CO2 to 70-80% confluence. The culture medium was discarded, and the cells were washed with PBS twice, and a small amount of PBS was added to cover the cells. UVB light source was used for irradiation, and the dose was set to 30 mJ / cm 2 (HaCaT), and immediately after irradiation, fresh serum-containing medium was replaced, and the cells were cultured for 24 h before being collected for subsequent experiments.

[0085] (2) NHDFs irradiation group: the difference from HaCaT irradiation group is that human keratinocytes HaCaT are replaced by human dermal fibroblasts NHDFs, and the dose of UVB light source irradiation is set to 40 mJ / cm 2 , and the rest of the operation is the same as HaCaT irradiation group.

[0086] (3) HaCaT non-irradiation control group: the difference from HaCaT irradiation group is only that UVB irradiation is not performed, and the rest of the operation is the same as HaCaT irradiation group.

[0087] (4) NHDFs non-irradiation control group: the difference from NHDFs irradiation group is only that UVB irradiation is not performed, and the rest of the operation is the same as NHDFs irradiation group.

[0088] 1.3 Fluorescent quantitative PCR detection of SPP1 gene mRNA level

[0089] 1 mL Trizol was added to the HaCaT-H2O2 treatment group, HaCaT-Non-H2O2 treatment control group, NHDFs-H2O2 treatment group, NHDFs-Non-H2O2 treatment control group collected in step 1.1, and HaCaT-UVB irradiation group, HaCaT-non-irradiation control group, NHDFs-UVB irradiation group, NHDFs-non-irradiation control group collected in step 1.2, and the cells were lysed.

[0090] After the completion of cell lysis, the RNA of HaCaT-H2O2 treatment group, HaCaT- non-H2O2 treatment control group, NHDFs-H2O2 treatment group, NHDFs-non-H2O2 treatment control group, HaCaT-UVB irradiation group, HaCaT-non-irradiation control group, NHDFs-UVB irradiation group, NHDFs-non-irradiation control group cells were extracted by acid thiocyanate guanidine-phenol-chloroform extraction method respectively.

[0091] The RNA of HaCaT-H2O2 treatment group, HaCaT-non-H2O2 treatment control group, NHDFs-H2O2 treatment group, NHDFs-non-H2O2 treatment control group, HaCaT-UVB irradiation group, HaCaT-non-irradiation control group, NHDFs-UVB irradiation group, NHDFs-non-irradiation control group cells were used as templates, and the HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) reverse transcription kit (Nanjing Novozyme, R312-01) was used to mix well according to the reaction system shown in Table 2, 42°C for 2min, remove genomic DNA, then mix well according to the reverse transcription system in Table 3, incubate at 37°C for 15min, heat at 85°C for 5s, and obtain the cDNA of HaCaT-H2O2 treatment group, HaCaT-non-H2O2 treatment control group, NHDFs-H2O2 treatment group, NHDFs-non-H2O2 treatment control group, HaCaT-UVB irradiation group, HaCaT-non-irradiation control group, NHDFs-UVB irradiation group, NHDFs-non-irradiation control group cells respectively.

[0092] Table 2: Genomic removal reaction system

[0093]

[0094] Table 3: First strand cDNA synthesis reaction system

[0095]

[0096] The cDNA of HaCaT-H2O2 treatment group cells, the cDNA of HaCaT-un-H2O2 treatment control group cells, the cDNA of NHDFs-H2O2 treatment group cells, the cDNA of NHDFs-un-H2O2 treatment control group cells, the cDNA of HaCaT-UVB irradiation group cells, the cDNA of HaCaT-un-irradiation control group cells, the cDNA of NHDFs-UVB irradiation group cells, and the cDNA of NHDFs-un-irradiation control group cells were used as templates, and the PerfectStart Green qPCR SuperMix fluorescent quantitative kit (Quanta, AQ601-01-V2) was used for real-time fluorescent quantitative detection according to the kit instructions, and the corresponding Ct values were obtained, and the transcription level (i.e. mRNA level) of SPP1 gene in each group of cells was calculated according to 2 - Δ ΔCt .

[0097] In the process of fluorescent quantitative PCR detection, the forward primer of SPP1 gene is as shown in SEQ ID NO: 7, the reverse primer of SPP1 gene is as shown in SEQ ID NO: 8, the forward primer of the reference gene β-actin is as shown in SEQ ID NO: 9, and the reverse primer of the reference gene β-actin is as shown in SEQ ID NO: 10.

[0098] Table 4 Primer information used in the process of fluorescent quantification

[0099]

[0100] Experimental results

[0101] The fluorescent quantitative PCR detection result chart is as shown in Figure 2 ; A is the mRNA level chart of SPP1 gene of HaCaT-un-H2O2 treatment control group (Ctrl) and HaCaT-H2O2 treatment group (H2O2); B is the mRNA level chart of SPP1 gene of NHDFs-un-H2O2 treatment control group (Ctrl) and NHDFs-H2O2 treatment group (H2O2); C is the mRNA level chart of SPP1 gene of HaCaT-un-irradiation control group (Ctrl) and HaCaT-UVB irradiation group (UVB); D is the mRNA level chart of SPP1 gene of NHDFs-un-irradiation control group (Ctrl) and NHDFs-UVB irradiation group (UVB).

[0102] The results show that:

[0103] (1) Compared with the un-H2O2 treatment control group (Ctrl), the mRNA level of SPP1 gene in H2O2 treatment-induced oxidative stress type senescent HaCaT cells and NHDFs cells was significantly increased.

[0104] (2) Compared with the non-irradiation control group (Ctrl), the mRNA level of SPP1 gene in the UVB irradiation-induced photoaging HaCaT cells and NHDFs cells was significantly increased.

[0105] The results show that after the human epidermal keratinocytes HaCaT and dermal fibroblasts NHDFs are induced to age by different methods, the expression amount of SPP1 is up-regulated, which is consistent with the sequencing result.

[0106] Example 3 Design and synthesis of siRNA targeting SPP1 gene

[0107] Design of siRNA: including siSPP1-1, siSPP1-2 and siSPP1-3, the nucleotide sequences of which are shown in Table 5.

[0108] Design of siNC: the nucleotide sequence is shown in Table 5. siNC is composed of the same bases as siSPP1-1, AA is fixed as the starting, and the remaining 19 bases are randomly arranged, and BLAST comparison is performed to determine that there is no obvious homology with SPP1 and known genes in GenBank database, which is used as negative control siNC.

[0109] Synthesis method: siSPP1-1, siSPP1-2, siSPP1-3 and negative control siNC used in the present application are prepared by chemical synthesis. The above nucleic acids are provided by a biotechnology enterprise with corresponding qualifications.

[0110] Table 5: Guide strand and passenger strand of siRNA and nucleotide sequence information

[0111]

[0112] Example 4 Verification of inhibition effect of siRNA targeting SPP1 gene

[0113] Experimental method:

[0114] 1.1 Cell transfection

[0115] 1.1.1 Cell preparation

[0116] Human dermal fibroblasts (NHDFs) were inoculated in a cell culture dish and cultured with DMEM complete medium until the cells were full. After the culture medium was discarded, it was washed with PBS three times, 0.25% (w / w) trypsin was added for digestion, and then complete medium was added to terminate digestion and centrifugal collection of cells. After the supernatant was discarded, it was resuspended in complete medium, and the concentration was adjusted to 4×10 51 mL / well into 6-well plates, and incubated at 37 °C in 5% CO2 to obtain the NHDFs cell plate to be transfected. The HaCaT cell plate was prepared in the same way.

[0117] 1.1.2 Transfection complex preparation

[0118] Two 1.5 mL centrifuge tubes were labeled as tube A and tube B, respectively, and each was added with 150 μL of OPTI medium. 4 μL of Lipofectamine™ 3000 transfection reagent was added to tube A and mixed well; 2 μL of siRNA solution (siSPP1-1, siSPP1-2, siSPP1-3 or siNC listed in Example 3, with sterile enzyme-free water as solvent) with a stock concentration of 20 μM was added to tube B, and after mixing well, the solution in tube B was transferred to tube A, mixed gently, and incubated at room temperature for 15 min to prepare the corresponding transfection complex.

[0119] 1.1.3 Cell transfection and sample preparation

[0120] The culture medium in the cell plate to be transfected obtained in step 1.1.1 was discarded, and the cells were washed twice with PBS and replaced with 2 mL of fresh DMEM complete medium, followed by the addition of the transfection complex obtained in step 1.1.2, and incubated at 37 °C in 5% CO2 for 24 h. After incubation, the culture medium was discarded to obtain the corresponding cell sample.

[0121] When the transfection complex was siSPP1-1, siSPP1-1-NHDFs cell sample or siSPP1-1-HaCaT cell sample was obtained;

[0122] When the transfection complex was siSPP1-2, siSPP1-2-NHDFs cell sample or siSPP1-2-HaCaT cell sample was obtained;

[0123] When the transfection complex was siSPP1-3, siSPP1-3-NHDFs cell sample or siSPP1-3-HaCaT cell sample was obtained;

[0124] When the transfection complex was siNC, siNC-NHDFs cell sample or siNC-HaCaT cell sample was obtained.

[0125] 1.2 Fluorescent quantitative PCR

[0126] 1 mL Trizol was added to the siSPP1-1-NHDFs cell sample, siSPP1-2-NHDFs cell sample, siSPP1-3-NHDFs cell sample, siNC-NHDFs cell sample, siSPP1-1-HaCaT cell sample, siSPP1-2-HaCaT cell sample, siSPP1-3-HaCaT cell sample and siNC-HaCaT cell sample collected in step 1.1.3, respectively, and the cells were lysed thoroughly.

[0127] After the cells were lysed thoroughly, the RNA in the siSPP1-1-NHDFs cell sample, siSPP1-2-NHDFs cell sample, siSPP1-3-NHDFs cell sample, siNC-NHDFs cell sample, siSPP1-1-HaCaT cell sample, siSPP1-2-HaCaT cell sample, siSPP1-3-HaCaT cell sample and siNC-HaCaT cell sample was extracted by acid guanidine thiocyanate-phenol-chloroform extraction method, respectively.

[0128] The RNA of the siSPP1-1-NHDFs cell sample, siSPP1-2-NHDFs cell sample, siSPP1-3-NHDFs cell sample, siNC-NHDFs cell sample, siSPP1-1-HaCaT cell sample, siSPP1-2-HaCaT cell sample, siSPP1-3-HaCaT cell sample and siNC-HaCaT cell sample was used as a template, and the reverse transcription kit (Nanjing Novozyme, R312-01) was used to perform the operation according to the method in Example 2, to obtain the cDNA of the siSPP1-1-NHDFs cell sample, siSPP1-2-NHDFs cell sample, siSPP1-3-NHDFs cell sample, siNC-NHDFs cell sample, siSPP1-1-HaCaT cell sample, siSPP1-2-HaCaT cell sample, siSPP1-3-HaCaT cell sample and siNC-HaCaT cell, respectively.

[0129] The cDNA of siSPP1-1-NHDFs cell sample, siSPP1-2-NHDFs cell sample, siSPP1-3-NHDFs cell sample, siNC-NHDFs cell sample, siSPP1-1-HaCaT cell sample, siSPP1-2-HaCaT cell sample, siSPP1-3-HaCaT cell sample and siNC-HaCaT cell were used as templates, and real-time fluorescent quantitative detection was performed using PerfectStart Green qPCR SuperMix fluorescent quantitative kit (Quanta, AQ601-01-V2) according to the kit instructions, and the corresponding Ct values were obtained, and the transcription level (i.e. mRNA level) of SPP1 gene in each group of cells was calculated according to 2 - Δ ΔCt The transcription level (i.e. mRNA level) of SPP1 gene in each group of cells was calculated according to 2

[0130] During the real-time fluorescent quantitative detection process, the forward primer and reverse primer of SPP1 gene, and the forward primer and reverse primer of the internal reference gene β-actin were as shown in Example 2.

[0131] Experimental results:

[0132] The results of fluorescent quantitative PCR detection are shown in Figure 3 The results showed that in human dermal fibroblasts (NHDFs) and human epidermal keratinocytes (HaCaT), compared with the negative control group (siNC transfected cells), the mRNA levels of SPP1 gene in cells transfected with siSPP1-1, siSPP1-2 and siSPP1-3 were significantly down-regulated. This indicates that the three siRNAs designed in Example 3 can effectively target and cut the mRNA of SPP1 gene, thereby inhibiting its expression level. Among them, the knockdown efficiency of siSPP1-1 is the highest.

[0133] Example 5: Function verification of siRNA targeting SPP1 gene

[0134] Experimental method

[0135] 1.1 Cell experiment

[0136] To verify the function of siRNA targeting SPP1 gene, human dermal fibroblasts (NHDFs) were selected as experimental models in this embodiment, and cell photoaging was induced by UVB irradiation. According to the results of Example 4, siSPP1-1 with the highest knockdown efficiency was selected for function verification, and ursolic acid, which has been reported in the literature to have anti-photoaging effect and can down-regulate SPP1 expression, was selected as a control. The experimental grouping is shown in Table 6 below. The cell photoaging modeling method was performed according to the method described in Example 2, and the cell transfection method was performed according to the method described in Example 4.

[0137] Table 6: Experimental grouping

[0138]

[0139] 1.2 Real-time fluorescent quantitative PCR

[0140] RNA extraction, reverse transcription to synthesize cDNA and real-time fluorescent quantitative PCR were performed according to the method described in Example 2. During the real-time fluorescent quantitative PCR detection process, the forward primer and reverse primer of the SPP1 gene, the forward primer and reverse primer of the reference gene β-actin, the forward primer of the inflammatory factor IL-6 gene as shown in SEQ ID NO: 13, the reverse primer of the IL-6 gene as shown in SEQ ID NO: 14, the forward primer of the CXCL1 gene as shown in SEQ ID NO: 15, the reverse primer of the CXCL1 gene as shown in SEQ ID NO: 16, the forward primer of the MCP-1 gene as shown in SEQ ID NO: 17, the reverse primer of the MCP-1 gene as shown in SEQ ID NO: 18, the forward primer of the MMP-1 gene as shown in SEQ ID NO: 19, the reverse primer of the MMP-1 gene as shown in SEQ ID NO: 20, the forward primer of the COL1A1 gene as shown in SEQ ID NO: 21, the reverse primer of the COL1A1 gene as shown in SEQ ID NO: 22, the forward primer of the COL3A1 gene as shown in SEQ ID NO: 23, and the reverse primer of the COL3A1 gene as shown in SEQ ID NO: 24 were used.

[0141] Table 7: Primer sequence information

[0142]

[0143] 1.3 ELISA detection

[0144] After the cells were treated according to the experimental grouping and method described in step 1 for 24 h, the culture supernatant was collected and centrifuged to remove cell debris. Then, the human IL-6 and human pro-collagen I alpha 1 (PIP) specific ELISA kit was used, and the sample was added, incubated, washed, and then the detection antibody was added, followed by enzyme labeling reaction, color development and termination reaction according to the requirements of the instructions. Finally, the absorbance value was measured at 450 nm wavelength, and the concentration of inflammatory factors IL-6 and PIP in the sample was calculated according to the standard curve.

[0145] 1.4 SA-β-galactosidase (SA-β-Gal) detection

[0146] After treating cells for 48 h according to the experimental grouping and methods described in step 1, staining was performed according to the β-galactosidase staining kit instructions, and SA-β-Gal positive cells were quantitatively analyzed using Image Pro Plus software. Human epidermal keratinocytes (HaCaT group) were added to this step, with UVB irradiation at 30 mJ / cm². 2 The positive cell rates for each group are shown in Table 8.

[0147] Experimental results

[0148] 2.1 Results of Real-Time PCR Detection

[0149] The results of quantitative real-time PCR are as follows Figure 4 As shown.

[0150] The results showed that, compared with the untreated negative control group, SPP1 was significantly upregulated in the UVB-treated negative control group. Transfection with siSPP1-1 effectively inhibited the upregulation of SPP1, and ursolic acid (UA) also decreased, but not as significantly as siSPP1-1. UVB simultaneously induced significant increases in IL-6 (interleukin-6), CXCL1 (CXC chemokine ligand 1), MCP-1 (monocyte chemoattractant protein-1), and MMP1 (matrix metalloproteinase 1), while downregulating COL1A1 and COL3A1. Compared with the positive control group, the untreated negative control group, and the irradiated negative control group, siSPP1-1 significantly reduced the expression of the aforementioned inflammatory and matrix degradation factors and increased the expression of collagen-related genes, and was superior to ursolic acid (UA).

[0151] The above results indicate that downregulating SPP1 specifically with siRNA can effectively alleviate UVB-induced cellular inflammation and collagen loss, thereby achieving an anti-photoaging effect. Among these, siSPP1-1 is preferred. Compared with other siRNAs, the siSPP1-1 provided by this invention has a better anti-photoaging effect and has unexpected technical benefits.

[0152] 2.2 ELISA test results

[0153] See results Figure 5 . Figure 5 ELISA results showed that UVB irradiation significantly induced the secretion of the inflammatory cytokine IL-6 by human dermal fibroblasts, while simultaneously decreasing the secretion level of type I collagen. Under UVB irradiation conditions, transfection with siSPP1-1 not only significantly reduced the secretion of inflammatory cytokines but also effectively prevented the loss of type I collagen. This indicates that specifically inhibiting the expression of the SPP1 gene can alleviate the inflammatory response at the protein level and prevent collagen degradation.

[0154] 2.3 SA-β-Gal detection results

[0155] The results are shown in Table 8.

[0156] Table 8: SA-β-Gal detection results

[0157]

[0158] The experimental results in Table 8 show that UVB irradiation can significantly increase the SA-β-Gal staining positive rate of human dermal fibroblasts, indicating that the cells are in a senescent state. Compared with the negative control group and the siNC transfection group, the SA-β-Gal positive rate in the siSPP1-1 transfection group is significantly reduced, and the reduction effect is better than that of the positive control group.

[0159] The above results show that by specifically inhibiting the expression of the SPP1 gene, the secretion of inflammatory factors at the protein level can be reduced, the senescent microenvironment of the extracellular matrix can be improved, and the effect of delaying cell senescence can be achieved.

[0160] Example 6: Human efficacy test of siRNA targeting SPP1 gene

[0161] Experimental method

[0162] 1.1 Preparation of siRNA or ursolic acid-containing water essence

[0163] 1.1.1 Formulation: see Table 9.

[0164] Table 9: Water essence component information table

[0165]

[0166] The ursolic acid treatment group replaces the siSPP1-1 aqueous solution in Table 9 with a 10wt% ursolic acid propylene glycol solution containing ursolic acid, and the rest of the formulation remains unchanged.

[0167] 1.1.2 Preparation method:

[0168] (1) First, heat the water to 85°C, then add p-hydroxyacetophenone and 1,3-butanediol accounting for three-fifths of the total amount of the formula, and stir until the material is completely dissolved; then cool to below 60°C (for example, 50°C), and A phase is obtained;

[0169] (2) Take the remaining amount of 1,3-butanediol in the formula, mix it uniformly with the transparent xanthan gum in advance, and then add it to the A phase with a temperature of no higher than 60°C (such as 50°C) while stirring; continue stirring until the system is fully swollen, there are no fisheye particles, and the whole is uniform, and then continue to cool to below 40°C (such as 35°C) to obtain the B phase;

[0170] (3) Add siSPP1-1 synthesized in Example 3 (or siNC, or ursolic acid) and 1,2-pentanediol to the B phase with a temperature maintained below 40°C (such as 35°C), and after fully stirring to mix uniformly, add water to make the total content of all ingredients reach 100wt%.

[0171] 1.2 Cytotoxicity test

[0172] The human epidermal keratinocytes HaCaT and human dermal fibroblasts NHDFs were used to evaluate the toxic effects of the formula on skin cells. The cells in a stable growth state were counted after digestion and inoculated in a 96-well plate at about 10,000 cells per well. After forming a monolayer for 24 h, the culture medium containing different concentrations of the test substance was added for continuous culture for 48 h. Subsequently, the cells were treated with a CCK-8 kit, and the absorbance (OD value) was measured at a wavelength of 450 nm using an enzyme marker. At the same time, HaCaT or NHDFs cultured for 48 h under the same conditions without the addition of the test substance were used as negative controls. The relative activity of the cells was calculated according to the following formula:

[0173] Cell relative activity (%) = [(sample group OD value - background OD value) / (negative control OD value - background OD value)] x 100%.

[0174] The results are shown in Table 10.

[0175] Table 10 Cell relative activity

[0176]

[0177] Conclusion: The siSPP1-1 provided by the present application has good safety.

[0178] 1.3 Efficacy test

[0179] 1.3.1 Inclusion criteria for subjects

[0180] 18-60 years old, healthy women or men;

[0181] Facial skin has problems such as redness, sensitivity, wrinkles, etc.

[0182] Sensitive skin population (by sensitive skin questionnaire and lactic acid stinging score ≥3 points);

[0183] No other clinical study in the past two months, no skin treatment, cosmetic treatment on the test site that may affect the test results;

[0184] Understand the trial process, voluntarily participate in the trial and sign a written informed consent form.

[0185] 1.3.2 Exclusion criteria for subjects

[0186] Pregnant or lactating women or those with recent plans to conceive;

[0187] History of skin diseases such as psoriasis, eczema, atopic dermatitis, severe acne, etc.; or with other chronic systemic diseases;

[0188] Oral or external use of corticosteroids and other anti-inflammatory drugs within the past 1 month;

[0189] Highly sensitive individuals;

[0190] Use of tretinoin preparations or chemical exfoliation, laser, intense pulsed light and other medical aesthetic treatments on the test site within the past 3 months;

[0191] Unavoidable long-term sun exposure;

[0192] Participated in other clinical trials within the past 2 months;

[0193] Other clinical assessments deemed unsuitable for the trial.

[0194] 1.3.3 Test instruments

[0195] Facial image capture system VISIA7 (Canfield, USA)

[0196] Skin hemoglobin test probe Mexameter MX18 (Courage+Khazaka, Germany)

[0197] 1.3.4 Test environment

[0198] Test environment: temperature 21±1℃; humidity 50±10%.

[0199] 1.3.5 Test method

[0200] Sample usage and frequency: After cleansing in the morning and evening, take an appropriate amount of product on the palm, evenly apply it to the face, and gently massage until absorbed. Test items are shown in Table 11.

[0201] Table 11: Human efficacy test items

[0202]

[0203] 1.3.6 Test procedure

[0204] (1) According to the requirements, the subjects are recruited into the group, and sign the written informed consent form. Before enrollment, the subjects are asked a series of questions about disease history, health status, etc. according to the inclusion and exclusion criteria, and the subjects who meet the criteria are selected to participate in this test project.

[0205] (2) The subjects enrolled use facial cleanser to clean the face, and then use clean water to rinse and dry the face with non-dust absorbent paper towel. After cleaning the face, enter the constant temperature and humidity room, wait for 30 min, and during the stable period, the subjects are prohibited from eating and drinking, the forehead is exposed, and the subjects are kept relaxed and avoid touching the affected area.

[0206] (3) After the rest, the skin physiological parameter values are tested by completing the skin test process.

[0207] (4) The sample is used for 7 days and 28 days after the visit, and the self-evaluation is completed according to the self condition, and the questionnaire related to the sample is filled in.

[0208] 1.3.7 Data analysis

[0209] Statistical analysis software is used for statistical analysis of data. The measurement data is expressed as: mean ± standard deviation, and normal distribution test is performed. If the normal distribution requirement is met, the paired t test is used for comparison before and after itself, otherwise the two related sample rank sum test is used. The above statistical analysis is a two-tailed test, and the significance level is a=0.05.

[0210] 1.3.8 Test conclusion determination basis

[0211] Claimed anti-wrinkle effect: using self before and after comparison, observing the average area of wrinkles, if at any visit time point after using the sample, any index test value is better than the baseline value before use, and the result has significant difference (P<0.05), it is considered that the test sample has anti-wrinkle effect.

[0212] Claimed repair effect: using self before and after comparison, observing the skin hemoglobin, if at any visit time point after using the sample, the test value is better than the baseline value before use, and the result has significant difference (P<0.05), it is considered that the test sample has repair effect.

[0213] Experimental results

[0214] The results are shown in Tables 12 and 13.

[0215] Table 12: Descriptive statistical results of average area of wrinkles test value (unit mm 2 )

[0216]

[0217] Table 13: Descriptive statistics of skin hematin test values

[0218]

[0219] Conclusion: From the results of Table 12 and Table 13, it can be seen that the cosmetic containing the siRNA targeting SPP1 gene provided by the present application shows significant effect in wrinkle repair, and the effect is better than that of traditional anti-aging active ingredient ursolic acid.

[0220] The method of the present application has been described by preferred embodiments, and the related personnel can obviously make changes or appropriate changes and combinations to the method and application described herein within the content, spirit and scope of the present application to realize and apply the present application technology. Those skilled in the art can refer to the content herein to appropriately improve the process parameters for implementation. It is particularly pointed out that all similar replacements and changes are obvious to those skilled in the art, and they are considered to be included in the present application.

Claims

1. A siRNA, characterized in that, comprise a guide strand and a passenger strand; the guide strand and the passenger strand are selected from at least one group of the following groups: (1) guide strand: SEQ ID NO: 1; passenger strand SEQ ID NO:

2. (2) guide strand: SEQ ID NO: 5; passenger strand SEQ ID NO:

6.

2. The siRNA according to claim 1, wherein one or more stabilizing modifications are further included in the guide strand and / or the passenger strand of the siRNA.

3. A composition characterized in that, comprise the siRNA according to any one of claims 1-2.

4. A DNA molecule, characterized in that, the DNA molecule encodes the siRNA according to any one of claims 1-2.

5. A recombinant expression vector, characterized in that, comprise the siRNA according to any one of claims 1-2 or the DNA molecule according to claim 4.

6. A recombinant cell, characterized in that, the recombinant cell expresses the siRNA according to any one of claims 1-2 or the DNA molecule according to claim 4.

7. The recombinant cell according to claim 6, which comprises the recombinant expression vector according to claim 5.

8. Use of the siRNA according to any one of claims 1-2, the composition according to claim 3, the DNA molecule according to claim 4, the recombinant expression vector according to claim 5, or the recombinant cell according to any one of claims 6-7 in the manufacture of a cosmetic product for repairing and / or anti-aging by silencing a target gene SPP1 encoding bone bridge protein.

9. A pharmaceutical or cosmetic product, characterized by comprise the siRNA according to any one of claims 1-2 or the composition according to claim 3.

Images