A vector, standardization method, product and application for quantitative characterization of plant promoter dual system
By designing a compact promoter characterization plasmid pLIP, combined with a dual-luciferase system and the RPU method, standardized comparisons of promoter activity in different plant expression systems were achieved. This solved the problems of data comparison difficulties and poor reproducibility in existing technologies, and improved detection accuracy and experimental reproducibility.
Patent Information
- Application Number
- CN202511237782.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-01
- Publication Date
- 2026-05-01
- Estimated Expiration
- 2045-09-01
AI Technical Summary
The lack of unified experimental tools and standardized analytical procedures in existing technologies makes it difficult to compare data from different plant promoter expression systems. The complex structure of vectors affects transformation efficiency, and the lack of a unified normalization method for luciferase quantitative systems leads to poor reproducibility of promoter research data and the inability to form a unified reference standard.
A compact promoter characterization plasmid (pLIP) was designed, containing firefly luciferase and Renilla luciferase reporter modules, combined with a dual luciferase system, to achieve cross-system promoter activity comparison via the RPU method, providing a standardized tool.
This technology enables standardized comparison of promoter activity across different plant expression systems, improving detection accuracy and reliability. It also solves the problems of incompatibility and poor data repeatability in cross-system detection in existing technologies, making it suitable for efficient screening and standardized characterization in plant synthetic biology.
Smart Images

Figure CN121065240B_ABST
Abstract
Description
A vector, standardized method, product, and application for quantitative characterization of plant promoter dual systems. Technical Field
[0001] This invention belongs to the field of plant synthetic biology and plant gene expression regulation, specifically relating to a vector, standardized method, product and application for quantitative characterization of plant promoter dual systems. Background Technology
[0002] In plant science research, elucidating gene expression regulation mechanisms is a core step in revealing the laws governing plant growth, development, and stress responses. Promoters, acting as the "switch" for gene expression, directly determine the transcriptional activity of downstream genes through their expression intensity and spatiotemporal specificity. Therefore, precise quantitative analysis of promoter function is of paramount importance. This analysis not only provides crucial evidence for the functional verification of genes but also lays the foundation for the design and optimization of artificial gene circuits in synthetic biology. For example, controlling promoter activity can lead to the controlled expression of target genes, thereby improving plant traits or increasing the yield of bioproducts.
[0003] Currently, quantitative studies on promoter expression intensity mainly rely on protoplast transient expression systems and Agrobacterium-mediated leaf transient expression systems. Protoplast transient expression systems, with their simple operation and short experimental cycle, can complete the detection of large numbers of samples in a short time, making them ideal for high-throughput promoter screening and preliminary functional analysis, especially playing an irreplaceable role in exploring molecular mechanisms such as the interaction between promoters and transcription factors. In contrast, Agrobacterium-mediated leaf transient expression systems, because they preserve the natural tissue environment and intercellular communication of plant cells, provide results that more closely resemble gene expression under whole-plant growth conditions. Therefore, they have unique value in verifying the actual expression activity of promoters in complex tissues and are often used for final functional confirmation experiments.
[0004] However, both systems have significant limitations in practical applications, severely restricting the depth and breadth of promoter research. First, the lack of unified experimental tools and standardized analytical procedures makes it difficult to directly compare promoter activity data obtained from different systems. For example, the vector frameworks commonly used in protoplast systems differ from those used in leaf transient expression systems in terms of component composition and transfection efficiency, making the detection results of the same promoter in the two systems often incomparable and greatly increasing the difficulty for researchers to integrate different experimental data. Second, vectors conventionally used for promoter research are usually structurally complex and have large molecular weights. This not only increases the assembly difficulty during vector construction and reduces construction efficiency but also affects transformation efficiency to some extent. Especially in systems such as protoplasts, which are more sensitive to transformation conditions, excessively large vector molecular weights may lead to a significant decrease in transformation success rate. Furthermore, the lack of a unified normalization method in currently widely used luciferase quantitative systems is also a prominent problem. Due to the influence of factors such as different experimental batches, different transformation efficiencies, and different cell states, the absolute expression level of luciferase fluctuates greatly. Existing normalization methods often vary from laboratory to laboratory, resulting in poor data reproducibility for the same promoter in different studies and the inability to form a unified reference standard. This greatly limits the standardized application of promoter elements and the communication and integration of different research results.
[0005] Therefore, developing a compact technical system that can be applied to a variety of plant expression systems and can achieve standardized characterization of promoter activity has become a key issue that urgently needs to be addressed in the field of plant gene expression regulation research. Summary of the Invention
[0006] To address the aforementioned shortcomings, this invention provides a quantitative promoter characterization technique suitable for tobacco systems, aiming to achieve standardized comparisons of promoter activity between protoplast systems and leaf transient expression systems. The innovation of this approach lies in the design and use of a compact, dual-system compatible promoter characterization plasmid (pLIP), combined with a dual-luciferase system, to achieve promoter activity comparisons between the two systems using a standardized process (RPU), providing a standardized tool for plant gene circuit design and synthetic element construction.
[0007] The technical solution of this invention is as follows:
[0008] On the one hand, the present invention provides a vector pLIP for quantitative characterization of plant promoter dual systems. The vector backbone is based on pUC19, retaining the prokaryotic origin of replication and resistance gene, inserting Agrobacterium-adapted origin of replication pSa ori and T-DNA left and right boundary sequences, designing Prefix and Suffix as assembly interfaces, and constructing an expression vector backbone of less than 3000 bp.
[0009] The T-DNA region contains two expression modules: a firefly luciferase reporter gene module driven by the test promoter and a Renilla luciferase internal control module driven by the 35S promoter.
[0010] Specifically, the sequence of the expression vector backbone is shown in SEQ ID NO.1.
[0011] Specifically, the sequence of the Prefix is shown in SEQ ID NO.2; the sequence of the Suffix is shown in SEQ ID NO.3.
[0012] In another aspect, the present invention provides a protoplast transfection expression system, including the aforementioned vector pLIP.
[0013] Specifically, the pLIP vector is introduced into protoplasts via a PEG-CaCl2-mediated transformation method.
[0014] Specifically, the protoplasts are prepared by tape peeling followed by enzymatic hydrolysis;
[0015] Specifically, the protoplasts can also be prepared using specially designed devices, such as a protoplast preparation pretreatment device.
[0016] The protoplast preparation pretreatment device achieves precise compression and adhesion of plant tissues through a specific mechanical structure, which can efficiently separate leaf epidermal tissue and mesophyll cells, providing a purer initial material for subsequent protoplast release. Its design fits the characteristics of plant tissue structure, which can improve tissue separation efficiency and reduce impurity interference while maintaining cell activity, thereby helping to improve the overall effect of protoplast preparation. It is a special auxiliary device optimized for specific materials, and can further optimize the preparation process when used in conjunction with conventional devices.
[0017] In some embodiments, a plant epidermal tearing device is used during protoplast preparation. This device comprises a pair of openable and closable clamping arms. The inner sides of the clamping arms are provided with soft, friction-resistant rubber pads. During operation, the clamping arms are closed manually or mechanically, allowing the rubber pads to gently grip the edge of the tobacco leaf epidermis. Then, a motor-driven linear guide rail smoothly pulls the clamping arms, thereby tearing the plant epidermis. This device allows for precise control of force and speed, preventing excessive pulling and damage to epidermal cells, and providing high-quality material for subsequent protoplast preparation.
[0018] In other embodiments, a plant epidermis tearing device based on the principle of negative pressure adsorption is used. The device is equipped with an adsorption plate with multiple tiny adsorption pores. When the adsorption plate approaches the plant epidermis, a vacuum pump is activated, creating negative pressure at the adsorption pores to tightly adsorb the plant epidermis. Simultaneously, the device's robotic arm moves along a preset trajectory, driving the adsorption plate to tear the plant epidermis from the leaf body. This device can adapt to plant epidermis of different thicknesses and toughnesses by adjusting the negative pressure, greatly improving the adaptability and stability of the operation, and helping to improve the efficiency and quality of the plant epidermis treatment step in the protoplast preparation process.
[0019] In another aspect, the present invention provides a plant-derived transient expression system, comprising the aforementioned vector pLIP and a host system; the host system includes, but is not limited to, at least one of: a plant leaf transient expression system, a plant root hair system, a suspension cell line, or a cell-free system.
[0020] Specifically, the host system is a transient expression system in plant leaves; the vector pLIP is transferred into the host system via Agrobacterium-mediated transformation.
[0021] In some embodiments, the Agrobacterium-mediated infection can also be used in conjunction with a plant negative pressure infiltration device, a leaf vacuum infiltration device, a plant spray infiltration device, etc. The purpose of the device is to optimize the contact efficiency between Agrobacterium and tobacco leaf tissue and enhance the infiltration effect.
[0022] The plant negative pressure infiltration device typically includes a sealed infiltration chamber, a negative pressure control system, an infiltration solution circulation assembly, and a plant fixing frame. During operation, the plant (or detached leaf) to be treated is fixed on the support within the chamber, ensuring full contact between the leaf and the infiltration solution. A negative pressure pump reduces the internal pressure of the chamber to a preset value (typically -0.05 to -0.08 MPa). Under this pressure difference, the stomata and intercellular spaces of the leaf passively expand, promoting more efficient entry of the infiltration solution into the tissue. Simultaneously, the circulation system ensures continuous flow of the infiltration solution, guaranteeing uniform contact between all parts of the leaf.
[0023] The leaf vacuum infiltration device constructs a sealed space, placing the plant material and the treatment liquid together in a vacuum environment, and uses the pressure difference to make the liquid quickly penetrate into the leaf tissue.
[0024] The plant spraying and dyeing device is equipped with a precision nozzle and an adjustable support, which can spray the dye solution evenly on the plant surface. Combined with the environmental control module (such as humidity and temperature regulation), it provides suitable cultivation conditions for the dyed plants.
[0025] Specifically, the Agrobacterium species include, but are not limited to, GV3101, LBA4404, EHA105, or C58; the plant leaves are selected from Nicotiana benthamiana, cultivated Nicotiana, or Arabidopsis thaliana.
[0026] Preferably, the Agrobacterium is GV3101; the plant is Nicotiana benthamiana.
[0027] In another aspect, the present invention provides a method for comparing plant promoters across systems. The method detects the fLUC / rLUC of the promoter to be tested using the aforementioned pLIP vector or protoplast transfection expression system or plant-derived transient expression system, and calculates the relative activity of the promoter to be tested using the fLUC / rLUC ratio of the 35S promoter as a benchmark of 1.0 RPU, thereby achieving cross-system comparison.
[0028] The relative activity is expressed by the formula: Relative activity = (fLUC) 待测 / rLUC 待测 ) / (fLUC 35S / rLUC 35S (Calculated)
[0029] Specifically, in the protoplast transfection expression system, cells were lysed 12-16 hours after transfection, and the expression levels of fLUC and rLUC were measured.
[0030] Preferably, in the protoplast transfection expression system, cells are lysed 12-13 hours after transfection, and the expression levels of fLUC and rLUC are measured.
[0031] Preferably, in the protoplast transfection expression system, cells are lysed 12 hours after transfection, and the expression levels of fLUC and rLUC are measured.
[0032] Specifically, in the transient expression system of plant leaves, leaf tissues were collected 24-72 hours after infection to determine the expression levels of fLUC and rLUC.
[0033] Preferably, in the transient expression system of plant leaves, leaf tissues are collected 72 hours after infection to determine the expression levels of fLUC and rLUC.
[0034] Preferably, in the transient expression system of plant leaves, leaf tissues are collected 48 hours after infection to determine the expression levels of fLUC and rLUC.
[0035] In another aspect, the present invention provides a kit comprising the aforementioned pLIP vector or protoplast transfection expression system or plant-derived transient expression system.
[0036] In another aspect, the present invention provides a method for promoter activity normalization and standardization, comprising the following steps:
[0037] (1) The relative activity of the 35S promoter was set to 1.0 RPU as the reference standard;
[0038] (2) For the promoter to be tested, its fLUC / rLUC is detected by the aforementioned pLIP vector or protoplast transfection expression system or plant-derived transient expression system. The ratio is normalized to the relative activity relative to the 35S promoter, so as to achieve standardization and comparison of promoter activity data.
[0039] Specifically, the promoters to be tested include, but are not limited to: plant-derived UBQ10 or ATC2, Agrobacterium-derived NOS, OCS or MAS, virus-derived 35S, MMV (Mirabalis Mosaic Virus) or CsVMV (Cassava Vein Mosaic Virus).
[0040] In another aspect, the present invention provides the application of the aforementioned pLIP vector or protoplast transfection expression system or plant-derived transient expression system or comparative method or kit or method in quantitative characterization or standardized comparison of plant promoters.
[0041] In another aspect, the present invention provides a startup sub-function evaluation platform, the core of which includes any of the following key components:
[0042] (1) The aforementioned pLIP vector;
[0043] (2) The aforementioned protoplast transfection expression system;
[0044] (3) The aforementioned plant-derived transient expression system.
[0045] The beneficial effects of this invention are as follows:
[0046] (1) This invention achieves efficient quantitative characterization of plant promoters by combining the protoplast transient expression system with the Agrobacterium-mediated leaf transient expression system, overcoming the shortcomings of traditional methods that are time-consuming, labor-intensive, and difficult to conduct large-scale screening.
[0047] (2) The present invention adopts a compact promoter characterization plasmid (pLIP) design, which contains a firefly luciferase (fLUC) module driven by the promoter to be tested and a kidney luciferase (rLUC) internal reference module driven by the 35S promoter, effectively eliminating background interference and improving the accuracy and reliability of detection.
[0048] (3) This invention uses the dual luciferase ratio calculation and introduces the RPU (Relative Promoter Unit) method, with the standard promoter (35S, 200 bp) as a reference, to realize the normalization and direct comparison of promoter activity in different systems, and solves the problem of lack of standardized methods in the prior art.
[0049] (4) The dual-system standardization method of the present invention has good cross-system compatibility and is suitable for efficient screening and standardized characterization of regulatory elements in plant synthetic biology, thereby improving the reproducibility of experimental results.
[0050] (5) The plasmid tool pLIP of the present invention is compact in design, easy to operate, easy to convert and use, overcomes the incompatibility between the protoplast transient expression system and the existing plasmids of Agrobacterium-mediated leaf transient expression system, and improves the speed and convenience of detection. Attached Figure Description
[0051] Figure 1 shows the compact promoter test vector pLIP, suitable for dual-platform expression in plants.
[0052] Figure 2 shows the preparation process and comparison of preparation effects of tobacco protoplasts.
[0053] Figure 3 is a schematic diagram of the mixed sampling method for tobacco leaves.
[0054] Figure 4 shows the correlation analysis of promoter activity and RPU normalized effect diagram of the transient expression system of protoplasts and leaves; where a is the relative fluorescence activity value of the transient expression system of protoplasts and leaves; b is the linear regression analysis of RPU normalization.
[0055] Figure 5 shows the correlation analysis of promoter activity in the protoplast (a) and tobacco leaf system (b) and the RPU normalized effect diagram (c); where orange: UBQ10, purple: 35S, red: ACT2, and blue: NOS.
[0056] Figure 6 is a schematic diagram of the tobacco protoplast transfection efficiency of pLIP plasmid. Detailed Implementation
[0057] The present invention will be further clearly and completely illustrated below through embodiments. These embodiments are only some examples of the present invention and are not intended to limit the present invention, but are only for illustrating the present invention. Unless otherwise specified, the experimental methods used in the following embodiments are all conventional experiments, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.
[0058] Example 1
[0059] 1.1 Construction of pLIP vector
[0060] Based on pUC19, after deleting unnecessary sequences, the replication origin pUC19 ori and the resistance gene region Kan were retained. The Agrobacterium replication origin pSa ori and the left and right boundary sequences (LB and RB sequences) of the T-DNA were inserted to synthesize a compact vector of 2813 bp (SEQ ID NO. 1). Assembly sites (Prefix, SEQ ID NO. 2: ggtgaagactaTGCC) and (SEQ ID NO. 3: AGGGCCCATTTCTGGATATA) were set in the T-DNA region for modular insertion of a dual reporter system (Figure 1): a firefly luciferase (fLUC) module driven by the test promoter and a Renilla luciferase (rLUC) module driven by 35S, assembled using the Gibson method. In this example, the test promoters selected were 35S, UBQ10, ATC2, and NOS.
[0061] SEQ ID NO. 1:
[0062]
[0063] Promoter 35S sequence (SEQ ID NO.4):
[0064] AGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGA。
[0065] Promoter UBQ10 sequence (SEQ ID NO.5):
[0066] GTCGACGAGTCAGTAATAAACGGCGTCAAAGTGGTTGCAGCCGGCACACACGAGTCGTGTTTATCAACTCAAAGCACAAATACTTTTCCTCAACCTAAAAATAAGGCAATTAGCCAAAAACAACTTTGCGTGTAAACAACGCTCAATACACGTGTCATTTTATTATTAGCTATTGCTTCACCGCCTTAGCTTTCTCGTGACCTAGTCGTCCTCGTCTTTTCTTCTTCTTCTTCTATAAAACAATACCCAAAGAGCTCTTCTTCTTCACAATTCAGATTTCAATTTCTCAAAATCTTAAAAACTTTCTCTCAATTCTCTCTACCGTGATCAAGGTAAATTTCTGTGTTCCTTATTCTCTCAAAATCTTCGATTTTGTTTTCGTTCGATCCCAATTTCGTATATGTTCTTTGGTTTAGATTCTGTTAATCTTAGATCGAAGACGATTTTCTGGGTTTGATCGTTAGATATCATCTTAATTCTCGATTAGGGTTTCATAGATATCATCCGATTTGTTCAAATAATTTGAGTTTTGTCGAATAATTACTCTTCGATTTGTGATTTCTATCTAGATCTGGTGTTAGTTTCTAGTTTGTGCGATCGAATTTGTCGATTAATCTGAGTTTTTCTGATTAACAG。
[0067] Promoter ACT2 sequence (SEQ ID NO.6):
[0068] TCGACAAAATTTAGAACGAACTTAATTATGATCTCAAATACATTGATACATATCTCATCTAGATCTAGGTTATCATTATGTAAGAAAGTTTTGACGAATATGGCACGACAAAATGGCTAGACTCGATGTAATTGGTATCTCAACTCAACATTATACTTATACCAAACATTAGTTAGACAAAATTTAAACAACTATTTTTTATGTATGCAAGAGTCAGCATATGTATAATTGATTCAGAATCGTTTTGACGAGTTCGGATGTAGTAGTAGCCATTATTTAATGTACATACTAATCGTGAATAGTGAATATGATGAAACATTGTATCTTATTGTATAAATATCCATAAACACATCATGAAAGACACTTTCTTTCACGGTCTGAATTAATTATGATACAATTCTAATAGAAAACGAATTAAATTACGTTGAATTGTATGAAATCTAATTGAACAAGCCAACCACGACGACGACTAACGTTGCCTGGATTGACTCGGTTTAAGTTAACCACTAAAAAAACGGAGCTGTCATGTAACACGCGGATCGAGCAGGTCACAGTCATGAAGCCATCAAAGCAAAAGAACTAATCCAAGGGCTGAGATGATTAATTAGTTTAAAAATTAGTTAACACGAGGGAAAAGGCTGTCTGACAGCCAGGTCACGTTATCTTTACCTGTGGTCGAAATGATTCGTGTCTGTCGATTTTAATTATTTTTTTGAAAGGCCGAAAATAAAGTTGTAAGAGATAAACCCGCCTATATAAATTCATATATTTTCCTCTCCGCTTTGAA。
[0069] Promoter NOS sequence (SEQ ID NO.7):
[0070] GAACCGCAACGATTGAAGGAGCCACTCAGCCGCGGGTTTCTGGAGTTTAATGAGCTAAGCACATACGTCAGAAACCATTATTGCGCGTTCAAAAGTCGCCTAAGGTCACTATCAGCTAGAAATATTTCTTGTCAAAAATGCTCCACTGACGTTCCATAAATTCCTCGGTATCCAATTA.
[0071] 1.2 Comparison of Protoplast Preparation Methods
[0072] (1) Protoplasts prepared by tape-sandwich method
[0073] Leafy tobacco leaves at the 4-6 leaf stage were selected, sterilely washed with water, the midrib was removed, and the lower epidermis was peeled off with tape. The exposed tissue was placed face down and floated in an enzymatic hydrolysis solution containing 1% (m / v) cellulase R10 (Yakult L0012) and 0.3% (m / v) cleavage enzyme (Yakult L0021). The solution was shaken at 50 rpm for 2.5 h for enzymatic hydrolysis. The reaction was terminated with W5 buffer (154 mM NaCl, 125 mM CaCl2, 5 mM KCl, 2 mM MES (pH 5.7)). Protoplasts were obtained by filtration and centrifugation, and the concentration was adjusted to 1-2 × 10⁻⁶. 6 per mL.
[0074] (2) Protoplasts prepared by the leaf strip method
[0075] Leafy tobacco leaves at the 4-6 leaf stage were selected, sterilely washed with water, and the main veins were removed. The leaves were then cut into fine filaments of approximately 0.5-1 mm using a double-edged blade. These filaments were suspended in an enzymatic hydrolysis solution containing 1% (m / v) cellulase R10 and 0.3% (m / v) cleavage enzyme, and hydrolyzed at 50 rpm for 3.5 h. The reaction was terminated with W5 buffer, and the protoplasts were obtained by filtration and centrifugation, with the concentration adjusted to 1-2 × 10⁻⁶. 6 per mL.
[0076] By comparing the purity of protoplasts prepared by the two methods, it can be found that the protoplasts prepared by the tape peeling method have more complete round protoplast cells and fewer broken impurities (Figure 2).
[0077] 1.3 Protoplast Transfection
[0078] Prepare a PEG-CaCl2 solution containing 40% (m / v) PEG4000 (Sigma 95904), 0.2 M mannitol (Sigma, M1902), and 100 mM CaCl2 (Sigma, V900266), fresh for each use. Prepare a WI buffer solution containing 0.5 M mannitol, 20 mM KCl, and 4 mM MMES (pH 5.7), for later use.
[0079] Take 5 μL of pLIP test vector at a concentration of 1500 ng / μL and add 50 μL of protoplasts prepared by the tape peeling method to the bottom of each 2 mL round-bottom centrifuge tube. After gently mixing, add 55 μL of PEG-CaCl2 transformation solution (plasmid:protoplast:transformation solution = 1:10:11) and gently tap the bottom of the tube to mix. Incubate at room temperature for 10 min. After the reaction is complete, slowly add 220 μL of W5 solution to each tube, mix well, and centrifuge at 100 × g for 5 min using a refrigerated centrifuge with a horizontal rotor. Discard the supernatant containing the transformation solution, resuspend in 120 μL of WI solution, place in a 48-well plate, and incubate for 12 h to express the exogenous gene.
[0080] 1.4 Transient expression in tobacco leaves
[0081] pLIP plasmids were transformed into GV3101 (pSoup-p19) strain. After resistance selection, the plasmids were amplified and resuspended in injection buffer containing 10 mM MES, 10 mM MgCl2, and 100 μM acetylsyringone. The buffer was adjusted to OD600=1.0 and incubated at room temperature for 2 h before being injected into the abaxial surface of leaves from three independent tobacco plants of appropriate age. Samples were collected 48 h later using a pooled sampling method for luciferase detection (Figure 3).
[0082] Mixed sampling method. Three holes are punched in each injection area (e.g., A1) using a handheld puncher to obtain leaf discs. The individual leaf discs from the three independent plants are then mixed into one tube to obtain a mixed sample (e.g., AM1).
[0083] 1.5 Dual-luciferase assay and standardized analysis
[0084] Protoplasts and leaf tissues were lysed separately, and the expression intensities of fLUC and rLUC in the lysates were measured. The fLUC / rLUC ratio was calculated as promoter activity. Using the 35S promoter as a 1.0 RPU, the activity of other promoters was determined according to their relative values, thus obtaining relative activity. Relative activity = (fLUC / rLUC) / (fLUC / rLUC) * (r ... / rLUC) * (rLUC / rLUC / rLUC 待测 / rLUC 待测 ) / (fLUC 35S / rLUC 35S ).
[0085] 1.6 Experimental Data Processing and Visualization
[0086] Using 35S and NOS promoters as test promoters, the original fluorescence activity values of each promoter in the protoplast system (sampled at 12 h, x-axis) and the leaf system (sampled at 48 h and 72 h respectively, y-axis) showed significant deviations. Nine experimental replicates are shown as data points in the figure: the regression slope at 48 h was only 0.52, further decreasing to 0.32 at 72 h (Figure 4a). However, using a standardized calculation method, comparing the RPU results of the two systems: after RPU correction, the regression slope of both systems increased to 1.17 at 48 h (R²=0.96) and reached 1.10 at 72 h (R²=0.93) (Figure 4b), indicating that standardization effectively eliminated the incomparability of absolute signal intensity between platforms. Furthermore, RPU significantly reduced the impact of time point differences on data correlation (the slope difference between 48 h and 72 h decreased from 0.20 to 0.07), suggesting that this method can improve the reproducibility of experiments across time points. The above results indicate that RPU standardization can not only correct technical deviations between protoplast and leaf systems, but also reduce the interference of transient expression dynamics fluctuations on data stability, providing a universal framework for multi-platform collaborative promoter function research.
[0087] Furthermore, UBQ10 and ATC2 were added as test promoters to construct a pLIP plasmid. This plasmid was then transfected into protoplasts prepared by tape stripping, with three replicates performed. The RPU value was calculated using the method described above (Figure 5a). Similarly, the pLIP plasmid containing the UBQ10 and ATC2 test promoters was injected into tobacco leaves using the same method. After 48 hours of mixed sampling from multiple plants, the RPU value was calculated. Nine replicates are shown as data points in the figure (Figure 5b). Comparing the RPU values of the protoplast system and the leaf system and performing correlation regression analysis, the regression slopes of the protoplast and leaf systems were close to 1.0 (slope=1.001, R²=0.8958), indicating a high degree of comparability of cross-platform activity values (Figure 5c).
[0088] This embodiment provides a complete workflow from plasmid construction, protoplast and leaf transfection to signal detection and normalization analysis, ensuring that the expression performance of the promoter in the two plant expression systems can be directly compared, which has important tool value and application prospects.
[0089] Example 2 compares the transfection efficiency of commonly used high-expression plasmid pEAQ and pLIP vector in tobacco leaves.
[0090] Transfection efficiency was compared using different vector construction methods. A GFP reporter module driven by the 35S promoter was inserted into the LB / RB boundary region of the pLIP vector to construct the pLIP-35S_GFP reporter plasmid. GFP was inserted into the multiple cloning restriction site of the pEAQ-HT (BioVector NTCC plasmid vector strain cell gene deposit center) vector to construct the pEAQ-35S_GFP plasmid.
[0091] Protoplast transfection method. Take 5 μL each of plasmid pEAQ-35S_GFP and pLIP-35S_GFP vector (1500 ng / μL) and add 50 μL of protoplasts prepared by tape peeling to the bottom of each 2 mL round-bottom centrifuge tube. Gently mix, then add 55 μL of PEG-CaCl2 transformation buffer (plasmid:protoplast:transformation buffer = 1:10:11), and gently tap the bottom of the tube to mix. Incubate at room temperature for 10 min. After the reaction is complete, slowly add 220 μL of W5 solution to each tube, mix well, and centrifuge at 100 × g for 5 min using a refrigerated centrifuge with a horizontal rotor. Discard the supernatant containing the transformation buffer, resuspend in 120 μL of W5 solution, place in a 48-well plate, and incubate for 12 h to express the exogenous gene. By comparing the proportion of positive cells in the protoplast population driven by the same promoter (35S), it can be found that the transfection efficiency of the pLIP vector backbone reaches 50%, which is 5 times higher than that of the pEAQ vector backbone (~10%) (Figure 6).
[0092] The above detailed description is a specific illustration of one feasible embodiment of the present invention, and this embodiment is not intended to limit the patent scope of the present invention. It should be noted that all equivalent implementations or modifications made without departing from the present invention should be included within the scope of the technical solution of the present invention. Therefore, the protection scope of the present invention should be determined by the appended claims.
Claims
1. A pLIP vector for quantitative characterization of a dual-system plant promoter, characterized in that, The vector backbone is based on pUC19, retaining the prokaryotic origin of replication and resistance gene, and inserting Agrobacterium-adapted replication origin pSa ori and T-DNA left and right boundary sequences. Prefix and Suffix are designed as assembly interfaces. The sequence of the vector backbone is shown in SEQ ID NO.1; the sequence of the Prefix is shown in SEQ ID NO.2; the sequence of the Suffix is shown in SEQ ID NO.3; the T-DNA region contains two expression modules: a firefly luciferase reporter gene module driven by the test promoter and a Renilla luciferase internal control module driven by the 35S promoter; the sequence of the 35S promoter is shown in SEQ ID NO.
4.
2. A protoplast transfection expression system, characterized in that, Includes the pLIP carrier as described in claim 1.
3. The protoplast transfection expression system according to claim 2, characterized in that, The pLIP vector was introduced into protoplasts via a PEG-CaCl2-mediated transformation method.
4. The protoplast transfection expression system according to claim 3, characterized in that, The protoplasts were prepared by tape peeling and enzymatic hydrolysis.
5. A plant-derived transient expression system, characterized in that, The invention includes the pLIP vector of claim 1 and a host system; the host system includes at least one of a plant leaf transient expression system, a plant root hair system, a suspension cell line or a cell-free system.
6. The plant-derived transient expression system according to claim 5, characterized in that, The host system is a transient expression system for plant leaves; the vector pLIP is transferred into the host system via Agrobacterium-mediated transformation.
7. The plant-derived transient expression system according to claim 6, characterized in that, The Agrobacterium species are GV3101, LBA4404, EHA105, K599, or C58; the plant leaves are selected from Nicotiana benthamiana, cultivated Nicotiana, or Arabidopsis thaliana.
8. The plant-derived transient expression system according to claim 6, characterized in that, The Agrobacterium species is GV3101; the plant source is Nicotiana benthamiana.
9. A method for comparing plant promoters across systems, characterized in that, The fLUC / rLUC ratio of the promoter to be tested was detected using the pLIP vector of claim 1, the protoplast transfection expression system of any one of claims 2-4, or the plant-derived transient expression system of any one of claims 5-8. The relative activity of the promoter to be tested was calculated using a 35S promoter fLUC / rLUC ratio of 1.0 RPU as a baseline, thereby enabling cross-system comparisons. The relative activity was expressed by the formula: Relative activity = (fLUC / rLUC) / (r ... 待测 / rLUC 待测 ) / (fLUC 35S / rLUC 35S (Calculated) 10. The comparison method according to claim 9, characterized in that, In the protoplast transfection expression system, cells were lysed 12-16 hours after transfection, and the expression levels of fLUC and rLUC were measured.
11. The comparison method according to claim 9, characterized in that, In the transient expression system of plant leaves, leaf tissues were collected 24-72 hours after infection to determine the expression levels of fLUC and rLUC.
12. A reagent kit, characterized in that, It includes the vector pLIP of claim 1, the protoplast transfection expression system of any one of claims 2-4, or the plant-derived transient expression system of any one of claims 5-8.
13. A method for promoter activity normalization and standardization, characterized in that, The steps include: (1) setting the relative activity of the 35S promoter to 1.0 RPU as a reference standard; (2) detecting the fLUC / rLUC of the promoter to be tested using the vector pLIP described in claim 1, the protoplast transfection expression system described in any one of claims 2-4, or the plant-derived transient expression system described in any one of claims 5-8, and normalizing the fLUC / rLUC to the relative activity relative to the 35S promoter, thereby achieving the standardization and comparison of promoter activity data.
14. The method according to claim 13, characterized in that, The promoters to be tested are plant-derived UBQ10 or ATC2, Agrobacterium-derived NOS, OCS or MAS, viral-derived 35S, MMV or CsVMV.
15. The application of the pLIP vector of claim 1, the protoplast transfection expression system of any one of claims 2-4, the plant-derived transient expression system of any one of claims 5-8, the comparison method of any one of claims 9-11, the kit of claim 12, or the method of claim 13 or 14 in the quantitative characterization or standardized comparison of plant promoters.
16. A startup function evaluation platform, characterized in that, The core of the platform includes any of the following key components: (1) the vector pLIP as described in claim 1; (2) the protoplast transfection expression system as described in any one of claims 2-4; and (3) the plant-derived transient expression system as described in any one of claims 5-8.
Citation Information
Patent Citations
Abiotic-stress induction type ultrastrong promoter in rice and application thereof
CN103387986A
Plant over-expression luciferase reporter gene recombinant vector, and construction method and application thereof
CN112126658A
Method for creating plant insufficient in sexual gamete formation
JP2007289042A
Variegation in plants
US20110126311A1