Rapid analysis method for metal corrosive microorganism acidithiobacillus ferrooxidans

Abstract

The invention provides a rapid analysis method of metal corrosive microorganism acidithiobacillus ferrooxidans, and belongs to the technical field of biology.The rapid analysis method comprises the steps that a microorganism genome DNA sample to be detected and a photosensitizer As2MoO6 at-NiS are taken to jointly construct a triple asymmetric photon PCR system, asymmetric photon PCR amplification is carried out under the condition of LED light source excitation, and the amplification result is obtained; after amplification is completed, the obtained amplification product is mixed with a photo-thermal signal probe prepared from a photosensitizer As2MoO6 at NiS, and photo-thermal temperature change detection is carried out. The rapid analysis method has the characteristics of high efficiency, convenience and accuracy, and is suitable for rapid detection of acidithiobacillus ferrooxidans.

Description

Technical Field

[0001] This invention belongs to the field of testing and inspection technology, specifically relating to a rapid analytical method for *Thiobacillus acidophilus*, a metal-corrosive microorganism. Background Technology

[0002] *Acidithiobacillus ferrooxidans* (AF) is a chemoautotrophic bacterium that uses ferrous ions and low-valence sulfur as its energy source. *Acidithiobacillus ferrooxidans* can oxidize ferrous ions (Fe... 2+ ) is trivalent iron ion (Fe 3+ This oxidation process not only provides the energy needed for bacterial growth but also alters the chemical environment of the metal surface. Fe 3+ Alternating ions (AFs) possess strong oxidizing properties and can react with atoms on metal surfaces, leading to oxidation and corrosion. In industry, AFs can cause corrosion of facilities and equipment; therefore, AF detection is of great importance for industrial process control.

[0003] Currently, most probable number (MPN) dilution culture method, fluorescence sensor method, polymerase chain reaction (PCR), enzyme-linked immunosorbent assay (ELISA), and electrochemical biosensor method have all been used for the detection of adenosine fusarium (AF). These methods complement each other in practical applications, but each has its advantages and disadvantages. MPN is highly reliable, but its operation is cumbersome and time-consuming; detection methods based on characteristic metabolites are simple to operate and have a wide range of applications, but still suffer from long processing times; cell-based detection methods have short detection cycles, but their stability and specificity need further improvement. Detection methods based on genetic markers have high specificity and sensitivity, but their amplification speed needs further improvement. Currently, rapid on-site detection methods based on genetic markers are still lacking.

[0004] Asymmetric PCR is a method that uses unequal amounts of a pair of primers to generate a large amount of single-stranded DNA (ssDNA). Photon PCR is an innovative polymerase chain reaction (PCR) technology. Photon PCR utilizes the principle of photon-thermal conversion, generating heat at the photosensitizer interface through photon-electron-phonon coupling, thereby achieving rapid heating and cooling of the PCR reaction solution. This process significantly shortens the thermal cycling time of PCR, improving amplification efficiency and enabling faster, more efficient, and more sensitive nucleic acid amplification and detection. Photon PCR can complete the amplification process that traditional PCR requires tens of minutes or even hours in minutes; due to its fast amplification speed and high efficiency, photon PCR can detect extremely low concentrations of nucleic acid samples, improving detection sensitivity; photon PCR systems typically use low-power light sources (such as LEDs) as heat sources, reducing energy consumption and cost; furthermore, due to its small size and simple operation, photon PCR systems are very suitable for on-site testing or point-of-care diagnosis. Currently, there are no reports of combining asymmetric PCR and photon PCR technologies for SRB detection.

[0005] Lateral-flow immunochromatographic assay strips (LFIA) are widely used in the design of portable analytical sensors due to their advantages of rapid analysis, good selectivity, low cost, small sample volume requirements, ease of large-scale production, and stable long-term storage. Photothermal LFIA signals are generated by temperature changes caused by the photothermal effect, resulting in low background signal, high sensing sensitivity, and the ability to be performed on various substrates of different colors, demonstrating strong application potential. Currently, there is still a need for new nanomaterials with higher photothermal conversion efficiency as signal probes to further improve the performance of photothermal LFIA. Summary of the Invention

[0006] Existing analytical methods for the metal-corrosive microorganism *Acidithiobacillus acidophilus* have limitations, including the time-consuming and complex nature of traditional PCR methods, and insufficient sensitivity for low-abundance target bacteria. Furthermore, there is a lack of efficient, simultaneous amplification and detection techniques for specific genes of *Acidithiobacillus acidophilus*, such as the alaS, cyc2, and rus genes. In addition, existing detection methods are insufficient in terms of rapid quantification and field application. This invention provides a rapid analytical method for the metal-corrosive microorganism *Acidithiobacillus acidophilus*.

[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0008] A rapid analytical method for analyzing metal-corrosive microorganisms, *Thiobacillus acidophilus*, comprising the following specific steps:

[0009] Construction of a triple asymmetric photonic PCR system: The microbial genomic DNA sample to be tested, photosensitizer As2MoO6@NiS, primer pairs for the alaS gene, primer pairs for the cyc2 gene and primer pairs for the rus gene were used to construct a triple asymmetric photonic PCR system.

[0010] LED light source excited asymmetric photonic PCR: The triple asymmetric photonic PCR system was irradiated with an LED light source to perform asymmetric photonic PCR amplification and obtain the amplification product;

[0011] Photothermal detection: Three corresponding photothermal signal probes were prepared by modifying the photosensitizer with three nucleic acid strands that are partially complementary to the amplification products. The detection area of ​​the photothermal test strip is fixed with the complementary sequences of the three amplification products to be tested, and the quality control area of ​​the test strip is fixed with the sequence complementary to the signal probe. The amplification product is mixed with the running buffer and the photothermal signal probe, and then dropped onto the sample pad of the test strip. Photothermal temperature change detection is performed to obtain the photothermal temperature change signal that is positively correlated with the content of the amplification product.

[0012] Furthermore, the total volume of the triple asymmetric photon PCR system is 25 μL, including 1.0–2.0 μL each of primer pairs for the alaS gene, the cyc2 gene, and the rus gene, 1.0–3.0 μL of photosensitizer As2MoO6@NiS, 10 μL of PCR premix (Taq plus mix), 1.0–2.0 μL of the microbial genomic DNA sample to be tested, and ultrapure water;

[0013] The primer pairs for the alaS gene, cyc2 gene, and rus gene were in a volume ratio of 1:1 to the microbial genomic DNA sample to be tested.

[0014] The ratio between any upstream primer (F) and its corresponding downstream primer (R) in the three primer pairs is 1:0.1 to 1:10.

[0015] Furthermore, the genetic information of Acidithiobacillus ferrooxidans, including the alaS gene, cyc2 gene, and rus gene, is included in NCBI GenBank, Accession Number AJ006456.2 (accessed October 19, 2024).

[0016] The alaS gene sequence of *Acidithiobacillus acidophilus* is shown in SEQ ID NO: 1;

[0017] The primer pair for the alaS gene includes the upstream primer alaS-F: 5'-GTGCCTTTCCCGAACTCACG-3', and the downstream primer alaS-R: 5'-TCCTCCAGCAGACTGAGTCC-3';

[0018] The cyc2 gene sequence of *Acidithiobacillus acidophilus* is shown in SEQ ID NO: 2;

[0019] The primer pair for the cyc2 gene includes the upstream primer cyc2-F: 5'-TGTTGGTGTCTATGGGGCGG-3', and the downstream primer cyc2-R: 5'-CCCCAATCGTGCTGATAGGC-3';

[0020] The rus gene sequence of *Acidithiobacillus acidophilus* is shown in SEQ ID NO: 3;

[0021] The primer pair for the rus gene includes the upstream primer rus-F: 5'-GCACGCTGGATTCCACATGG-3' and the downstream primer rus-R: 5'-CTTCAAAGCTCGGGAACGG-3'.

[0022] Furthermore, the preparation process of the photosensitizer As2MoO6@NiS is as follows:

[0023] Nanoparticles of the photosensitizer As2MoO6 were synthesized using a hydrothermal method;

[0024] Add 1-2 mg of As2MoO6 nanoparticles to 5-10 mL of deionized water containing 10-20 mg of polyethylene glycol (MW5000-10000), sonicate for 20-30 min, stir overnight to obtain a mixture;

[0025] NiS was dissolved in nitric acid with a concentration of 0.3-0.5 mol / L, and the pH was adjusted to 6.5-7.0 to obtain an aqueous solution of NiS with a concentration of 1-10 mg / mL.

[0026] Add 1 mL of the mixture to 1 mL of NiS aqueous solution with a concentration of 1–10 mg / mL and stir overnight. The resulting solution can be used directly as the photosensitizer As2MoO6@NiS solution in a triple asymmetric photon PCR system. Alternatively, centrifuge to collect the dark gray powder, dry it, and obtain the solid photosensitizer As2MoO6@NiS for further surface modification reactions or storage.

[0027] Furthermore, the fabrication process of the three photothermal signal probes is as follows:

[0028] Take 10 μL of three partially complementary nucleic acid strands (TGCTGGAGGAAAAAAAAAAA, ACGATTGGGGAAAAAAAAAA, and AGCTTTGAAGAAAAAAAAAA) at a concentration of 0.1 M and mix them with 1 mL of 1 mg / mL photosensitizer As2MoO6@NiS. In 1×PBS buffer, protect from light and shake overnight at room temperature to obtain three corresponding photothermal signal probes: the photothermal signal probes of the alaS gene, cyc2 gene, and rus gene of *Acidithiobacillus acidophilus*.

[0029] Furthermore, the LED light source illumination utilizes an 808nm external coaxial reflective LED.

[0030] During irradiation, the excitation power is 4.5–6W, and the total excitation time is 10–30 min.

[0031] Furthermore, the reaction conditions for asymmetric photonic PCR amplification were as follows: the concentration of photosensitizer As2MoO6@NiS solution was 0.1-1.0 mg / mL; the pre-denaturation excitation power was 6 W for 1 min; 20-60 denaturation-annealing-extension cycles were performed: 6 W for 10 s; 4.5 W for 5 s; 5 W for 5 s; and extension for 5 W for 3 min.

[0032] Furthermore, quantitative analysis was performed on the three genes alaS, cyc2, and rus based on photothermal temperature change signals, as detailed below:

[0033] After asymmetric photon PCR amplification and photothermal detection of three samples with unknown target gene concentrations, the photothermal temperature change signals of the three genes were substituted into the equation of the quantitative curve to calculate the corresponding concentrations of the three genes, thus realizing the quantitative analysis of the target genes.

[0034] The quantitative curves for the genes in the three entries are as follows:

[0035] The quantitative curve for the alaS gene is: y = 5.50x + 0.78, R0 2 =0.9929;

[0036] The quantitative curve for the cyc2 gene is: y = 4.55x + 0.82, R0 2 =0.9935;

[0037] The quantitative curve for the rus gene is y = 4.36x + 0.34, R 2 =0.9897.

[0038] Furthermore, the microbial genomic DNA sample to be tested is prepared by collecting microorganisms from metal surfaces and extracting their genomic DNA.

[0039] Methods for collecting microorganisms from metal surfaces include, but are not limited to, direct scraping, cotton swab wiping, or brushing.

[0040] Methods for extracting genomic DNA include, but are not limited to, thermal lysis, kit-based methods, and SDS-based methods.

[0041] Furthermore, the detection area (T area) of the photothermal test strip is sequentially fixed with complementary sequences of three amplification products to be tested: GTGCCTTTCC, TTGTTGGTGTC, and GCACGCTGGA. The quality control area (C area) of the test strip body is fixed with a sequence complementary to the signal probe (C probe: TTTTTTTTTT).

[0042] The beneficial effects of the rapid analytical method for *Thiobacillus acidophilus*, a metal-corrosive microorganism, according to the present invention are as follows:

[0043] The rapid analysis method of this invention utilizes the photoactive properties of the photosensitizer As2MoO6@NiS to generate photoelectron and photothermal effects. This allows for rapid temperature control and direct molecular-level contact with the amplification system, significantly improving efficiency compared to traditional water baths and metal baths. Furthermore, this photosensitizer serves as a photothermal signal probe for the photothermal test strip, providing a sensitive and quantifiable signal. Compared to traditional PCR amplification, which takes 40 minutes and subsequent detection using gel electrophoresis and other methods, and quantitative real-time PCR amplification and detection, which takes 40 minutes and has a detection limit of approximately 100 copies, the rapid analysis method of this invention shortens the entire amplification and detection time to approximately 20 minutes and reduces the detection limit to 10 copies, resulting in a 10-fold increase in sensitivity compared to traditional PCR.

[0044] The rapid analysis method of this invention can quickly and efficiently amplify and detect multiple target DNAs, and is characterized by high efficiency, convenience and accuracy. It is suitable for the rapid detection of *Thiobacillus acidophilus*. Attached Figure Description

[0045] Figure 1 This is a schematic diagram of the workflow of the present invention;

[0046] Figure 2 This describes the photothermal heating of the photothermal material in step S3 of Embodiment 1 of the present invention.

[0047] Figure 3 The results are the final test strip detection results for the asymmetric photonic PCR systems with different upstream and downstream primer ratios in step S6 of Example 1 of this invention.

[0048] Figure 4This is a comparison of gel electrophoresis analysis results of the corresponding amplification products obtained by asymmetric photonic PCR and conventional PCR methods in step S7 of Example 1 of the present invention;

[0049] Figure 5 This is a photograph of the photothermal test paper in step S6 of embodiment 2 of the present invention. Detailed Implementation

[0050] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Many specific details are set forth in the following description to provide a thorough understanding of the present invention. However, the present invention can also be implemented in other ways different from those described herein. Those skilled in the art can make similar extensions without departing from the spirit of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below. The present invention will be further described in detail below with reference to specific embodiments to enable those skilled in the art to understand it.

[0051] Furthermore, in the specific embodiments disclosed below, where specific techniques or conditions are not specified, the techniques or conditions described in the literature in this field or in accordance with the product instructions should be followed. Reagents whose manufacturers are not specified are all conventionally available products.

[0052] This invention discloses a rapid analytical method for *Acidithiobacillus acidophilus*, a metal-corrosive microorganism. Specifically, it involves a method for rapid analysis and detection of the *AlaS*, *Cyc2*, and *Rus* genes of *Acidithiobacillus acidophilus* using asymmetric photonic PCR with the photosensitizer As2MoO6@NiS and photothermal test strips. Figure 1 As shown, it includes the following steps:

[0053] S1. Primer sequence design

[0054] Based on the principles of PCR, amplification primer sets were designed for the alaS, cyc2, and rus gene sequences of the target gene *Acidithiobacillus acidophilus*, respectively. Each primer set includes two primers: an upstream primer and a downstream primer.

[0055] S2. Sample Collection and Nucleic Acid Extraction

[0056] Microorganisms on metal surfaces were collected using sampling methods such as direct scraping, cotton swab wiping, or brushing; and genomic DNA of the microorganisms was extracted using methods such as thermal lysis, reagent kits, and SDS.

[0057] S3. Preparation of photosensitizer As2MoO6@NiS

[0058] Nanoparticles of the photosensitizer As2MoO6 were synthesized using a hydrothermal method;

[0059] Add 1-2 mg of As2MoO6 nanoparticles to 5-10 mL of deionized water containing 10-20 mg of polyethylene glycol (MW5000-10000), sonicate for 20-30 min, stir overnight to obtain a mixture;

[0060] NiS was dissolved in nitric acid with a concentration of 0.3-0.5 mol / L, and the pH was adjusted to 6.5-7.0 to obtain an aqueous solution of NiS with a concentration of 1-10 mg / mL.

[0061] Add 1 mL of the mixture to 1 mL of NiS aqueous solution with a concentration of 1–10 mg / mL and stir overnight. The resulting solution can be used directly as the photosensitizer As2MoO6@NiS solution in a triple asymmetric photon PCR system. Alternatively, the dark gray powder can be collected by centrifugation, dried, and the solid photosensitizer As2MoO6@NiS can be obtained for further surface modification reactions or storage.

[0062] S4. Constructing a triple asymmetric photonic PCR system

[0063] Using the alaS, cyc2, and rus genes of *Acidithiobacillus ferrooxidans* extracted from the microbial genomic DNA in step S2 as templates, a triple asymmetric photonic PCR system was constructed. This triple asymmetric photonic PCR system comprises the following components: the primer set from step S1, the photosensitizer As2MoO6@NiS prepared in step S3, PCR premix (Taq plus mix), the microbial genomic DNA extracted in step S2 as template, and ultrapure water.

[0064] S5, LED light source excitation of asymmetric photon PCR

[0065] The above triple asymmetric photonic PCR system was irradiated with an 808nm external coaxial reflective LED to excite the photosensitizer in the triple asymmetric photonic PCR system to provide the energy required for asymmetric photonic PCR. The excitation power was 4.5-6W and the total excitation time was 10-30min.

[0066] Then, asymmetric photon PCR amplification was performed under the following conditions: the concentration of photosensitizer As2MoO6@NiS solution was 0.1-1.0 mg / mL; the pre-denaturation excitation power was 6 W for 1 min; 20-60 denaturation-annealing-extension cycles were performed: 6 W for 10 s; 4.5 W for 5 s; 5 W for 5 s; and extension for 5 W for 3 min.

[0067] After the triple asymmetric photon PCR system was amplified, the amplification product was obtained.

[0068] S6, Photothermal Detection

[0069] Three corresponding photothermal signal probes were obtained by modifying the photosensitizer As2MoO6@NiS with nucleic acid chains.

[0070] The amplification product was mixed with three photothermal signal probes and loaded onto the sample. The detection area of ​​the photothermal test strip captured the amplification product and signal probes in a sandwich configuration, and provided a photothermal temperature change signal positively correlated with the amplification product content, which was used to quantify the target gene. The amplification product was detected using the photothermal test strip, and the temperature signal was read by a smartphone for quantification.

[0071] The photothermal test strip consists primarily of a nitrocellulose membrane, with glass fiber sample pads and absorbent paper at each end. The detection area (T-zone) of the photothermal test strip contains sequentially immobilized complementary sequences (Ti, Ti, Ti) of three amplification products to be tested. alaS :GTGCCTTTCC,T cyc2 :TGTTGGTGTC,T rus The test strip body has a control zone (C zone) with a sequence complementary to the signal probe (C probe: TTTTTTTTTT) that is fixed on the main body of the test strip.

[0072] Simultaneously, the three corresponding photothermal signal probes can be mixed with the amplification product as described above (i.e., independently of the test strip body), or they can be first dropped onto the conjugate pad and dried, integrating the conjugate pad into the test strip. During use, the amplification product is directly loaded onto the sample. During detection, one end of the amplification product binds to the T probe, and the other end binds to the photothermal signal probe, thus providing a photothermal temperature change signal positively correlated with the amplification product content, which is used to quantify the target gene.

[0073] The rapid analysis method of the present invention is used to detect metal-corrosive microorganisms, such as *Acidithiobacillus acidophilus*. In the application process, it is necessary to use components including a light source, an asymmetric photon PCR amplification system scaffold, the above-mentioned photothermal test strip, a test strip holder, a device with temperature acquisition accessories (such as a smartphone), and a light-proof and heat-insulating shell to achieve the integration and convenient operation of the above method.

[0074] This invention enables efficient amplification of the alaS, cyc2, and rus genes of *Acidithiobacillus acidophilus*. The following examples use the alaS gene of *Acidithiobacillus acidophilus* as an example to provide a thorough and detailed explanation of the entire amplification method.

[0075] Example 1: A rapid analysis method for the alaS gene in *Acidithiobacillus acidophilus*, a metal-corroding microorganism.

[0076] This embodiment presents a rapid analysis method for the alaS gene in *Acidithiobacillus acidophilus*, a metal-corrosive microorganism. Specifically, it is an asymmetric photonic PCR method driven by the photothermal effect of the photosensitizer As2MoO6@NiS, using the alaS gene of *Acidithiobacillus acidophilus* as a template. The method includes the following specific steps:

[0077] S1. Primer sequence design:

[0078] Based on the principle of asymmetric PCR, a set of amplification primer pairs were designed for the target gene alaS gene of *Acidithiobacillus acidophilus*. The primer pairs include upstream and downstream primers, and the specific primer sets are shown in Table 1. The alaS gene sequence of *Acidithiobacillus acidophilus* is shown in SEQ ID NO: 1.

[0079] Table 1. Primer sequences for asymmetric photon PCR

[0080]

[0081] S2. Sample Collection and Nucleic Acid Extraction

[0082] Microorganisms on metal surfaces were collected using the cotton swab wiping method. Specifically, a sterile cotton swab dipped in physiological saline was used to gently wipe the metal surface to collect microorganisms. The wiped cotton swab was then placed in a sterile container and diluted with 10 mL of sterile water or physiological saline.

[0083] Microbial genomic DNA was extracted using a thermal lysis method. Specifically, 0.5 mL of bacterial culture was heated in a water bath at 100 °C for 10 min, and after standing, 100 μL of the supernatant was taken as the microbial genomic DNA sample to be tested (i.e., containing the alaS gene of *Acidithiobacillus acidophilus*).

[0084] Meanwhile, the DNA content, A260nm / A280nm ratio, and A260nm / A230nm ratio in the microbial genomic DNA samples were measured using a Nano Drop micro-spectrophotometer to ensure that the microbial genomic DNA samples met quality standards.

[0085] The alaS gene reference used to create standard curves is a custom-synthesized sequence that is diluted stepwise according to the copy number concentration provided by the supplier to obtain the required concentration.

[0086] S3. Preparation and characterization of photosensitizer As2MoO6@NiS

[0087] As2MoO6 nanoparticles were synthesized using a hydrothermal method.

[0088] Add 2 mg of As2MoO6 nanoparticles to 10 mL of deionized water containing 20 mg of polyethylene glycol (MW = 10000), sonicate for 30 min, stir overnight to obtain a mixture;

[0089] NiS was dissolved in 0.4 mol / L nitric acid, and the pH was adjusted to 6.5 to obtain an aqueous solution of NiS with a concentration of 1 mg / mL.

[0090] Add 1 mL of the mixture to 1 mL of a 5 mg / mL NiS aqueous solution and stir overnight. The resulting solution can be used directly as the photosensitizer As2MoO6@NiS solution in an asymmetric photon PCR system. Alternatively, the dark gray powder can be collected by centrifugation, dried, and the solid photosensitizer As2MoO6@NiS can be obtained for further surface modification reactions or storage.

[0091] A photosensitizer As2MoO6@NiS solution (concentration 0.1 mg / mL) was irradiated with an 808 nm laser, and compared with an As2MoO6 solution (As2MoO6 concentration 0.1 mg / mL) and a NiS solution (NiS solution solvent is deionized water, NiS concentration 0.5 mg / mL). The photothermal heating curves of the three are as follows: Figure 2 As shown, the As2MoO6@NiS solution exhibits significantly improved heating efficiency compared to the single-substance solution, which is beneficial for enhancing its efficiency as a photosensitizer.

[0092] S4. Construction of asymmetric photonic PCR system

[0093] Using the microbial genomic DNA sample to be tested as a DNA template, an asymmetric photonic PCR system was constructed in a PCR tube. This asymmetric photonic PCR system includes the following components: the primer pair from step S1, the photosensitizer As2MoO6@NiS prepared in step S3, PCR premix (Taq plus mix), the microbial genomic DNA sample to be tested, and ultrapure water. The specific concentrations and reaction volumes of each component in the asymmetric photonic PCR system are shown in Table 2.

[0094] Table 2. Concentrations and reaction volumes of various components in asymmetric photon PCR amplification of the alas gene of *Acidithiobacillus ferrooxidans*.

[0095]

[0096] S5, LED light source excitation of asymmetric photon PCR

[0097] An 808nm external coaxial reflective LED was repeatedly turned on (10s) and off (5s) at a distance of 3cm from the PCR tube to irradiate the asymmetric photonic PCR system. The photosensitizer As2MoO6@NiS in the asymmetric photonic PCR system was excited to provide energy for the asymmetric photonic PCR. The excitation power was 4.5W and the total excitation time was 10min.

[0098] Then, asymmetric photonic PCR amplification was performed under the following conditions: As2MoO6@NiS solution concentration was 0.5 mg / mL; pre-denaturation excitation power was 6 W for 1 min; denaturation-annealing-extension cycles were: 6 W for 10 s; 4.5 W for 5 s; 5 W for 5 s; extension at 5 W for 3 min. The total time for 20 cycles of asymmetric photonic PCR amplification was 10 min, and the total time for 40 cycles was 20 min.

[0099] For the reference sample with 1000 copies of the alaS gene, asymmetric photonic PCR was performed on the alaS gene for 20 and 40 amplification cycles, respectively, to obtain the corresponding amplification products.

[0100] Asymmetric photonic PCR was performed on samples with the same alaS gene copy number but different upstream and downstream primer ratios for 20 amplification cycles to obtain the corresponding asymmetric photonic PCR amplification samples.

[0101] Asymmetric photonic PCR amplification was performed on a reference series with alaS gene copy numbers of 1, 10, 100, 1000, 10000, and 100000 for 20 amplification cycles to obtain the corresponding asymmetric photonic PCR amplification samples.

[0102] S6, Photothermal Detection

[0103] The photothermal test paper's main body is a nitrocellulose membrane, with a glass fiber sample pad and absorbent paper at each end. An alaS T-region probe is fixed to the detection area (T-region) of the photothermal test paper. alaS :GTGCCTTTCC, the control area (C area) of the test strip body has a sequence complementary to the signal probe (C probe: TTTTTTTTTT).

[0104] Take 10 μL of 0.1 M nucleic acid strand (TGCTGGAGGAAAAAAAAAAA) and 1 mL of 1 mg / mL photosensitizer As2MoO6@NiS, and incubate overnight in 1×PBS buffer in the dark at room temperature with shaking to obtain the photothermal signal probe of the alaS gene.

[0105] Take 10 μL of asymmetric photonic PCR amplification sample, mix it with 10 μL of the alaS gene photothermal signal probe and 80 μL of running buffer (4×SSC, 0.25% Tween-20), and load the sample onto the detection area of ​​the photothermal test strip in a sandwich configuration to capture the amplification product and the photothermal signal probe. After loading for 10 min, air-dry the test strip and collect the photothermal temperature change signal in the detection area using a smartphone under LED light excitation. Then, plot a quantitative curve with the initial target gene copy number as the x-axis and the measured photothermal temperature change signal as the y-axis.

[0106] Take 10 μL of amplification product corresponding to the upstream and downstream primer ratio, mix it with 10 μL of alaS gene photothermal signal probe and 80 μL of running buffer (4×SSC, 0.25% Tween-20), and load the sample. The amplification product and photothermal signal probe are sandwiched in the detection area of ​​the photothermal test strip. After loading the sample for 10 min, the test strip is air-dried. Under the condition of LED light source excitation, the photothermal temperature change signal of the detection area is collected with a smartphone, and the measured photothermal temperature change signal is used to input the quantitative curve. The target gene is quantified according to the quantitative curve.

[0107] from Figure 3 As can be seen, under different upstream and downstream primer ratios, the photothermal test strip detection area gives different photothermal signals, that is, the yield of asymmetric photon PCR amplification products is different. When the upstream and downstream primer ratios F:R are 1:2 and 1:5 respectively, there is no significant difference in photothermal signals. From the perspective of saving primers, the preferred upstream and downstream primer ratio F:R in this invention is 1:2.

[0108] S7. Comparison with traditional PCR

[0109] Using the microbial genomic DNA sample obtained in step S2 as a DNA template, conventional PCR was used for amplification. The amplification system for conventional PCR is shown in Table 3.

[0110] Table 3. Concentrations and reaction volumes of various components in the alaS gene of *Acidithiobacillus ferrooxidans* amplified by conventional PCR.

[0111]

[0112] The traditional PCR program is set as follows: 40 cycles of pre-denaturation at 94℃ for 5 min, followed by denaturation at 94℃ for 10 s, annealing at 60℃ for 30 s, and extension at 72℃ for 10 s, with a total amplification time of about 40 min, yielding the traditional PCR amplification product.

[0113] Using the microbial genomic DNA sample obtained in step S2 as a DNA template, with an upstream and downstream primer ratio of F:R of 1:2, amplification was performed for 5 min and 10 min respectively according to the methods in steps S4 to S5 to obtain asymmetric photon PCR amplification products corresponding to different amplification durations.

[0114] Gel electrophoresis analysis was performed on traditional PCR amplification products and asymmetric photon PCR amplification products corresponding to different amplification durations, as shown in the following results. Figure 4 As shown, the asymmetric photonic PCR method of this invention exhibits a significant difference in amplification efficiency compared to the traditional PCR method. Under the same initial DNA template concentration, traditional PCR amplification after 40 minutes shows a weak band on gel electrophoresis, while the asymmetric photonic PCR method of this invention shows a band after only 10 minutes of amplification, and the band is significantly darker after 20 minutes than that of traditional PCR amplification after 40 minutes. This indicates that the asymmetric photonic PCR amplification product after 20 minutes is significantly greater than that after 40 minutes of traditional PCR amplification. This demonstrates that the asymmetric photonic PCR method of this invention can effectively improve amplification efficiency and shorten amplification time.

[0115] Example 2: A rapid analytical method for *Thiobacillus acidophilus*, a metal-corrosive microorganism.

[0116] This embodiment presents a rapid analytical method for *Acidithiobacillus acidophilus*, a metal-corrosive microorganism. Specifically, it is a rapid analytical method for detecting the asymmetric photonic PCR products of the *AlaS*, *Cyc2*, and *Rus* genes of *Acidithiobacillus acidophilus* using the photosensitizer As2MoO6@NiS as a photothermal signal probe. The method includes the following specific steps:

[0117] S1. Primer sequence design:

[0118] Based on the principle of asymmetric PCR, amplification primer pairs were designed for the alaS, cyc2, and rus genes of *Acidithiobacillus acidophilus*. Each primer pair included upstream and downstream primers, and the specific primer sets and primer pair sequences are shown in Table 4. The alaS gene sequence of *Acidithiobacillus acidophilus* is shown in SEQ ID NO: 1; the cyc2 gene sequence is shown in SEQ ID NO: 2; and the rus gene sequence is shown in SEQ ID NO: 3.

[0119] Table 4. List of primer sequences for asymmetric photon PCR

[0120]

[0121] S2. Sample Collection and Nucleic Acid Extraction

[0122] Sample collection and nucleic acid extraction were performed according to the method in step S2 of Example 1 to obtain the microbial genomic DNA sample to be tested.

[0123] The alaS, cyc2, and rus gene references used in the preparation of standard curves are artificially synthesized custom sequences. The required concentrations are obtained by serially diluting them according to the copy number concentrations provided by the supplier.

[0124] S3. Preparation of photosensitizer As2MoO6@NiS

[0125] The photosensitizer As2MoO6@NiS solution was prepared according to the method in step S3 of Example 1.

[0126] Construction of S4 triple asymmetric photonic PCR system

[0127] A mixture of alaS gene, cyc2 gene, and rus gene was used as a DNA template. An amplification system was constructed according to the method in step S4 of Example 1. The concentrations and reaction volumes of each component in the resulting amplification system are shown in Table 5.

[0128] Table 5. Summary of the concentrations and reaction volumes of each component of the alaS, cyc2, and rus genes in asymmetric photon PCR amplification of *Acidithiobacillus acidophilus*.

[0129]

[0130] S5, LED light source excitation of asymmetric photon PCR

[0131] Amplification was performed according to the method in step S5 of Example 1. After amplification, amplification products of the alaS gene, cyc2 gene, and rus gene were obtained.

[0132] S6, Photothermal Detection

[0133] The photothermal test strip is made of nitrocellulose membrane, with a glass fiber sample pad and absorbent paper at each end. The detection zone (T zone) of the photothermal test strip contains complementary sequences of three amplification products to be tested, while the control zone (C zone) contains a sequence complementary to the signal probe (C probe: TTTTTTTTTT).

[0134] Three nucleic acid strands (TGCTGGAGGAAAAAAAAAAA, ACGATTGGGGAAAAAAAAAA, and AGCTTTGAAGAAAAAAAAAA) partially complementary to the asymmetric photon PCR amplification product, each at a concentration of 0.1 M, were taken in 1 mL of 1 mg / mL photosensitizer As2MoO6@NiS. The mixtures were then incubated overnight in 1×PBS buffer, protected from light, at room temperature with shaking, to obtain three corresponding photothermal signal probes for the alaS gene, cyc2 gene, and rus gene of *Acidithiobacillus acidophilus*.

[0135] Take 10 μL of the amplification product from step 5, 10 μL each of the three photothermal signal probes, and 60 μL of running buffer (4×SSC, 0.25% Tween-20). Mix the mixture and load it onto the detection area of ​​the photothermal test strip, trapping the amplification product and signal probes in a sandwich configuration. After loading for 10 min, air-dry the test strip. Under LED light source excitation, use a smartphone to collect the photothermal temperature change signal in the detection area. The results are as follows. Figure 5 As shown.

[0136] Depend on Figure 5 The photothermal test strip photos show that the test strip can detect the amplification products of specific target genes in a triple asymmetric photon PCR system under photothermal mode.

[0137] S7. Quantitative Curve Plotting

[0138] Mixtures of the target gene alaS, cyc2, and rus genes with copy numbers of 1, 10, 100, 1000, 10000, and 100000, respectively, were taken as DNA templates and asymmetric photon PCR amplification was performed according to the methods in steps S4 to S5 to obtain the corresponding amplification mixtures.

[0139] 10 μL of the amplification mixture corresponding to each gene copy number was taken and mixed with 10 μL each of the three photothermal signal probes and 60 μL of running buffer (4×SSC, 0.25% Tween-20). The mixture was then loaded onto the detection area of ​​the photothermal test strip in a sandwich configuration to capture the amplification product and the photothermal signal probe. After 10 min of loading, the test strip was air-dried. Under LED light excitation, the photothermal temperature change signal in the detection area was acquired using a smartphone. Then, quantitative curves for the three genes were plotted with the initial target gene copy number as the x-axis and the measured photothermal temperature change signal as the y-axis.

[0140] The quantitative curves for the genes in the three entries are as follows:

[0141] The quantitative curve for the alaS gene is: y = 5.50x + 0.78, R0 2 =0.9929;

[0142] The quantitative curve for the cyc2 gene is: y = 4.55x + 0.82, R0 2 =0.9935;

[0143] The quantitative curve for the rus gene is y = 4.36x + 0.34, R 2 =0.9897.

[0144] When performing quantitative analysis on three genes, samples with unknown target gene concentrations were subjected to asymmetric photon PCR amplification and photothermal detection. The resulting photothermal temperature change signals of the three genes were substituted into the equation of the quantitative curve to calculate the corresponding concentrations of the three genes, thus achieving quantitative analysis of the target genes.

[0145] Meanwhile, it can be seen that the present invention can successfully amplify and quantitatively detect the three genes of *AlaS*, *Cyc2*, and *Rus* of *Thiobacillus acidophilus*, and the detection limit for all three genes is 10 copies / μL.

[0146] All other parts not described in detail are existing technologies. Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, not all embodiments. Those skilled in the art can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A rapid analytical method for *Thiobacillus acidophilus*, a metal-corrosive microorganism, characterized in that... The rapid analysis method includes the following specific steps: Construction of a triple asymmetric photonic PCR system: The microbial genomic DNA sample to be tested, photosensitizer As2MoO6@NiS, primer pairs for the alaS gene, primer pairs for the cyc2 gene and primer pairs for the rus gene were used to construct a triple asymmetric photonic PCR system. LED light source excited asymmetric photonic PCR: The triple asymmetric photonic PCR system was irradiated with an LED light source to perform asymmetric photonic PCR amplification and obtain the amplification product; Photothermal detection: Three corresponding photothermal signal probes were prepared by modifying photosensitizers with three nucleic acid strands that are partially complementary to the amplification products. The detection area of ​​the photothermal test strip is sequentially fixed with complementary sequences of the three amplification products to be tested, and the quality control area of ​​the test strip body is fixed with sequences complementary to the signal probes. The amplification products are mixed with the running buffer and the photothermal signal probes and then dropped onto the sample pad of the test strip for photothermal temperature change detection. The photothermal temperature change signal is positively correlated with the content of the amplification products.

2. The rapid analytical method for *Thiobacillus acidophilus*, a metal-corrosive microorganism, according to claim 1, is characterized in that... The triple asymmetric photon PCR system includes 1.0–2.0 μL each of primer pairs for the alaS gene, the cyc2 gene, and the rus gene, 1.0–3.0 μL of photosensitizer As2MoO6@NiS, 10 μL of PCR premix, and 1.0–2.0 μL of the microbial genomic DNA sample to be tested.

3. The rapid analytical method for *Acidithiobacillus acidophilus*, a metal-corrosive microorganism, according to claim 1 or 2, is characterized in that... The primer pair for the alaS gene includes the upstream primer alaS-F: 5'-GTGCCTTTCCCGAACTCACG-3', and the downstream primer alaS-R: 5'-TCCTCCAGCAGACTGAGTCC-3'; The primer pair for the cyc2 gene includes the upstream primer cyc2-F: 5'-TGTTGGTGTCTATGGGGCGG-3', and the downstream primer cyc2-R: 5'-CCCCAATCGTGCTGATAGGC-3'; The primer pair for the rus gene includes the upstream primer rus-F: 5'-GCACGCTGGATTCCACATGG-3', and the downstream primer rus-R: 5'-CTTCAAAGCTCGGGAACGG-3'; The ratio between any upstream primer and its corresponding downstream primer in the three primer pairs is 1:0.1 to 1:

10.

4. The rapid analytical method for *Thiobacillus acidophilus*, a metal-corrosive microorganism, according to claim 1 or 2, is characterized in that... The preparation process of the photosensitizer As2MoO6@NiS is as follows: Add As2MoO6 nanoparticles to deionized water containing polyethylene glycol, sonicate, and stir overnight to obtain a mixture; NiS was dissolved in nitric acid and the pH was adjusted to obtain an aqueous solution of NiS. Add the mixture to an aqueous NiS solution and stir overnight. The resulting solution can be used directly as the photosensitizer As2MoO6@NiS solution; or centrifuge to collect the dark gray powder, dry it, and obtain the solid photosensitizer As2MoO6@NiS.

5. The rapid analytical method for *Thiobacillus acidophilus*, a metal-corrosive microorganism, according to claim 1 or 2, is characterized in that... The fabrication process of the three photothermal signal probes is as follows: Three nucleic acid strands, TGCTGGAGGAAAAAAAAAAA, ACGATTGGGGAAAAAAAAAA, and AGCTTTGAAGAAAAAAAAAA, which are partially complementary to the asymmetric photon PCR amplification product, were taken and reacted with the photosensitizer As2MoO6@NiS. They were then incubated overnight in 1×PBS buffer at room temperature in the dark to obtain three corresponding photothermal signal probes for the alaS gene, cyc2 gene, and rus gene of *Acidithiobacillus acidophilus*.

6. The rapid analytical method for *Thiobacillus acidophilus*, a metal-corrosive microorganism, according to claim 1 or 2, is characterized in that... LED light source illumination utilizes an 808nm external coaxial reflective LED for illumination; during the illumination process, the excitation power is 4.5–6W, and the total excitation time is 10–30 minutes.

7. The rapid analytical method for *Thiobacillus acidophilus*, a metal-corrosive microorganism, according to claim 1 or 2, is characterized in that... The reaction conditions for asymmetric photonic PCR amplification were as follows: the concentration of photosensitizer As2MoO6@NiS solution was 0.1-1.0 mg / mL; the pre-denaturation excitation power was 6 W for 1 min; 20-60 denaturation-annealing-extension cycles were performed: 6 W for 10 s; 4.5 W for 5 s; 5 W for 5 s; and extension for 5 W for 3 min.

8. The rapid analytical method for *Thiobacillus acidophilus*, a metal-corrosive microorganism, according to claim 1 or 2, is characterized in that... Quantitative analysis of the alaS, cyc2, and rus genes was performed based on photothermal temperature change signals, as detailed below: After asymmetric photon PCR amplification and photothermal detection of three samples with unknown target gene concentrations, the photothermal temperature change signals of the three genes were substituted into the equation of the quantitative curve to calculate the corresponding concentrations of the three genes, thus realizing the quantitative analysis of the target genes. The quantitative curves for the genes in the three entries are as follows: The quantitative curve for the alaS gene is: y = 5.50x + 0.78, R0 2 =0.9929; The quantitative curve for the cyc2 gene is: y = 4.55x + 0.82, R0 2 =0.9935; The quantitative curve for the rus gene is y = 4.36x + 0.34, R 2 =0.9897.

9. The rapid analytical method for *Thiobacillus acidophilus*, a metal-corrosive microorganism, according to claim 1 or 2, is characterized in that... The microbial genomic DNA sample to be tested was prepared by collecting microorganisms from metal surfaces and extracting their genomic DNA.

Images