KASP molecular marker significantly related to amylose content of wheat and application of KASP molecular marker

Abstract

The invention discloses a KASP molecular marker remarkably related to the amylose content of wheat and application of the KASP molecular marker, and belongs to the technical field of wheat breeding. A KASP molecular marker system closely linked with SBEIIa and / or SBEIIb is developed on the basis of information of one mutation site of a wheat starch branching enzyme gene SBEIIa on a 2B chromosome and information of three mutation sites of SBEIIb on 2A, 2B and 2D chromosomes, and the KASP molecular marker system is simple and convenient in detection process, low in cost, high in throughput, high in sensitivity and high in sensitivity. According to the method, the high-amylose wheat material which contains the mutant genotype and can be stably inherited can be accurately and efficiently screened out, the breeding process of wheat variety quality improvement can be accelerated, and the method has important significance on creation of the high-amylose wheat material or molecular assisted breeding of the high-amylose wheat.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of wheat breeding, and particularly relates to a KASP molecular marker significantly related to amylose content of wheat and application thereof. BACKGROUND

[0002] Wheat starch (70%-80% of endosperm) is mainly composed of amylose and amylopectin. Amylose can be widely used in functional food development, industrial raw materials and other fields due to its unique linear molecular structure. For example, high-amylose wheat can significantly increase the content of resistant starch (RS), which is used for developing functional staple food suitable for people with diabetes and obesity, and can also be used as a natural thickening agent and stabilizer to improve food texture and delay digestion, and can also be used to prepare degradable plastics, food packaging films, 3D printing materials, drug molecule embedding agents, etc. However, the lack of high-amylose wheat germplasm resources and the shortage of special molecular detection markers restrict the breeding process of high-amylose wheat, and new breeding markers need to be developed.

[0003] Starch branching enzyme (SBE) as a key enzyme for amylopectin synthesis, affects the ratio of amylose / amylopectin by catalyzing the formation of α-1, 6-glycosidic bond branching, and is an ideal target for regulating the content of crop amylose. Wheat SBE includes SBEI and SBEII two types of isozymes, and SBEII is further divided into SBEIIa and SBEIIb. Studies have shown that SBEI has little effect on amylose content in wheat, while the loss of function of SBEII (especially SBEIIb) can significantly increase amylose. SBEIIa in wheat is controlled by SBEIIa-2A, SBEIIa-2B and SBEIIa-2D, and SBEIIb is controlled by SBEIIb-2A, SBEIIb-2B and SBEIIb-2D. Unlike other crops (such as corn and rice), wheat needs to inhibit the expression of SBEIIa and SBEIIb at the same time to achieve the phenotype of high-amylose. By EMS mutagenesis, RNAi silencing or gene editing to inhibit SBEIIa and SBEIIb at the same time, short-chain branching can be reduced, the substrate is diverted to amylose synthesis, and the content of amylose and resistant starch is significantly increased. Therefore, targeting SBEIIa / b for coordinated regulation is a core strategy for creating wheat varieties with high amylose content.

[0004] Marker-Assisted Selection (MAS) can quickly identify excellent individuals at the molecular level by selecting genetic markers linked to target trait genes, which significantly accelerates the breeding process. As a SNP-based endpoint fluorescent genotyping technology, Kompetitive Allele Specific PCR (KASP) has become the core tool of high-throughput MAS due to its unique advantages. KASP has the following core competitiveness: 1. Low cost, using universal fluorescent probes, the reagent cost is 80% lower than Taqman technology; 2. Accurate high-throughput detection, can clearly distinguish homozygous / heterozygous genotypes, detection rate > 99.5%; 3. Good platform compatibility, only needs ordinary PCR instrument combined with enzyme label instrument or qPCR equipment, without special instrument; 4. High-efficiency breeding integration ability, can detect multiple traits of genes at the same time, reducing the workload of breeding. Therefore, KASP markers are more suitable for molecular marker-assisted selection breeding. SUMMARY

[0005] The purpose of the present application is to provide a KASP molecular marker significantly related to the amylose content of wheat and its application, so as to solve the problems existing in the prior art.

[0006] To achieve the above purpose, the present application provides the following solutions:

[0007] In a first aspect, the present application provides a KASP molecular marker significantly related to the amylose content of wheat, characterized in that the KASP molecular marker is at least one of KASP-a2B, KASP-b2A, KASP-b2B and KASP-b2D.

[0008] The molecular marker KASP-a2B is located at 100 bp of the nucleotide sequence shown in SEQ ID NO. 1, and the base is G or A;

[0009] The molecular marker KASP-b2A is located at 88 bp of the nucleotide sequence shown in SEQ ID NO. 5, and the base is C or T;

[0010] The molecular marker KASP-b2B is located at 56 bp of the nucleotide sequence shown in SEQ ID NO. 9, and the base is C or T;

[0011] The molecular marker KASP-b2D is located at 26 bp of the nucleotide sequence shown in SEQ ID NO. 13, and the base is C or T.

[0012] In a second aspect, the present application further provides a KASP primer set for identifying the amylose content trait of wheat, comprising two forward primers and one reverse universal primer.

[0013] The nucleotide sequences of the two forward primers for detecting the KASP-a2B molecular marker are shown in SEQ ID NO. 2-3, and the nucleotide sequence of the reverse universal primer is shown in SEQ ID NO. 4;

[0014] The nucleotide sequences of the two forward primers for detecting the KASP-b2A molecular marker are shown in SEQ ID NO. 6-7, and the nucleotide sequence of the reverse universal primer is shown in SEQ ID NO. 8;

[0015] The nucleotide sequences of the two forward primers for detecting the KASP-b2B molecular marker are shown in SEQ ID NO. 10-11, and the nucleotide sequence of the reverse universal primer is shown in SEQ ID NO. 12;

[0016] The nucleotide sequences of the two forward primers for detecting the KASP-b2D molecular marker are shown in SEQ ID NO. 14-15, and the nucleotide sequence of the reverse universal primer is shown in SEQ ID NO. 16.

[0017] In a third aspect, the present application further provides use of the KASP primer set as described in the preparation of a product for identifying the amylose content trait of wheat.

[0018] Preferably, the product is a kit.

[0019] In a fourth aspect, the present application further provides a product for identifying the amylose content trait of wheat, wherein the product comprises the KASP primer set as described.

[0020] Preferably, the product is a kit.

[0021] In a fourth aspect, the present application further provides use of the KASP molecular marker or the KASP primer set or the product as described in identifying the amylose content trait of wheat.

[0022] In a fifth aspect, the present application further provides a method for identifying high-amylose-content wheat, comprising the following steps:

[0023] Extracting DNA of the wheat to be tested, performing fluorescent quantitative PCR amplification using the KASP primer set, obtaining the genotype of the wheat to be tested, and determining the amylose content of the wheat to be tested according to the genotype;

[0024] If the AA type is identified by the KASP-a2B molecular marker corresponding primer set, the amylose content of the wheat to be tested is high;

[0025] If the TT type is identified by the KASP-b2A molecular marker corresponding primer set, the amylose content of the wheat to be tested is high;

[0026] If the TT type is identified by the KASP-b2B molecular marker corresponding primer set, the amylose content of the wheat to be tested is high;

[0027] If the TT type is identified by the KASP-b2D molecular marker corresponding primer set, the amylose content of the wheat to be tested is high.

[0028] Preferably, the PCR amplification reaction system is: 2x KASP Master Mix 5 μL, KASP Assay Mix 1.4 μL, 20-200 ng / μL DNA template 1 μL, and ddH2O to 10 μL; wherein the KASP Assay Mix contains two forward primers and one reverse universal primer corresponding to each molecular marker.

[0029] Preferably, the PCR amplification reaction program is: 95℃ heat activation for 15 min; 95℃ denaturation for 20 s, 61-55℃ annealing and extension for 40 s, 10 Touch-down cycles, each cycle decreasing by 0.6℃; 95℃ denaturation for 20 s, 55℃ annealing and extension for 40 s, 34 cycles.

[0030] Using the KASP molecular marker system of the present application, the method for identifying the amylose content of wheat of the present application comprises the following steps:

[0031] (1) Taking the genomic DNA of the wheat to be tested as a template, KASP-a2B markers are used as primers for PCR amplification, and then the amplified products are scanned for fluorescence signals or directly subjected to fluorescent quantitative PCR amplification, and the wheat to be tested is genotyped according to the fluorescence signals: if the wheat to be tested exhibits KASP-a2B-HEX fluorescence group signals of the KASP primer set (the fluorescence signal values are aggregated near the X axis, and the samples show red color), but does not contain KASP-a2B-FAM fluorescence group signals, it is considered that the genotype of the wheat to be tested at the KASP-a2B marker is the mutant type AA; if the wheat to be tested exhibits KASP-a2B-FAM fluorescence group signals of the KASP primer set (the fluorescence signal values are aggregated near the Y axis, and the samples show blue color), but does not contain KASP-a2B-HEX fluorescence group signals, it is considered that the genotype of the wheat to be tested at the KASP-a2B marker is the wild type GG; if the wheat to be tested exhibits both KASP-a2B-HEX fluorescence group signals and KASP-a2B-FAM fluorescence group signals of the KASP primer set (the fluorescence signal values are aggregated on the bisector of the X axis and the Y axis), it is considered that the genotype of the wheat to be tested at the KASP-a2B marker is the hybrid type GA. The amylose content of the AA type wheat is significantly higher than that of the GG type wheat;

[0032] (2) Taking the genomic DNA of the wheat to be tested as a template, KASP-b2A markers are used as primers for PCR amplification, and then the amplified products are scanned for fluorescence signals or directly subjected to fluorescent quantitative PCR amplification, and the wheat to be tested is genotyped according to the fluorescence signals: if the wheat to be tested exhibits KASP-b2A-HEX fluorescence group signals of the KASP primer set (the fluorescence signal values are aggregated near the X axis, and the samples show red color), but does not contain KASP-b2A-FAM fluorescence group signals, it is considered that the genotype of the wheat to be tested at the KASP-b2A marker is the mutant type TT; if the wheat to be tested exhibits KASP-b2A-FAM fluorescence group signals of the KASP primer set (the fluorescence signal values are aggregated near the Y axis, and the samples show blue color), but does not contain KASP-b2A-HEX fluorescence group signals, it is considered that the genotype of the wheat to be tested at the KASP-b2A marker is the wild type CC; if the wheat to be tested exhibits both KASP-b2A-HEX fluorescence group signals and KASP-b2A-FAM fluorescence group signals of the KASP primer set (the fluorescence signal values are aggregated on the bisector of the X axis and the Y axis), it is considered that the genotype of the wheat to be tested at the KASP-b2A marker is the hybrid type CT. The amylose content of the TT type wheat is significantly higher than that of the CC type wheat;

[0033] (3) taking the genomic DNA of the wheat to be tested as a template, performing PCR amplification on the KASP-b2B marker as a primer, and then performing fluorescence signal scanning or directly performing fluorescent quantitative PCR amplification on the amplification product by using a fluorescent quantitative PCR instrument, and genotyping the wheat to be tested according to the fluorescence signal: if the wheat to be tested appears KASP-b2B-HEX fluorescence group signal of the KASP primer set (the fluorescence signal value is aggregated on the sample close to the X axis, showing red), and does not contain KASP-b2B-FAM fluorescence group signal, it is considered that the genotype of the KASP-b2B marker of the wheat to be tested is the mutant type TT; if the wheat to be tested appears KASP-b2B-FAM fluorescence group signal of the KASP primer set (the fluorescence signal value is aggregated on the sample close to the Y axis, showing blue), and does not contain KASP-b2B-HEX fluorescence group signal, it is considered that the genotype of the KASP-b2B marker of the wheat to be tested is the wild type CC; if the wheat to be tested appears KASP-b2B-HEX fluorescence group signal and KASP-b2B-FAM fluorescence group signal of the KASP primer set at the same time (the fluorescence signal value is aggregated on the bisector of the X axis and the Y axis), it is considered that the genotype of the KASP-b2B marker of the wheat to be tested is the hybrid type TC. The amylose content of the TT type wheat is significantly higher than that of the CC type wheat;

[0034] (4) taking the genomic DNA of the wheat to be tested as a template, performing PCR amplification on the KASP-b2D marker as a primer, and then performing fluorescence signal scanning or directly performing fluorescent quantitative PCR amplification on the amplification product by using a fluorescent quantitative PCR instrument, and genotyping the wheat to be tested according to the fluorescence signal: if the wheat to be tested appears KASP-b2D-HEX fluorescence group signal of the KASP primer set (the fluorescence signal value is aggregated on the sample close to the X axis, showing red), and does not contain KASP-b2D-FAM fluorescence group signal, it is considered that the genotype of the KASP-b2D marker of the wheat to be tested is the mutant type TT; if the wheat to be tested appears KASP-b2D-FAM fluorescence group signal of the KASP primer set (the fluorescence signal value is aggregated on the sample close to the Y axis, showing blue), and does not contain KASP-b2D-HEX fluorescence group signal, it is considered that the genotype of the KASP-b2D marker of the wheat to be tested is the wild type CC; if the wheat to be tested appears KASP-b2D-HEX fluorescence group signal and KASP-b2D-FAM fluorescence group signal of the KASP primer set at the same time (the fluorescence signal value is aggregated on the bisector of the X axis and the Y axis), it is considered that the genotype of the KASP-b2D marker of the wheat to be tested is the hybrid type CT. The amylose content of the TT type wheat is significantly higher than that of the CC type wheat.

[0035] The present application discloses the following technical effects:

[0036] The present application utilizes four single-gene mutants SBEIIa-2B, SBEIIb-2A, SBEIIb-2B and SBEIIb-2D of the John Innes Centre in the United Kingdom, which are Cadenza0269, Cadenza1644, Cadenza1648 and Cadenza1800 mutants (the mutants can be queried from the mutant retrieval website provided in the reference "Uncovering hidden variation in polyploid wheat [Proc Natl Acad Sci U S A, 2017]"), to develop a molecular marker system significantly associated with the amylose content of wheat, to accurately and efficiently screen high-amylose wheat materials containing one or more SBE site mutant genotypes and capable of stable inheritance through hybridization, to shorten the breeding process, and to provide technical support for high-amylose wheat and high-resistance starch wheat breeding.

[0037] Compared with the prior art, the present application develops a KASP molecular marker system closely linked to SBEIIa and / or SBEIIb based on the information of one mutation site of wheat starch branching enzyme gene SBEIIa on chromosome 2B and three mutation sites of SBEIIb on chromosomes 2A, 2B and 2D, which has a simple detection process, low cost, high throughput, can accurately and efficiently screen high-amylose wheat materials containing mutant genotypes and capable of stable inheritance, can accelerate the breeding process of wheat variety quality improvement, and has important significance for the creation of high-amylose wheat materials or the molecular-assisted breeding of high-amylose wheat. BRIEF DESCRIPTION OF DRAWINGS

[0038] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor.

[0039] Figure 1 The figures are genotyping results of the molecular markers of the present application; wherein A is the genotyping result of molecular marker KASP-a2B, B is the genotyping result of molecular marker KASP-b2A, C is the genotyping result of molecular marker KASP-b2B, and D is the genotyping result of molecular marker KASP-b2D. DETAILED DESCRIPTION

[0040] The following detailed description of various exemplary embodiments of the application will not be considered limiting of the application, but rather a description of certain aspects, features and embodiments of the application.

[0041] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. Additionally, where a range of values is provided, it is understood that each intervening value, to the upper and lower limit of the range is also specifically disclosed. Each smaller range between any stated value or intervening value in the stated range and any other stated or intervening value in that stated range is encompassed. The upper and lower limits of these smaller ranges can independently be included or excluded in the range.

[0042] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although preferred methods and materials are described, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application. All documents mentioned herein are incorporated by reference to disclose and describe the methods and / or materials in connection with which the documents are cited. In case of conflict, the content of the specification will control.

[0043] Various modifications and changes can be made to the specific embodiments of the application described herein without departing from the scope or spirit of the application. Other embodiments of the application will be apparent to those of ordinary skill in the art from the description and examples herein. The description and examples are illustrative of the application and are not intended to limit the scope of the application.

[0044] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", "contains", "containing", or variations thereof, are intended to be open-ended terms that mean including, but not limited to.

[0045] The experimental methods of the following examples, if not otherwise specified, are routine methods, which are carried out according to the techniques, conditions or product instructions described in the literature in the art. The materials, reagents, etc. used in the following examples, if not otherwise specified, can be obtained commercially.

[0046] Example 1 Obtaining and typing effect verification of KASP-a2B molecular marker closely linked to gene SBEIIa-2B

[0047] 1. Marker development

[0048] The partial sequence of SBEIIa gene on chromosome 2B of Chinese Spring (IWGSC RefSeq v2.1) (nucleotide sequence SEQ ID NO. 1 is: 5'- CAAAATAGCTTACTGAATACTGACCAGTTACTCTAAATTTATGATCTGGCTTTTGCATCCTGTTACAGTCTGCAGCATTAGTAGGTGACTTCAACAATT[G / A] GAATCCAAATGCAGATACTATGACCAGAGTATGTCTACAGCTTGGCAATCTTCCACCTTTGCTTCGTAACTACTGATACATCTATTTGTATTTATTTAACTGTTTGCACGTTCGTTAAAGTTGAGCCTCAACTATATCATACCAAAATGGTATAATTTGTCAGTGTCTTAAGCTTCAGCCTAAAGATCCTACTGAATTTA-3') is used as a reference sequence, at the SNP mutation site G / A, a plurality of KASP primers are designed by using Primer Premier 5 software, each group of primers includes two forward competitive primers and one reverse universal primer, and the primer sequence specificity is detected by using WheatOmics database. After a plurality of primer detections and screening, a KASP-a2B molecular marker with good amplification effect and strong specificity is finally obtained, which includes primers KASP-a2B-FAM, KASP-a2B-HEX and KASP-a2B-R, and the nucleotide sequences are shown as SEQ ID NO. 2-4 (the underlined part is the sequence of a fluorescent group):

[0049] SEQ ID NO. 2: 5'- GAAGGTGACCAAGTTCATGCT AGCATTAGTAGGTGACTTCAACAATTG-3';

[0050] SEQ ID NO. 3: 5'- GAAGGTCGGAGTCAACGGATT CAGCATTAGTAGGTGACTTCAACAATTA-3';

[0051] SEQ ID NO. 4: 5'- AACTTTAACGAACGTGCAAACAGT-3'.

[0052] The primers are sent to Beijing Lihe Huada Gene Technology Co., Ltd. for primer synthesis.

[0053] 2. Verification of KASP marker genotyping effect

[0054] The SNP types in Chinese Spring, Fielder, Zhongmai 16, Beijing 8, Jimai 22 and mutant Cadenza0269 detected by sequencing technology were reversely detected by the developed KASP-a2B molecular marker. The results need to meet the following conditions: good KASP primer specificity, strong amplification, clear clustering results and complete consistency of the typing data with the known genotype, which indicates that the KASP marker development is successful and can be further applied to high-throughput detection of large-scale breeding materials and molecular marker-assisted breeding. The specific method is as follows:

[0055] (1) DNA extraction

[0056] Seven wheat varieties of Cadenza0269, Chinese Spring, Fielder, Zhongkuai 58, Zhongmai 16, Beijing 8 and Jimai 22 were used as materials, and 2-10 samples were selected from each material. The genomic DNA of wheat seedling leaves was extracted, and the DNA concentration and purity were detected by micro visible / ultraviolet spectrophotometer (NanoDrop 2000). The OD 260 / 280 ratio between 1.7 and 2.2 proves that the DNA quality is high, and it is diluted to 50 ng / μL template for standby;

[0057] (2) Preparation of PCR amplification reaction system

[0058] Preparation of PCR amplification system (10 μL): 50 ng / μL DNA template 1 μL, 2× KASP Master Mix 5 μL, KASP Assay Mix 1.4 μL, supplemented with ddH2O to 10 μL; wherein the KASP Assay Mix system is prepared (100 μL) as follows: take KASP-a2B molecular marker corresponding KASP-a2B-FAM primer 12 μL, KASP-a2B-HEX primer 12 μL, KASP-a2B-R primer 30 μL, and add ddH2O to a total of 100 μL, and the concentration of each primer is 10 μM.

[0059] (3) Fluorescent quantitative PCR amplification of the tested genomic DNA

[0060] ABI QuantStudio 6 real-time fluorescent quantitative PCR instrument was used to perform fluorescent quantitative PCR amplification on the above prepared PCR system. The PCR amplification reaction program was as follows: 95℃ heat activation for 15 min; 95℃ denaturation for 20 s, 61-55℃ annealing and extension for 40 s (10 Touch-down cycles, each cycle decreasing by 0.6℃); 95℃ denaturation for 20 s, 55℃ annealing and extension for 40 s, 34 cycles; 25℃ incubation for 30 s, and fluorescence signal was collected.

[0061] (4) Determination of typing results

[0062] The classification results are as follows: Figure 1 As shown in Figure A, the fluorescence signal values ​​of the Cadenza0269 material aggregate near the X-axis, showing the red sample (the allele genotype of the HEX fluorescent linker), and the genotype of the molecular marker KASP-a2B is the mutant AA. The fluorescence signal values ​​of the six wild-type materials, namely Chinese Spring, Fielder, Aikang 58, Zhoumai 16, Beijing 8, and Jimai 22, aggregate near the Y-axis, showing the blue sample (the allele genotype of the FAM fluorescent linker), and the genotype of the molecular marker KASP-a2B is the wild-type GG.

[0063] The amylose content of whole wheat flour from the Cadenza0269 mutant grains was determined to be 13.4%, which is 8.8% higher than that of the wild-type Cadenza (12.3%). The KASP-a2B marker developed in this invention yielded excellent genotyping results, with clear delineation of different genotypes and high resolution. Furthermore, the marker's genotyping results for the Cadenza0269 mutant and wild-type materials were completely consistent, indicating that the KASP marker was successfully developed and can be further applied to high-throughput detection of breeding materials and marker-assisted breeding in large-scale breeding programs.

[0064] Example 2: Obtaining and validating the KASP-b2A molecular marker tightly linked to gene SBEⅡb-2A.

[0065] 1. Tag Development

[0066] The partial sequence of SBEIIb gene on the chromosome 2A of Chinese Spring (IWGSC RefSeq v2.1) (nucleotide sequence SEQ ID NO. 5: 5'-GTTGAACACAAATACCAAGTCCCCTTTTTCAAACACGATCACCTTATCTTCCTCATGTTTCCGAGATACGTACTGGTGGTCTGATGT[C / T]ATAAACTGCAATTACATGGCCTGTTTCATCAGCGAATATTCATAGGTGCCATATAATGAACTTACTAGGATCTGCCTACGTTACCAGATATAATTTGAAGGCAAGAAAGCA-3') is used as a reference sequence, and a plurality of KASP primers are designed at the SNP mutation site C / T by using Primer Premier 5 software, each of the primers comprising two forward competitive primers and one reverse universal primer, and the primer sequence specificity is detected by using the WheatOmics database. After multiple primer detections and screening, the KASP-b2A molecular marker with good amplification effect and strong specificity is finally obtained, comprising primers KASP-b2A-FAM, KASP-b2A-HEX and KASP-b2A-R, and the nucleotide sequences are shown as SEQ ID NO. 6-8 (the underlined part is the sequence of the fluorescent group):

[0067] SEQ ID NO. 6: 5'- GAAGGTGACCAAGTTCATGCT GAGATACGTACTGGTGGTCTGATGTC-3';

[0068] SEQ ID NO. 7: 5'- GAAGGTCGGAGTCAACGGATT CGAGATACGTACTGGTGGTCTGATGTT-3';

[0069] SEQ ID NO. 8: 5'-TTCTTGCCTTCAAATTATATCTGGTAAC-3'.

[0070] The primers are sent to Beijing Lianghe Huada Gene Technology Co., Ltd. for primer synthesis.

[0071] 2. Verification of KASP marker typing effect

[0072] The SNP types in Chinese Spring, Fielder, Dwarf 58, Zhoumai 16, Beijing 8, Jimai 22 and mutant Cadenza1644 were detected by the developed KASP-b2A molecular marker. The results should meet the following conditions: good specificity of KASP primer, strong amplification, clear clustering results and complete consistency of typing data with known genotypes. Then the KASP marker development is successful, which can be further applied to high-throughput detection of large-scale breeding materials and molecular marker-assisted breeding. The specific method is as follows:

[0073] (1) DNA extraction

[0074] Seven wheat varieties, Cadenza1644, Chinese Spring, Fielder, Dwarf 58, Zhoumai 16, Beijing 8 and Jimai 22, which had been detected by sequencing technology, were used as materials. 2-10 samples were selected from each material. The genomic DNA of wheat seedling leaves was extracted. The DNA concentration and purity were detected by micro- visible / ultraviolet spectrophotometer (NanoDrop 2000). The OD 260 / 280 ratio between 1.7 and 2.2 proved that the DNA quality was high. The dilution was 50 ng / μL template for standby;

[0075] (2) Preparation of PCR amplification reaction system

[0076] Preparation of PCR amplification system (10 μL): 50 ng / μL DNA template 1 μL, 2× KASP Master Mix 5 μL, KASP Assay Mix 1.4 μL, supplemented with ddH2O to 10 μL; wherein the KASP Assay Mix system was prepared (100 μL) as follows: KASP-b2A molecular marker corresponding KASP-b2A-FAM primer 12 μL, KASP-b2A-HEX primer 12 μL, KASP-b2A-R primer 30 μL, supplemented with ddH2O to 100 μL, and the concentration of each primer was 10 μM.

[0077] (3) Fluorescent quantitative PCR amplification of the genomic DNA to be tested

[0078] ABI QuantStudio 6 real-time fluorescent quantitative PCR instrument was used to perform fluorescent quantitative PCR amplification on the prepared PCR system. The PCR amplification reaction program was as follows: 95℃ heat activation for 15 min; 95℃ denaturation for 20 s, 61-55℃ annealing and extension for 40 s (10 Touch-down cycles, each cycle decreased by 0.6℃); 95℃ denaturation for 20 s, 55℃ annealing and extension for 40 s, 34 cycles; 25℃ incubation for 30 s, and fluorescence signal was collected.

[0079] (4) Determination of typing results

[0080] The classification results are as follows: Figure 1 As shown in Figure B, the fluorescence signal values ​​of the Cadenza1644 material aggregate near the X-axis, showing the red sample (the allele type of the HEX fluorescent linker), and the genotype of the molecular marker KASP-b2A is the mutant TT. The fluorescence signal values ​​of the six wild-type materials, namely Chinese Spring, Fielder, Aikang 58, Zhoumai 16, Beijing 8, and Jimai 22, aggregate near the Y-axis, showing the blue sample (the allele type of the FAM fluorescent linker), and the genotype of the molecular marker KASP-b2A is the wild-type CC.

[0081] The amylose content of whole wheat flour from the Cadenza1644 mutant grains was determined to be 15.7%, which is 27.5% higher than that of the wild-type Cadenza (12.3%). The KASP-b2A marker developed in this invention yielded excellent genotyping results, with clear delineation of different genotypes and high resolution. Furthermore, the marker's genotyping results for the Cadenza1644 mutant and wild-type materials were completely consistent, indicating the successful development of the KASP marker. This marker can be further applied to high-throughput detection of breeding materials and marker-assisted breeding in large-scale breeding programs.

[0082] Example 3: Obtaining and validating the KASP-b2B molecular marker tightly linked to the SBEⅡb-2B gene.

[0083] 1. Tag Development

[0084] The partial sequence of SBEIIb gene on the chromosome 2B of Chinese Spring (IWGSC RefSeq v2.1) (nucleotide sequence SEQ ID NO. 9 is: 5'-CACACTTTTCCAACCACCTTCTGTTTGTTAGTGTGTGCACAATGTTACCCATCTC[C / T]CAAGCTTCATCGTTTCCTCTGTTTAGAATAAAAGGTTGCAATTCATGTTTCAGATACAAGATGCTCCACATCAATAACCAGAACACGAAACCAA-3') is used as a reference sequence, and at the SNP mutation site C / T, a plurality of KASP primers are designed by using Primer Premier 5 software, each group of primers comprising two forward competitive primers and one reverse universal primer, and the primer sequence specificity is detected by using the WheatOmics database. After multiple primer detection and screening, the KASP-b2B molecular marker with good amplification effect and strong specificity is finally obtained, comprising primers KASP-b2B-FAM, KASP-b2B-HEX and KASP-b2B-R, and the nucleotide sequences are shown as SEQ ID NO. 10-12 (the underlined part is the sequence of the fluorescent group):

[0085] SEQ ID NO. 10: 5'- GAAGGTGACCAAGTTCATGCT TGCACAATGTTACCCATCTCC-3';

[0086] SEQ ID NO. 11: 5'- GAAGGTCGGAGTCAACGGATT TGCACAATGTTACCCATCTCT-3';

[0087] SEQ ID NO. 12: 5'-GTATCTGAAACATGAATTGCAACC-3'.

[0088] The primers are sent to Beijing Lihe Huada Gene Technology Co., Ltd. for primer synthesis.

[0089] 2. Verification of KASP marker genotyping effect

[0090] The SNP types of Chinese Spring, Fielder, dwarf resistant 58, Zhoumai 16, Beijing 8, Jimai 22 and mutant Cadenza1648 are reversely detected by using the developed KASP-b2B molecular marker, and the results need to meet: the KASP primer has good specificity and strong amplification, the clustering result is clear and distinguishable, and the genotyping data is completely consistent with the known genotype, which indicates that the KASP marker development is successful, and can be further applied to high-throughput detection of large-scale breeding materials and molecular marker assisted breeding. The specific method is as follows:

[0091] (1) DNA extraction

[0092] Seven wheat varieties, Cadenza1648, Chinese Spring, Fielder, Zhongmai 16, Beijing 8, and Jimai 22, were used as materials. Two to ten samples were selected from each material to extract the genomic DNA of the wheat seedling leaves. The DNA concentration and purity were detected using a micro- visible / ultraviolet spectrophotometer (NanoDrop 2000). The OD 260 / 280 ratio between 1.7 and 2.2 indicated high-quality DNA, which was diluted to 50 ng / μL template for standby;

[0093] (2) Preparation of PCR amplification reaction system

[0094] The PCR amplification system was prepared (10 μL): 50 ng / μL DNA template 1 μL, 2× KASP Master Mix 5 μL, KASP Assay Mix 1.4 μL, and ddH2O to 10 μL. The KASP Assay Mix system was prepared (100 μL) as follows: KASP-b2B-FAM primer 12 μL, KASP-b2B-HEX primer 12 μL, KASP-b2B-R primer 30 μL, and ddH2O to 100 μL. The concentration of each primer was 10 μM.

[0095] (3) Fluorescent quantitative PCR amplification of the test genomic DNA

[0096] The prepared PCR system was subjected to fluorescent quantitative PCR amplification using an ABI QuantStudio 6 real-time fluorescent quantitative PCR instrument. The PCR amplification reaction program was as follows: 95℃ heat activation for 15 min; 95℃ denaturation for 20 s, 61-55℃ annealing and extension for 40 s (10 Touch-down cycles, each cycle decreased by 0.6℃); 95℃ denaturation for 20 s, 55℃ annealing and extension for 40 s, 34 cycles; 25℃ incubation for 30 s, and fluorescence signal collection.

[0097] (4) Typing result determination

[0098] The typing results were as follows: Figure 1As shown in FIG. C, the fluorescence signal value of Cadenza1648 material is aggregated in the sample close to the X axis, which shows red color (allele type connected with HEX fluorescent group linker), and the genotype of the molecular marker KASP-b2B is mutant TT; the fluorescence signal value of Zhongnongchun, Fielder, Aikang 58, Zhoumai 16, Beijing 8 and Jimai 22 and other six wild type materials is aggregated in the sample close to the Y axis, which shows blue color (allele type connected with FAM fluorescent group linker), and the genotype of the molecular marker KASP-b2B is wild type CC.

[0099] It is determined that the amylose content of Cadenza1648 mutant whole grain flour is 16.7%, which is increased by 36.5% compared with Cadenza wild type (the amylose content of Cadenza wild type is 12.3%). The KASP-b2B marker developed in the application has good genotyping results, clear genotype definition and high resolution; and the genotyping results of the marker on the mutant Cadenza1648 and the wild type material are completely consistent, which indicates that the KASP marker is successfully developed and can be further applied to high-throughput detection of large-scale breeding materials and molecular marker assisted breeding.

[0100] Example 4: Obtaining of KASP-b2D molecular marker closely linked to gene SBEIIb-2D and verification of genotyping effect

[0101] 1. Marker development

[0102] Taking part of the sequence (nucleotide sequence SEQ ID NO. 13 is: 5'-TAAAAGACTTGGATACAATGCAGTG[C / T]AAATAATGGCAATCCAAGAGCACTCATACTATGGAAGCTTTGGGTAGTTCTCTGGGTCGATTTCTGGTTCTTTTAGTTATCTTTTGTCCATAGAACATATTTCAACTT-3') of SBEIIb gene on Chr2D chromosome of Zhongnongchun (IWGSC RefSeq v2.1) as a reference sequence, at SNP mutation site C / T, a plurality of KASP primers were designed by using Primer Premier software 5, each primer group including two forward competitive primers and one reverse universal primer, and the primer sequence specificity was detected by using WheatOmics database. After multiple primer detection and screening, a KASP-b2D molecular marker with good amplification effect and strong specificity was finally obtained, including primers KASP-b2D-FAM, KASP-b2D-HEX and KASP-b2D-R, and the nucleotide sequences are shown in SEQ ID NO. 14-16 (the underlined part is the sequence of the fluorescent group):

[0103] SEQ ID NO. 14: 5'- AAAAGACTTGGATACAATGCAGTGC-3'; GAAGGTGACCAAGTTCATGCT AAAAGACTTGGATACAATGCAGTGC-3';

[0104] SEQ ID NO. 15: 5'- TAAAAGACTTGGATACAATGCAGTGT-3'; GAAGGTCGGAGTCAACGGATT TAAAAGACTTGGATACAATGCAGTGT-3';

[0105] SEQ ID NO. 16: 5'- AAGTTGAAATATGTTCTATGGACAAAAG-3'.

[0106] The primers were sent to Beijing Huada Gene Technology Co., Ltd. for primer synthesis.

[0107] 2. KASP marker typing effect verification

[0108] The SNP types in the sequenced wheat varieties Chinese Spring, Fielder, Zhongmai 16, Beijng 8, Jimai 22 and mutant Cadenza1800 were reversely detected by the developed KASP-b2D molecular marker. The results need to meet the following conditions: good KASP primer specificity, strong amplification, clear clustering results and complete consistency between the typing data and the known genotype, which indicates that the KASP marker development is successful and can be further applied to high-throughput detection of large-scale breeding materials and molecular marker assisted breeding. The specific method is as follows:

[0109] (1) DNA extraction

[0110] Seven wheat varieties Cadenza1800, Chinese Spring, Fielder, Zhongmai 16, Beijng 8, Jimai 22 and Zhongdan 58 were used as materials, 2-10 samples were selected from each material, the genomic DNA of the wheat seedling leaves was extracted, the DNA concentration and purity were detected by micro visible / ultraviolet spectrophotometer (NanoDrop 2000), and the OD 260 / 280 ratio between 1.7 and 2.2 proved that the DNA quality was high, and it was diluted to 50 ng / μL template for standby;

[0111] (2) Preparation of PCR amplification reaction system

[0112] PCR amplification system preparation (10 μL): 50 ng / μL DNA template 1 μL, 2× KASP Master Mix 5 μL, KASP Assay Mix 1.4 μL, supplemented with ddH2O to a total of 10 μL; wherein the KASP Assay Mix system is prepared (100 μL) as follows: take the KASP-b2D molecular marker corresponding KASP-b2D-FAM primer 12 μL, KASP-b2D-HEX primer 12 μL, KASP-b2D-R primer 30 μL, and supplement ddH2O to 100 μL, the concentration of each primer is 10 μM.

[0113] (3) Fluorescent quantitative PCR amplification of the test genomic DNA

[0114] Using the ABI QuantStudio 6 real-time fluorescent quantitative PCR instrument, the above prepared PCR system is subjected to fluorescent quantitative PCR amplification, and the PCR amplification reaction program is as follows: 95℃ heat activation for 15 min; 95℃ denaturation for 20 s, 61-55℃ annealing and extension for 40 s (10 Touch-down cycles, each cycle decreasing by 0.6℃); 95℃ denaturation for 20 s, 55℃ annealing and extension for 40 s, 34 cycles; 25℃ incubation for 30 s, and fluorescence signal acquisition.

[0115] (4) Typing result determination

[0116] The typing result is shown in Table 1. Figure 1 The fluorescence signal value of the Cadenza1800 material is aggregated in the sample close to the X axis, showing red (the allele genotype connected with the HEX fluorescent group linker), and the genotype of the KASP-b2D molecular marker is the mutant TT; the fluorescence signal value of the six wild-type materials of Zhongdongong, Fielder, Aikang 58, Zhoumai 16, Beijing 8, and Jimai 22 is aggregated in the sample close to the Y axis, showing blue (the allele genotype connected with the FAM fluorescent group linker), and the genotype of the KASP-b2D molecular marker is the wild-type CC.

[0117] It is determined that the amylose content of the Cadenza1800 mutant whole grain flour is 14.8%, which is increased by 20.5% compared with the Cadenza wild type (the amylose content of the Cadenza wild type is 12.3%). The KASP-b2D marker developed in the application has good typing results, clear genotype definition, and high resolution; and the typing results of the marker on the mutant Cadenza1800 and the wild-type material are completely consistent, which indicates that the KASP marker development is successful, and can be further applied to high-throughput detection of large-scale breeding materials and molecular marker assisted breeding.

[0118] Application of KASP molecular marker system closely linked to wheat starch branching enzyme gene SBEIIa and / or SBEIIb in Embodiment 5

[0119] Using the molecular markers of Embodiments 2-4, a high amylose material with mutations at SBEIIb-2A, SBEIIb-2B and SBEIIb-2D three loci was created through molecular marker assisted selection. First, the mutant Cadenza1644 and Cadenza1648 were crossed to obtain F1 seeds, and 20 F2 seeds were obtained after sowing. Using the KASP-b2A and KASP-b2B molecular markers of Embodiments 2 and 3 for assisted selection, 1 strain of SBEIIb-2A x SBEIIb-2B homozygous mutant seeds was identified. Then, it was crossed with Cadenza1800 material to obtain F1 seeds, and 220 F2 seeds were obtained after sowing. Using the KASP-b2A, KASP-b2B and KASP-b2D molecular markers of Embodiments 2-4 for assisted selection, 5 strains of SBEIIb-2A x SBEIIb-2B x SBEIIb-2D homozygous mutant seeds were identified. After propagation, the amylose content in the whole grain flour was determined, and the amylose content of the three mutant materials was 17.2%, which was about 40% higher than that of the wild type (the amylose content of Cadenza wild type was 12.3%).

[0120] The above-described embodiments are only to describe the preferred modes of the present application, and do not limit the scope of the present application. Without departing from the design spirit of the present application, various modifications and improvements to the technical solutions of the present application made by those of ordinary skill in the art shall fall within the protection scope determined by the claims of the present application.

Claims

1. A KASP molecular marker significantly correlated with wheat amylose content, characterized in that, The KASP molecular marker is at least one of KASP-a2B, KASP-b2A, KASP-b2B, and KASP-b2D; The molecular marker KASP-a2B is located at 100 bp in the nucleotide sequence shown in SEQ ID NO.1, and the base is G or A; The molecular marker KASP-b2A is located at 88 bp of the nucleotide sequence shown in SEQ ID NO.5, and the base is C or T; The molecular marker KASP-b2B is located at 56 bp of the nucleotide sequence shown in SEQ ID NO.9, and the base is C or T; The molecular marker KASP-b2D is located at 26 bp of the nucleotide sequence shown in SEQ ID NO.13, and the base is C or T.

2. A KASP primer set for identifying the amylose content trait in wheat, characterized in that, It includes two forward primers and one reverse universal primer; The nucleotide sequences of the two forward primers for detecting the KASP-a2B molecular marker as described in claim 1 are shown in SEQ ID NO. 2-3, and the nucleotide sequence of the one reverse universal primer is shown in SEQ ID NO. 4; The nucleotide sequences of the two forward primers for detecting the KASP-b2A molecular marker as described in claim 1 are shown in SEQ ID NO. 6-7, and the nucleotide sequence of the one reverse universal primer is shown in SEQ ID NO. 8; The nucleotide sequences of the two forward primers for detecting the KASP-b2B molecular marker as described in claim 1 are shown in SEQ ID NO. 10-11, and the nucleotide sequence of the one reverse universal primer is shown in SEQ ID NO. 12; The nucleotide sequences of the two forward primers for detecting the KASP-b2D molecular marker as described in claim 1 are shown in SEQ ID NO. 14-15, and the nucleotide sequence of the one reverse universal primer is shown in SEQ ID NO.

16.

3. The application of the KASP primer set as described in claim 2 in the preparation of products for identifying the amylose content trait in wheat.

4. The application according to claim 3, characterized in that, The product in question is a reagent kit.

5. A product for identifying the amylose content of wheat, characterized in that, The product includes the KASP primer set as described in claim 2.

6. The product according to claim 5, characterized in that, The product in question is a reagent kit.

7. The application of a KASP molecular marker as described in claim 1, or a KASP primer set as described in claim 2, or a product as described in any one of claims 5-6, in identifying the amylose content trait in wheat.

8. A method for identifying wheat with high amylose content, characterized in that, Includes the following steps: DNA was extracted from the wheat to be tested, and quantitative real-time PCR amplification was performed using the KASP primer set described in claim 2 to obtain the genotype of the wheat to be tested. The amylose content of the wheat to be tested was determined based on the genotype. If the AA type is identified using the primer set corresponding to the KASP-a2B molecular marker, then the amylose content of the wheat being tested is high. If the TT type is identified using the primer set corresponding to the KASP-b2A molecular marker, then the amylose content of the wheat being tested is high. If the TT type is identified using the primer set corresponding to the KASP-b2B molecular marker, then the amylose content of the wheat being tested is high. If the TT type is identified using the primer set corresponding to the KASP-b2D molecular marker, then the amylose content of the wheat being tested is high.

9. The method according to claim 8, characterized in that, The PCR amplification reaction system is as follows: 5 μL of 2× KASPMaster Mix, 1.4 μL of KASP Assay Mix, 1 μL of 20-200 ng / μL DNA template, and ddH2O added to 10 μL; wherein, the KASP Assay Mix contains two forward primers and one reverse universal primer corresponding to each molecular marker.

10. The method according to claim 8, characterized in that, The PCR amplification reaction program is as follows: 95℃ thermal activation for 15 min; 95℃ denaturation for 20 s, annealing and extension at 61-55℃ for 40 s, 10 touch-down cycles, decreasing the temperature by 0.6℃ each cycle; 95℃ denaturation for 20 s, annealing and extension at 55℃ for 40 s, 34 cycles.

Images