Primer probe combination for detecting multiple lactococcus and application thereof
By designing specific primer-probe combinations and combining them with fluorescent PCR technology, rapid and accurate detection of Lactobacillus casei, Lactobacillus paracasei, and Lactobacillus rhamnosus was achieved, solving the problem of multiple detection in existing technologies and improving detection efficiency and sensitivity.
Patent Information
- Application Number
- CN202511820862.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-05
- Publication Date
- 2026-05-26
- Estimated Expiration
- 2045-12-05
AI Technical Summary
Existing detection methods are insufficient for rapid and accurate multiple detection of Lactobacillus casei, Lactobacillus paracasei, and Lactobacillus rhamnosus. Furthermore, traditional methods are cumbersome and time-consuming, making it difficult to meet the needs of large-scale probiotic product quality screening and gut microbiota research.
A primer-probe combination was designed, including primer-probe combinations for Lactobacillus casei, Lactobacillus paracasei, and Lactobacillus rhamnosus for singleton PCR detection, and a combination for tripleton PCR detection. The combination enables rapid and accurate detection using fluorescent PCR technology and utilizes specific primers and probes to specifically identify the genome sequence of the target strain.
It achieves sensitive, specific and efficient detection of Lactobacillus casei, Lactobacillus paracasei and Lactobacillus rhamnosus, with a limit of detection of 0.001 ng/μL for single detection and 0.01 ng/μL for triple detection, reducing detection costs and improving detection efficiency.
Smart Images

Figure CN121344226B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to a primer-probe combination for detecting various types of Lactobacillus and its application. Background Technology
[0002] In April 2020, scientists completed a significant taxonomic shift in the genus *Lactobacillus* through analysis of a large amount of published whole-genome data. The genus was reclassified into 25 genera, including 23 new genera, with *Lactobacillus casei* being one of them. Currently, there are 35 species in the *Lactobacillus* genus. Among them, *Lactobacillus casei*, *Lactobacillus paracasei*, and *Lactobacillus rhamnosus* are three of the most studied and widely used important probiotics. They can regulate intestinal health by improving diarrhea and constipation and maintaining intestinal flora balance, while also enhancing immunity and alleviating allergy symptoms. *Lactobacillus casei*, *Lactobacillus paracasei*, and *Lactobacillus rhamnosus* have been included in my country's "List of Microbial Strains that Can Be Used in Food".
[0003] However, with in-depth research on bacterial strains, a problem arises: existing national standards cannot meet the detection requirements for *Lactobacillus casei*, *Lactobacillus paracasei*, and *Lactobacillus rhamnosus*. Since *Lactobacillus* is a newly classified genus from *Lactobacillus* based on whole-genome sequence clustering analysis, there is currently no selective culture medium suitable for isolating *Lactobacillus casei* from a large background of bacteria. This significantly increases the difficulty of isolating and identifying *Lactobacillus casei* using traditional detection methods. Furthermore, even with purified cultures of *Lactobacillus casei*, traditional detection techniques, such as morphological observation and physiological and biochemical identification, suffer from drawbacks such as cumbersome operation, long processing times, low accuracy in species differentiation, and difficulty in interpreting results. Existing molecular biology detection techniques, such as conventional PCR, while possessing high sensitivity, are less specific than probe-based fluorescent PCR methods, and the amplified products require electrophoresis detection, making the operation relatively cumbersome. Digital PCR has not yet been widely adopted due to the cost of its equipment and reagents. Furthermore, most existing detection methods are for single-species detection, and methods for rapid and accurate multiplex detection of *Lactobacillus casei*, *Lactobacillus paracasei*, and *Lactobacillus rhamnosus* are relatively rare, making it difficult to meet the demands for high-efficiency, high-throughput detection in practical applications. For example, in large-scale probiotic product quality screening or gut microbiota studies, detecting only one species at a time is inefficient and increases detection costs and time. Therefore, developing a primer-probe combination that can accurately, rapidly, and efficiently detect *Lactobacillus casei*, *Lactobacillus paracasei*, and *Lactobacillus rhamnosus*, and that can perform both single-species and multiplex detection, is of significant practical importance. Summary of the Invention
[0004] The purpose of this invention is to provide a primer-probe combination for detecting multiple types of Lactobacillus and its application, thereby addressing the problems existing in the prior art. This invention provides a primer-probe combination for *Lactobacillus casei*, *Lactobacillus paracasei*, and *Lactobacillus rhamnosus*, which can be used for both singleton and multiplex PCR detection. This combination can accurately detect these bacteria, enabling the identification of genuine and counterfeit products containing Lactobacillus. This invention provides a more convenient method for detecting *Lactobacillus casei*, *Lactobacillus paracasei*, and *Lactobacillus rhamnosus*.
[0005] To achieve the above objectives, the present invention provides the following solution:
[0006] This invention provides a primer-probe combination for detecting multiple types of Lactobacillus, the primer-probe combination including a primer-probe combination for detecting Lactobacillus casei, a primer-probe combination for detecting Lactobacillus paracasei, and a primer-probe combination for detecting Lactobacillus rhamnosus.
[0007] The primer-probe combination for detecting Lactobacillus casei consists of an upstream primer as shown in SEQ ID NO.1, a downstream primer as shown in SEQ ID NO.2, and a probe as shown in SEQ ID NO.3;
[0008] The primer-probe combination for detecting Lactobacillus paracasei consists of an upstream primer as shown in SEQ ID NO.5, a downstream primer as shown in SEQ ID NO.6, and a probe as shown in SEQ ID NO.7;
[0009] The primer-probe combination for detecting Lactobacillus rhamnosus consists of an upstream primer as shown in SEQ ID NO. 9, a downstream primer as shown in SEQ ID NO. 10, and a probe as shown in SEQ ID NO. 11.
[0010] The present invention also provides the application of the above primer-probe combination in the preparation of a single detection kit for Lactobacillus casei, Lactobacillus paracasei, or Lactobacillus rhamnosus.
[0011] The present invention also provides a single detection kit for Lactobacillus casei, Lactobacillus paracasei, and Lactobacillus rhamnosus, wherein the single detection kit for detecting Lactobacillus casei contains the above-mentioned primer-probe combination for detecting Lactobacillus casei.
[0012] The single detection kit is used to detect Lactobacillus paracasei, and contains the above-mentioned primer and probe combination for detecting Lactobacillus paracasei.
[0013] The single detection kit is used to detect Lactobacillus rhamnosus, and contains the primer-probe combination for detecting Lactobacillus rhamnosus as described above.
[0014] This invention also provides a single-detection method for *Lactobacillus casei*, *Lactobacillus paracasei*, or *Lactobacillus rhamnosus* for non-diagnostic purposes, comprising the following steps:
[0015] Genomic DNA was extracted from the sample to be tested, and fluorescent PCR was performed using the genomic DNA as a template with the above-mentioned single detection kit.
[0016] If the sample to be tested is detected using the primer and probe combination for detecting Lactobacillus casei, and an amplification curve is observed with a Ct value ≤ 25, then Lactobacillus casei is determined to be present in the sample to be tested; if no amplification curve is observed, or the Ct value is ≥ 30, then Lactobacillus casei is determined not to be detected in the sample to be tested.
[0017] If the sample to be tested is detected using the primer and probe combination for detecting Lactobacillus paracasei, and an amplification curve is observed with a Ct value ≤ 25, then Lactobacillus paracasei is determined to be present in the sample to be tested; if no amplification curve is observed, or the Ct value is ≥ 30, then Lactobacillus paracasei is determined not to be detected in the sample to be tested.
[0018] If the sample to be tested is detected using the primer and probe combination for detecting Lactobacillus rhamnosus, and there is an amplification curve and the Ct value is ≤25, then it is determined that Lactobacillus rhamnosus is present in the sample to be tested; if there is no amplification curve, or the Ct value is ≥30, then it is determined that Lactobacillus rhamnosus is not detected in the sample to be tested.
[0019] If the sample to be tested has an amplification curve, but 25 < Ct value < 30, it is determined to be an uncertain sample, and the sample extraction amount needs to be increased to retest the sample.
[0020] Furthermore, the reaction system for the fluorescent PCR detection is as follows: 10 μL of 2×PCR Mix, 1 μL each of upstream and downstream primers, 0.5 μL of probe, 1 μL of DNA template, and ddH2O to bring the total to 20 μL.
[0021] The reaction conditions for the fluorescence PCR detection were: 95℃ hot start for 10 min; 95℃ denaturation for 10 s; 60℃ annealing / extension for 30 s, for a total of 35 cycles.
[0022] The present invention also provides the application of the above primer-probe combination in the preparation of a triple detection kit for Lactobacillus casei, Lactobacillus paracasei, and Lactobacillus rhamnosus, wherein the probe for detecting Lactobacillus casei is supplemented with a Cy5 fluorescent group; the probe for detecting Lactobacillus paracasei is supplemented with a FAM fluorescent group; and the probe for detecting Lactobacillus rhamnosus is supplemented with a VIC fluorescent group.
[0023] The present invention also provides a triple detection kit for Lactobacillus casei, Lactobacillus paracasei, and Lactobacillus rhamnosus, wherein the triple detection kit contains the above-mentioned primer-probe combination; and the probe for detecting Lactobacillus casei is supplemented with a Cy5 fluorescent group; the probe for detecting Lactobacillus paracasei is supplemented with a FAM fluorescent group; and the probe for detecting Lactobacillus rhamnosus is supplemented with a VIC fluorescent group.
[0024] This invention also provides a triple detection method for *Lactobacillus casei*, *Lactobacillus paracasei*, and *Lactobacillus rhamnosus* for non-diagnostic purposes, comprising the following steps:
[0025] Genomic DNA was extracted from the sample to be tested, and fluorescent PCR was performed using the genomic DNA as a template with the above-mentioned triple detection kit.
[0026] If the sample to be tested has an amplification curve in the Cy5 detection channel and the Ct value is ≤25, it is determined that *Lactobacillus casei* is present in the sample. If the sample to be tested has an amplification curve in the FAM detection channel and the Ct value is ≤25, it is determined that *Lactobacillus paracasei* is present in the sample. If the sample to be tested has an amplification curve in the VIC detection channel and the Ct value is ≤25, it is determined that *Lactobacillus rhamnosus* is present in the sample. If the sample to be tested has an amplification curve in the corresponding fluorescence detection channel, but 25 < Ct value < 30, it is determined to be an uncertain sample, and the sample extraction amount needs to be increased to retest the sample.
[0027] Furthermore, the reaction system for the fluorescent PCR detection is as follows: 10 μL of 2×PCR Mix, 1 μL each of upstream and downstream primers, 0.5 μL each of probes, 1 μL of DNA template, and ddH2O to bring the total to 20 μL.
[0028] The reaction conditions for the fluorescence PCR detection were: 95℃ hot start for 10 min; 95℃ denaturation for 10 s; 60℃ annealing / extension for 30 s, for a total of 35 cycles.
[0029] The present invention also provides the application of the above-mentioned single detection kit or the above-mentioned triple detection kit in the identification of authenticity of products containing Lactobacillus casei, Lactobacillus paracasei and Lactobacillus rhamnosus.
[0030] The present invention discloses the following technical effects:
[0031] This invention verifies and compares the genomic information of *Lactobacillus casei*, *Lactobacillus paracasei*, and *Lactobacillus rhamnosus* in the NCBI genome database (removing genomic information with 4 incorrect classifications), identifying highly conserved and comprehensive single-copy sequences. Specific primers and probes are designed using these single-copy sequences as target sequences, enabling the accurate identification of *Lactobacillus casei*, *Lactobacillus paracasei*, and *Lactobacillus rhamnosus*.
[0032] The primer-probe combination designed in this invention for *Lactobacillus casei*, *Lactobacillus paracasei*, and *Lactobacillus rhamnosus* can be used for both singleton and tripleton PCR detection, offering high flexibility and allowing for adjustments based on actual needs, thereby reducing detection costs. This primer-probe combination exhibits advantages such as high sensitivity, strong specificity, and rapid detection. In singleton detection, the limit of detection (LOD) for *Lactobacillus casei* reaches 0.001 ng / μL, and the LODs for both *Lactobacillus paracasei* and *Lactobacillus rhamnosus* reach 0.01 ng / μL. In tripleton detection, the LODs for all three species reach 0.01 ng / μL. The primer-probe combination and detection method of this invention have extremely high application value in the development of *Lactobacillus casei*, *Lactobacillus paracasei*, and *Lactobacillus rhamnosus* strains and in the authentication of products containing these strains. Attached Figure Description
[0033] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0034] Figure 1 Figure showing the results of the exclusivity verification of the Lactobacillus casei primer-probe combination;
[0035] Figure 2 Figure showing the results of the exclusivity verification of the Lactobacillus paracasei primer-probe combination;
[0036] Figure 3 Figure showing the results of the exclusivity verification of the Lactobacillus rhamnosus primer-probe combination;
[0037] Figure 4 Figure showing the inclusion validation results of the Lactobacillus casei primer-probe combination;
[0038] Figure 5 Figure showing the inclusion validation results of the Lactobacillus paracasei primer-probe combination;
[0039] Figure 6 Figure showing the inclusion validation results of the Lactobacillus rhamnosus primer-probe combination;
[0040] Figure 7 The graph shows the sensitivity detection results of the Lactobacillus casei primer-probe combination;
[0041] Figure 8 The graph shows the sensitivity detection results of the Lactobacillus paracasei primer-probe combination.
[0042] Figure 9 The graph shows the sensitivity detection results of the Lactobacillus rhamnosus primer-probe combination;
[0043] Figure 10 The graph shows the amplification efficiency detection results of the Lactobacillus casei primer-probe combination;
[0044] Figure 11 The standard curve of the primer-probe combination for Lactobacillus casei shows an amplification efficiency of 93.3% and a slope of -3.493.
[0045] Figure 12 The figure shows the amplification efficiency detection results of the Lactobacillus paracasei primer-probe combination;
[0046] Figure 13 The standard curve for the primer-probe combination of Lactobacillus paracasei shows an amplification efficiency of 94.5% and a slope of -3.463.
[0047] Figure 14 The figure shows the amplification efficiency detection results of the Lactobacillus rhamnosus primer-probe combination;
[0048] Figure 15 The standard curve of the primer-probe combination for Lactobacillus rhamnosus shows an amplification efficiency of 93.2% and a slope of -3.495.
[0049] Figure 16 The graph shows the sensitivity detection results of Lactobacillus casei in the triple PCR detection system of Lactobacillus casei, Lactobacillus paracasei, and Lactobacillus rhamnosus.
[0050] Figure 17 The graph shows the sensitivity detection results of Lactobacillus paracasei in the triple PCR detection system of Lactobacillus casei, Lactobacillus paracasei, and Lactobacillus rhamnosus.
[0051] Figure 18 The graph shows the sensitivity detection results of Lactobacillus rhamnosus in the triple PCR detection system of Lactobacillus casei, Lactobacillus paracasei, and Lactobacillus rhamnosus.
[0052] Figure 19The figure shows the amplification efficiency of Lactobacillus casei in the triple PCR detection system of Lactobacillus casei, Lactobacillus paracasei, and Lactobacillus rhamnosus.
[0053] Figure 20 The standard curve for Lactobacillus casei in a triple PCR detection system of Lactobacillus casei, Lactobacillus paracasei, and Lactobacillus rhamnosus is shown; the amplification efficiency is 94.3% and the slope is -3.466.
[0054] Figure 21 The figure shows the amplification efficiency of Lactobacillus paracasei in the triple PCR detection system of Lactobacillus casei, Lactobacillus paracasei, and Lactobacillus rhamnosus.
[0055] Figure 22 The standard curve for Lactobacillus paracasei in a triple PCR detection system of Lactobacillus casei, Lactobacillus paracasei, and Lactobacillus rhamnosus is shown; the amplification efficiency is 99.6% and the slope is -3.333.
[0056] Figure 23 The figure shows the amplification efficiency of Lactobacillus rhamnosus in the triple PCR detection system of Lactobacillus casei, Lactobacillus paracasei, and Lactobacillus rhamnosus.
[0057] Figure 24 The standard curve of Lactobacillus rhamnosus in the triple PCR detection system of Lactobacillus casei, Lactobacillus paracasei, and Lactobacillus rhamnosus is shown; the amplification efficiency is 98.1% and the slope is -3.368. Detailed Implementation
[0058] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0059] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0060] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0061] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0062] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0063] Example 1: Design of Specific Primers and Probes
[0064] Based on the verified complete genome sequence of the target bacterial species (four out of seven complete genome sequences of *Lactobacillus casei* were identified as non-*Lactobacillus casei*, thus removing four erroneous genome sequences), specific sequences were screened using multiple bioinformatics tools. First, complete genome sequences of multiple strains of the target bacterial species and reference genome sequences of closely related species were downloaded from the NCBI database. Then, the complete genomes of multiple strains of the target bacterial species were aligned using Mauve software to extract conserved core blocks. To further screen for specific regions of the target bacterial species, a BLAST+local alignment method was used to align the segmented core blocks with a database constructed from the genomes of non-target bacterial species. Strict filtering thresholds were set during the alignment process, retaining only single-copy fragments not appearing in the non-target database as candidate specific sequences. Finally, statistical analysis and coverage evaluation were performed on the candidate fragments to select specific sequences with high coverage. For each target bacterial species, 2-5 single-copy specific sequences with high coverage were selected as target sequences. Primers and probes were designed using Primer 3.0 software, and the specificity and amplification efficiency of the primers and probes were tested using a standard strain of *Lactobacillus casei*. The primer and probe screening results are shown below:
[0065] The specific primers and probes (5'-3') for Lactobacillus casei are as follows:
[0066] Upstream primer L. Casei-F: AAAAGGTCTCGGCTAATCGTCA, SEQ ID NO.1;
[0067] Downstream primer L. casei-R: CGTCATATAGATCGCGCAAAGCAA, SEQ ID NO.2;
[0068] Fluorescent probe L. casei-P: TCCAAGCGCCAACCAGTCCTGCTC, SEQ ID NO.3.
[0069] The primer and probe for Lactobacillus casei target the following target sequence:
[0070] GGATTAATACTTCATATACCAATAGTACCTTATTTGCTTACGTACATCTATTGTCTTTAGAAAATCAATCACTTGTTGTACTGTTTCACTTGACCCATATATGCGTCCGGTTTGAAATCTAAGAAGTACTTTTAACGCATGAATATCCAGGAAAGGTTTGTTTTACGACGCCTTTTGACCTAATCGTTTAAGTGTAGCAATATCAATGAACTCCAAATCAGGTTCTTCACGTTGGTGGAACTAAATCAGGCCGTCTGGTCAAAGTTACGGGACTTCACTCAGACGATGATCGAAAAGTATCGCAAAAAGGTCTCGGCTAATCGTCAAGAGCAGGACTGGTTGGCGCTTGGACTTGAGTTATCACGGCAACAGATCACCAACTGGCACATCTTAGCATGCGACTTTGCTTTGCGCGATCTATATGACGTCATGCATGAAGCGCTGCTTAAACAGGATGTCATCCACGCCGATGAAACACCTTACAACGTCTTGGACAGTGAAAAGAGCAAAACCTACTTCTGGGTCTTCACTTCCAGTAAGGCATCGCCGGAGAAAGTCGTCCTTTATGAGCATGCGAATTCTCGCCAGTTCGCCGTTCCGGAGCGATTCCTCCGCGGCTACACCGGCTATCTCCAGACAGATGGATACGCTGCTTACGCCAAGCTGCCAGATGTCACGCGCGTAGCGTGCCTCGCCCAAATTCGCCGGAAATTTTTTGAAGCGATGGGTAAGCAAGGCATCGCCAAGAGCG, SEQ ID NO.4.
[0071] The specific primers and probes (5'-3') for *Lactobacillus paracasei* are as follows:
[0072] Upstream primer L. paracasei-F: GGCCATTGCRGTTGTGAT, SEQ ID NO.5; where R represents A or G;
[0073] Downstream primer L. paracasei-R: GCTTTAGYATTGCTTGTAGCTTGT, SEQ ID NO.6; where Y represents C or T;
[0074] Fluorescent probe L. paracasei-P: CCCGGTGCCCGCCTACCTG, SEQ ID NO.7;
[0075] Because different species of *Lactobacillus paracasei* exhibit single-base mutations at certain sites in the amplified fragment, degenerate bases were used at these sites to ensure primer-probe inclusion. Taking GenBank: CP081851.1 as an example, the target sequences for primers and probes of *Lactobacillus paracasei* are as follows:
[0076] , SEQ ID NO.8.
[0077] The specific primers and probes (5'-3') for *Lactobacillus rhamnosus* are as follows:
[0078] Upstream primer L. rhamnosus-F: TTGTCAATGCGCTATCAACGAA, SEQ ID NO.9;
[0079] Downstream primer L. rhamnosus-R: CTTTCATCGGCGTGTTAACCT, SEQ ID NO.10;
[0080] Fluorescent probe L. rhamnosus-P: CCGCCGCGAACAACCGTCACA, SEQ ID NO.11;
[0081] The target sequences for the primers and probes of *Lactobacillus rhamnosus* are:
[0082] GGTGGCGGCTATAAGGTCTCCGGCGGTTTGCATGGTGTCGGCGCTTCGGTTGTCAATGCGCTATCAACGAATCTGGATGTGACGGTTGTTCGCGGCGGCAAGCGGTATTACATCGACTTTGTGCGCGGCAAGGTTAACACGCCGATGAAAGAACTTGGCCCGGCACCGGAGCATGAGCATGGGACCAAGGTCCATTTTCAG, SEQ ID NO. 12.
[0083] Example 2 Construction of a singlet fluorescent PCR reaction system
[0084] Extract DNA from the sample to be tested (using a bacterial genomic DNA extraction kit or other recognized extraction methods with equivalent efficacy) and store at -20°C for later use.
[0085] The total volume of the fluorescent PCR reaction system was 20 μL: 10 μL of 2×PCR Mix, 1 μL each of upstream and downstream primers (10 pmol / μL), 0.5 μL of probe (10 pmol / μL), 1 μL of DNA template, and ddH2O to bring the total volume to 20 μL.
[0086] The fluorescent PCR reaction conditions were: 95℃ hot start for 10 min; 95℃ denaturation for 10 s; 60℃ annealing / extension for 30 s, for a total of 35 cycles.
[0087] Result interpretation: If the sample to be tested shows an amplification curve when detected with a primer probe of a certain type of Lactobacillus and the Ct value is ≤25, then the Lactobacillus species is detected in the sample to be tested; if the sample to be tested does not show an amplification curve when detected with a primer probe of a certain type of Lactobacillus, or the Ct value is ≥30, then the Lactobacillus species is not detected in the sample to be tested; if the sample to be tested shows an amplification curve when detected with a primer probe of a certain type of Lactobacillus, but 25 < Ct value <30, then it is considered an uncertain sample and the sample needs to be retested by increasing the sample extraction amount.
[0088] Example 3: Establishment of a single-color fluorescent PCR detection kit
[0089] This quantitative real-time PCR kit for rapid identification of *Lactobacillus casei*, *Lactobacillus paracasei*, and *Lactobacillus rhamnosus* includes: 2×PCR Mix, primers and probes for *Lactobacillus casei* (100 pmol / μL), primers and probes for *Lactobacillus paracasei* (100 pmol / μL), primers and probes for *Lactobacillus rhamnosus* (100 pmol / μL), a positive control, a negative control, instructions, and the kit itself.
[0090] The positive controls mentioned above were mixtures of plasmids containing specific fragments prepared in equal proportions, with corresponding Ct values ranging from 18 to 21. The plasmid for *Lactobacillus casei* was obtained by cloning the 123 bp fragment sequence (positions 305-427 of SEQ ID NO. 4) corresponding to the synthetic *Lactobacillus casei* primers and probes into the pGM-T vector; the plasmid for *Lactobacillus paracasei* was obtained by cloning the 63 bp fragment sequence (positions 80-142 of SEQ ID NO. 8) corresponding to the synthetic *Lactobacillus paracasei* primers and probes into the pGM-T vector; and the plasmid for *Lactobacillus rhamnosus* was obtained by cloning the 102 bp fragment sequence (positions 50-151 of SEQ ID NO. 12) corresponding to the synthetic *Lactobacillus rhamnosus* primers and probes into the pGM-T vector.
[0091] The negative control mentioned above is Escherichia coli genomic DNA.
[0092] Example 4: Exclusivity Verification of Single-Fluorescence PCR Detection System
[0093] To verify the exclusivity of the fluorescent PCR detection system for *Lactobacillus casei*, *Lactobacillus paracasei*, and *Lactobacillus rhamnosus* constructed in this invention, the genomic DNA of the standard strains shown in Table 1 was used as PCR reaction templates to verify the exclusivity of the fluorescent PCR detection system.
[0094] Table 1. Information on standard strains used for exclusion verification.
[0095]
[0096] The primers and probes for *Lactobacillus casei*, *Lactobacillus paracasei*, and *Lactobacillus rhamnosus* from the kit in Example 3 were used to detect the 36 strains listed in Table 1. The DNA extraction process, PCR reaction system, and reaction conditions were the same as in Example 2. The results of the exclusion verification for each strain are as follows: Figure 1 , Figure 2 and Figure 3 As shown, where, Figure 1 It is Lactobacillus casei. Figure 2 It is Lactobacillus paracasei. Figure 3 The target strain was *Lactobacillus rhamnosus*. It was observed that only the target strain showed an amplification curve; non-target strains, the negative control (*Escherichia coli* genomic DNA), and the blank control (water) all showed no amplification curve or had a Ct value ≥30. This result demonstrates that the fluorescent PCR detection system of this invention has excellent exclusivity.
[0097] Example 5: Inclusivity Validation of Single-Fluorescence PCR Detection System
[0098] To verify the inclusiveness of the fluorescent PCR detection system for *Lactobacillus casei*, *Lactobacillus paracasei*, and *Lactobacillus rhamnosus* constructed in this invention, the genomic DNA of the standard strains and industrial production strains shown in Tables 2-4 were used as PCR reaction templates to verify the inclusiveness of the fluorescent PCR detection system.
[0099] Table 2. Information on Lactobacillus casei strains used for inclusion validation and validation results.
[0100]
[0101] Table 3. Information on Lactobacillus paracasei strains used for inclusion validation and validation results.
[0102]
[0103] Table 4. Information on Lactobacillus rhamnosus strains used for inclusion validation and validation results.
[0104]
[0105] The strains listed in Table 2 were detected using primers and probes for *Lactobacillus casei*, *Lactobacillus paracasei*, and *Lactobacillus rhamnosus* from the kit in Example 3. The DNA extraction process, PCR reaction system, and reaction conditions were the same as in Example 2. The inclusion verification results for each strain are as follows: Figures 4-6 As shown in Tables 2-4, Figure 4 It is Lactobacillus casei. Figure 5 It is Lactobacillus paracasei. Figure 6 The target strain was *Lactobacillus rhamnosus*. All strains of the corresponding target species showed amplification curves, while non-target strains, negative controls (*Escherichia coli* genomic DNA), and blank controls (water) showed no amplification curves. This result indicates that the fluorescent PCR detection system of this invention has excellent compatibility.
[0106] Example 6 Sensitivity Detection of Single-Fluorescence PCR Detection System
[0107] Genomic DNA from *Lactobacillus casei*, *Lactobacillus paracasei*, and *Lactobacillus rhamnosus* (described in Table 1) was collected, and its concentration was determined using Nanodrop. The DNA was then serially diluted 10-fold, with 1.0 × 10⁻⁶ DNA samples taken. 0 -1.0×10 -5 DNA at a concentration of ng / μL was used as a PCR template, and the assay was performed using the kit in Example 3 and the method in Example 2.
[0108] The results are as follows Figures 7-9As shown in Tables 5-7, the minimum detectable concentration (MRC) of this kit for *Lactobacillus casei* is 0.001 ng / μL, and the MRC for both *Lactobacillus paracasei* and *Lactobacillus rhamnosus* is 0.01 ng / μL.
[0109] Table 5. Ct values of Lactobacillus casei primer-probe combinations
[0110]
[0111] Table 6. Ct values of Lactobacillus paracasei primer-probe combinations
[0112]
[0113] Table 7. Ct values of Lactobacillus rhamnosus primer-probe combinations
[0114]
[0115] Example 7: Detection of amplification efficiency in a single-color fluorescent PCR detection system
[0116] Genomic DNA from *Lactobacillus casei*, *Lactobacillus paracasei*, and *Lactobacillus rhamnosus* (described in Table 1) was collected and serially diluted 10-fold. The PCR reaction system and conditions were the same as in Example 2, with each gradient repeated three times. The detection results are shown below. Figure 10 , Figure 12 and Figure 14 The standard curve constructed based on the average Ct value is as follows: Figure 11 , Figure 13 and Figure 15 As shown, the slopes of the standard curves for the three sets of primers and probes were -3.493 for *Lactobacillus casei*, -3.463 for *Lactobacillus paracasei*, and -3.495 for *Lactobacillus rhamnosus*, corresponding to amplification efficiencies of 93.3%, 94.5%, and 93.2%, respectively. The correlation coefficient R0... 2 All values were greater than 0.99. This indicates that, combined with the standard curve of the standard products, the kit and method of the present invention can achieve the quantitative detection of *Lactobacillus casei*, *Lactobacillus paracasei*, and *Lactobacillus rhamnosus*.
[0117] Example 8: Detection of real samples
[0118] Five probiotic solid beverage products purchased from Taobao and JD.com were used as test subjects. The primers and probes of Lactobacillus casei, Lactobacillus paracasei, and Lactobacillus rhamnosus in the kit of Example 3 were used for detection. The DNA extraction process, PCR reaction system and reaction conditions were the same as in Example 2.
[0119] The results are shown in Table 8. This kit can detect 100% of Lactobacillus casei, Lactobacillus paracasei, and Lactobacillus rhamnosus in real samples.
[0120] Table 8. Test results of real samples
[0121]
[0122] Example 9: Establishment of a Triple Fluorescent PCR Detection Kit
[0123] This fluorescent PCR detection kit for rapid identification of *Lactobacillus casei*, *Lactobacillus paracasei*, and *Lactobacillus rhamnosus* includes: 2×PCR Mix, primers and probes for *Lactobacillus casei* (100 pmol / μL), primers and probes for *Lactobacillus paracasei* (100 pmol / μL), primers and probes for *Lactobacillus rhamnosus* (100 pmol / μL), a positive control, a negative control, instructions, and the kit itself.
[0124] The probes of *Lactobacillus casei* have a Cy5 fluorescent group at their 5' end; those of *Lactobacillus paracasei* have a FAM fluorescent group at their 5' end; and those of *Lactobacillus rhamnosus* have a VIC fluorescent group at their 5' end. Positive and negative controls are the same as in Example 3.
[0125] Example 10 Construction of a triplet PCR fluorescent PCR reaction system
[0126] Extract DNA from the sample to be tested (using a bacterial genomic DNA extraction kit or other recognized extraction methods with equivalent efficacy) and store at -20°C for later use.
[0127] The total volume of the fluorescent PCR reaction system was 20 μL: 10 μL of 2×PCR Mix, 1 μL each of forward and reverse primers (10 pmol / μL), 0.5 μL each of probe (10 pmol / μL), 1 μL of sample DNA template, and ddH2O to bring the total volume to 20 μL.
[0128] The fluorescent PCR reaction conditions were: 95℃ for 10 min hot start; 95℃ for 10 s denaturation; 60℃ for 30 s annealing / extension, for a total of 35 cycles.
[0129] Result Interpretation: If the sample shows an amplification curve in the Cy5 detection channel and the Ct value is ≤25, then *Lactobacillus casei* is detected in the sample; if the sample shows an amplification curve in the FAM detection channel and the Ct value is ≤25, then *Lactobacillus paracasei* is detected in the sample; if the sample shows an amplification curve in the VIC detection channel and the Ct value is ≤25, then *Lactobacillus rhamnosus* is detected in the sample; if the sample shows an amplification curve in the corresponding fluorescence detection channel, but 25 < Ct value < 30, then it is considered an uncertain sample, and the sample extraction amount needs to be increased for retesting.
[0130] Example 11 Sensitivity Validation of Triple Fluorescence PCR Detection System
[0131] Genomic DNA from *Lactobacillus casei*, *Lactobacillus paracasei*, and *Lactobacillus rhamnosus* (listed in Table 1) was collected, and their concentrations were determined using Nanodrop to prepare a mixed sample. The template concentrations of *Lactobacillus casei*, *Lactobacillus paracasei*, and *Lactobacillus rhamnosus* in the mixed sample were all 1 ng / μL. The mixed sample was then serially diluted 10-fold, and 1.0 × 10⁻⁶ ng / μL was collected. 0 -1.0×10 -4 DNA at a concentration of ng / μL was used as a PCR template, and the assay was performed using the kit of Example 9 and the method of Example 10.
[0132] The results are shown in Table 9 and Figures 16-18 As shown, the minimum detectable concentration of this kit for *Lactobacillus casei*, *Lactobacillus paracasei*, and *Lactobacillus rhamnosus* is 0.01 ng / μL.
[0133] Table 9 Ct values of the triple PCR detection system
[0134]
[0135] Example 12 Validation of Amplification Efficiency of Triple Fluorescent PCR Detection System
[0136] Genomic DNA from *Lactobacillus casei*, *Lactobacillus paracasei*, and *Lactobacillus rhamnosus* (described in Table 1) was mixed in equal proportions to prepare a pooled sample, which was then serially diluted 10-fold. The PCR reaction system and conditions were the same as in Example 10, with each gradient replicated three times. The detection results are shown below. Figure 19 , Figure 21 and Figure 23 The standard curve constructed based on the average Ct value is as follows: Figure 20 , Figure 22 and Figure 24 As shown, the slopes of the standard curves for the three primer-probe sets were -3.466 for *Lactobacillus casei*, -3.333 for *Lactobacillus paracasei*, and -3.368 for *Lactobacillus rhamnosus*, corresponding to amplification efficiencies of 94.3%, 99.6%, and 98.1%, respectively. The correlation coefficient R0... 2 All values were greater than 0.99. This indicates that, combined with the standard curve of the standard products, the kit and method of the present invention can achieve the quantitative detection of *Lactobacillus casei*, *Lactobacillus paracasei*, and *Lactobacillus rhamnosus*.
[0137] Example 13 Detection of real samples
[0138] Five probiotic solid beverage products purchased from Taobao and JD.com were used as test subjects. The primers and probes of Lactobacillus casei, Lactobacillus paracasei, and Lactobacillus rhamnosus in the kit of Example 9 were used for detection. The DNA extraction process, PCR reaction system and reaction conditions were the same as in Example 10.
[0139] The results are shown in Table 10. This kit can detect 100% of Lactobacillus casei, Lactobacillus paracasei, and Lactobacillus rhamnosus in real samples.
[0140] Table 10 Test results of real samples
[0141]
[0142] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A primer-probe combination for detecting multiple types of Lactobacillus, characterized in that, The primer-probe combination includes methods for detecting Lactobacillus casei (Lactobacillus casei). Lacticaseibacillus casei Primer-probe combination for detecting Lactobacillus paracasei ( Lacticaseibacillus paracasei Primer-probe combination and detection of Lactobacillus rhamnosus (Lactobacillus rhamnosus) Lacticaseibacillus rhamnosus Primer-probe combination; The primer-probe combination for detecting Lactobacillus casei consists of an upstream primer as shown in SEQ ID NO.1, a downstream primer as shown in SEQ ID NO.2, and a probe as shown in SEQ ID NO.3; The primer-probe combination for detecting Lactobacillus paracasei consists of an upstream primer as shown in SEQ ID NO.5, a downstream primer as shown in SEQ ID NO.6, and a probe as shown in SEQ ID NO.7; The primer-probe combination for detecting Lactobacillus rhamnosus consists of an upstream primer as shown in SEQ ID NO. 9, a downstream primer as shown in SEQ ID NO. 10, and a probe as shown in SEQ ID NO.
11.
2. The application of the primer-probe combination according to claim 1 in the preparation of a triple detection kit for *Lactobacillus casei*, *Lactobacillus paracasei*, and *Lactobacillus rhamnosus*, characterized in that... The probe for detecting *Lactobacillus casei* is supplemented with a Cy5 fluorescent group; the probe for detecting *Lactobacillus paracasei* is supplemented with a FAM fluorescent group; and the probe for detecting *Lactobacillus rhamnosus* is supplemented with a VIC fluorescent group.
3. A triple detection kit for Lactobacillus casei, Lactobacillus paracasei, and Lactobacillus rhamnosus, characterized in that, The triple detection kit includes the primer-probe combination of claim 1; and the probe for detecting *Lactobacillus casei* is supplemented with a Cy5 fluorescent group; the probe for detecting *Lactobacillus paracasei* is supplemented with a FAM fluorescent group; and the probe for detecting *Lactobacillus rhamnosus* is supplemented with a VIC fluorescent group.
4. A triple detection method for *Lactobacillus casei*, *Lactobacillus paracasei*, and *Lactobacillus rhamnosus* for non-diagnostic purposes, characterized in that, Includes the following steps: Genomic DNA was extracted from the sample to be tested, and fluorescent PCR was performed using the genomic DNA as a template with the triple detection kit described in claim 3. If the sample to be tested has an amplification curve in the Cy5 detection channel and the Ct value is ≤25, then it is determined that Lactobacillus casei is present in the sample to be tested. If the sample to be tested has an amplification curve in the FAM detection channel and the Ct value is ≤25, then it is determined that Lactobacillus paracasei is present in the sample to be tested. If the sample to be tested has an amplification curve in the VIC detection channel and the Ct value is ≤25, it is determined that Lactobacillus rhamnosus is present in the sample. If the sample to be tested has an amplification curve in the corresponding fluorescence detection channel, but 25 < Ct value <30, it is determined to be an uncertain sample, and the sample extraction amount needs to be increased to retest the sample.
5. The triple detection method according to claim 4, characterized in that, The reaction system for the fluorescent PCR detection is as follows: 10 μL of 2×PCR Mix, 1 μL each of upstream and downstream primers, 0.5 μL each of probes, 1 μL of DNA template, and ddH2O to bring the total to 20 μL. The reaction conditions for the fluorescence PCR detection were: 95℃ hot start for 10 min; 95℃ denaturation for 10 s; 60℃ annealing / extension for 30 s, for a total of 35 cycles.
6. The application of the triple detection kit according to claim 3 in the identification of authenticity of products containing Lactobacillus casei, Lactobacillus paracasei, and Lactobacillus rhamnosus.
Citation Information
Patent Citations
Method for quantitatively detecting viable bacteria of lactobacillus reuteri, lactobacillus rhamnosus, lactobacillus paracasei and lactobacillus acidophilus
CN120366488A
Primer set for identifying bacterial species in probiotics composition and method for identifying bacterial species using same
US20250034658A1