Chitin synthase 1 gene and application thereof in prevention and treatment of diabrotica balteata

By providing the chitin synthase 1 gene and its dsRNA from the two-spotted leaf beetle, transgenic maize was designed, solving the problems of pesticide resistance and environmental pollution caused by chemical pesticide control of the two-spotted leaf beetle, and achieving a highly efficient and environmentally friendly pest control effect.

CN121380133BActive Publication Date: 2026-05-01YAZHOUWAN NATIONAL LABORATORY
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202511972757.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-12-25
Publication Date
2026-05-01
Estimated Expiration
2045-12-25

AI Technical Summary

Technical Problem

In existing technologies, chemical pesticides for controlling the two-spotted leaf beetle have problems with pesticide resistance and pollute the environment, and there is a lack of effective gene interference methods to control this pest.

Method used

The chitin synthase 1 gene and its designed dsRNA of the two-spotted leaf beetle were provided. Expression of the gene through transgenic maize significantly increased the pest mortality rate and reduced the leaf damage area. The gene was stably expressed in plants using recombinant expression vectors and recombinant microorganisms.

Benefits of technology

This method achieves specific control of the two-spotted leaf beetle, reduces the use of chemical pesticides, lowers environmental pollution, avoids toxicity to non-target beneficial insects, and provides a new environmentally friendly control method.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121380133B_ABST
    Figure CN121380133B_ABST
Patent Text Reader

Abstract

This invention discloses a chitin synthase 1 gene and its application in controlling the two-spotted leaf beetle, belonging to the fields of genetic engineering and biological control technology. The nucleotide sequence of the chitin synthase 1 gene is shown in SEQ ID NO.1. This invention also provides a dsRNA for controlling the two-spotted leaf beetle, transcribed from the nucleotide sequence shown in SEQ ID NO.3. This invention discloses for the first time the chitin synthase 1 gene of the two-spotted leaf beetle, and designs a dsRNA based on this gene capable of controlling the two-spotted leaf beetle, as well as transgenic maize expressing the two-spotted leaf beetle dsRNA. Feeding transgenic maize leaves significantly increases the mortality rate of the two-spotted leaf beetle and reduces the area and severity of leaf damage. This invention provides a new genetic resource and an efficient and environmentally friendly control method for the two-spotted leaf beetle, offering a new option for its control and possessing broad application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

A chitin synthase 1 gene and its application in controlling the two-spotted firefly beetle Technical Field

[0001] This invention relates to the fields of genetic engineering and biological control technology, and in particular to a chitin synthase 1 gene and its application in controlling the two-spotted leaf beetle. Background Technology

[0002] The two-spotted leaf beetle, *Monolepta hieroglyphica* (Motschulsky), is a widely distributed polyphagous pest that primarily damages crops such as corn, sorghum, beans, alfalfa, potatoes, peppers, and cotton. Adults feed on leaves, flower spikes, and seeds, while larvae feed on roots, leading to reduced crop yields. In recent years, the population of the two-spotted leaf beetle in northern regions has been increasing annually, its range of occurrence has expanded, and its damage has intensified, making it one of the major pests in northern China. Chemical pesticides are commonly used in agricultural production to control the two-spotted leaf beetle; however, long-term and frequent use of chemical pesticides leads to pesticide resistance, causing severe losses and environmental pollution. Therefore, given the increasingly serious problem of the two-spotted leaf beetle, exploring new control methods is urgently needed.

[0003] RNA interference (RNAi) refers to the phenomenon where exogenous or endogenous double-stranded RNA (dsRNA) specifically induces gene expression silencing. After entering the cell, dsRNA is cleaved by the Dicer enzyme into 21-23 bp small RNA molecules, namely siRNA. Then, under the action of the RNA-induced silencing complex (RISC), the siRNA unwinds into single strands, and the antisense strand specifically binds to homologous target mRNA, ultimately leading to gene expression silencing. Due to its high specificity and low production cost, RNAi has been applied as a novel method in agricultural pest control. For example, Baum et al. (2007) expressed vacuole ATPase gene dsRNA in transgenic maize, resulting in delayed development and increased mortality of root leaf beetles that fed on the transgenic maize.

[0004] Chitin synthase 1 (CHS1) is an insect-specific gene that determines the formation of the insect's cuticle. Insects lacking the chitin synthase 1 gene cannot form a cuticle normally, resulting in developmental defects and increased mortality. However, the effectiveness of RNAi technology varies greatly among different insects. A key factor in using this technology as a control measure against insect infestations is selecting the most appropriate target genes—those whose functional loss leads to severe disruption of essential biological processes and / or organismal death. Currently, there are no reports on the chitin synthase 1 gene in the two-spotted leaf beetle, nor are there any reports of using RNAi technology to interfere with the chitin synthase 1 gene for the control of the two-spotted leaf beetle. Summary of the Invention

[0005] The purpose of this invention is to provide a chitin synthase 1 gene and its application in the control of the two-spotted leaf beetle, thereby addressing the problems existing in the prior art. This invention discloses for the first time the chitin synthase 1 gene of the two-spotted leaf beetle, and based on this gene, designs dsRNA capable of controlling the two-spotted leaf beetle, as well as transgenic maize expressing the two-spotted leaf beetle dsRNA. Feeding transgenic maize leaves significantly increases the mortality rate of the two-spotted leaf beetle and reduces the area and severity of leaf damage. This invention provides a new genetic resource and an efficient and environmentally friendly control method for the two-spotted leaf beetle, offering a new option for its control and possessing broad application prospects.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] This invention provides a chitin synthase 1 gene for the two-spotted leaf beetle, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0008] The present invention also provides a dsRNA for controlling the two-spotted leaf beetle, which is transcribed from the nucleotide sequence shown in SEQ ID NO.3.

[0009] The present invention also provides a recombinant expression vector comprising a DNA fragment transcribed from the above-mentioned dsRNA.

[0010] The present invention also provides a recombinant microorganism comprising the above-described recombinant expression vector.

[0011] The present invention also provides the application of the above-mentioned chitin synthase 1 gene, the above-mentioned recombinant expression vector, or the above-mentioned recombinant microorganism in constructing transgenic plants for preventing and controlling the two-spotted leaf beetle or in cultivating plants resistant to the two-spotted leaf beetle.

[0012] The present invention also provides a method for constructing a transgenic plant for controlling the two-spotted firefly beetle, comprising the step of transforming the above-mentioned recombinant expression vector into a plant to construct a transgenic plant for controlling the two-spotted firefly beetle.

[0013] The present invention also provides a method for cultivating plants resistant to the two-spotted leaf beetle, comprising the steps of transforming the above-mentioned recombinant expression vector into plants, stably expressing it in plants, and cultivating plants resistant to the two-spotted leaf beetle.

[0014] Furthermore, the plant includes corn.

[0015] The present invention also provides the application of the above-mentioned dsRNA, the above-mentioned recombinant expression vector, the above-mentioned recombinant microorganism or the transgenic plant constructed by the above-mentioned construction method in the control of the two-spotted firefly beetle.

[0016] The present invention also provides a method for controlling the two-spotted firefly beetle, comprising the step of feeding the two-spotted firefly beetle with a transgenic plant constructed using the above-described construction method.

[0017] The present invention discloses the following technical effects:

[0018] This invention discloses for the first time the chitin synthase 1 gene of the two-spotted leaf beetle, and designs a dsRNA based on this gene to control the two-spotted leaf beetle, as well as transgenic maize expressing the two-spotted leaf beetle dsRNA. The control effect of this dsRNA on the two-spotted leaf beetle was detected by indoor bioassays. The results showed that the mortality rate of two-spotted leaf beetles fed with transgenic maize leaves was significantly higher than that of non-transgenic maize leaves, and the area of ​​damage on transgenic maize leaves was much smaller than that on non-transgenic maize leaves. This method achieves specific control of the two-spotted leaf beetle, reduces the use of chemical pesticides, lowers environmental pollution, and avoids the toxicity of chemical pesticides to non-target beneficial insects. This invention provides a new genetic resource and an efficient and environmentally friendly control method for the two-spotted leaf beetle, offering a new option for its control and showing broad application prospects. Attached Figure Description

[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0020] Figure 1 is a schematic diagram of the construction of the dsCHS1 vector;

[0021] Figure 2 shows the identification results of dsCHS1 positive maize lines; in which lane M is the marker, lane WT is the wild-type maize line, and lines 1, 2 and 3 in lanes are all dsCHS1 positive maize lines.

[0022] Figure 3 shows the results of indoor bioassays on transgenic maize (dsCHS1) and non-transgenic maize (WT) fed with the two-spotted leaf beetle; where A is the statistical result of the damaged area of ​​leaves on transgenic maize (dsCHS1) and non-transgenic maize (WT); B is the statistical result of the number of damaged parts of leaves on transgenic maize (dsCHS1) and non-transgenic maize (WT); C is the phenotypic diagram of damaged leaves on transgenic maize (dsCHS1) and non-transgenic maize (WT).

[0023] Figure 4 shows the mortality curves of the two-spotted leaf beetle fed with transgenic maize (dsCHS1) and non-transgenic maize (WT). Detailed Implementation

[0024] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0025] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0026] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0027] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0028] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0029] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the instruments and equipment used in the following examples are all conventional laboratory instruments and equipment; unless otherwise specified, the experimental materials used in the following examples were all purchased from conventional biochemical reagent stores.

[0030] Example 1

[0031] 1. Identification of the CHS1 gene in the double-spotted leaf beetle

[0032] The nucleotide sequence of the CHS1 gene of the two-spotted leaf beetle is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2.

[0033] SEQ ID NO.1:

[0034]

[0035] SEQ ID NO.2:

[0036]

[0037] 2. Test insects

[0038] Adult two-spotted leaf beetles were collected from weeds surrounding a cornfield in the experimental field of Inner Mongolia Agricultural University. The rearing conditions were: temperature 27±2℃, relative humidity 75%±10%, and photoperiod 14L:10D.

[0039] 3. RNA extraction

[0040] The collected adult worms were ground with liquid nitrogen, and 50-100 mg of powder was transferred to a 1.5 mL RNase-free centrifuge tube. 1 mL of Trizol was added and the mixture was thoroughly mixed. The collected tissue was then placed in a centrifuge tube, 200 μL of Trizol was added, and the tissue was ground with a plastic grinding rod. After thorough grinding, 800 μL of Trizol was added.

[0041] Incubate at room temperature for 5 min to facilitate complete separation of ribosomes from the homogenized sample. Add 200 μL of chloroform, vortex for 15 s, and let stand at room temperature for 5 min. Then centrifuge at 12000 rpm and 4℃ for 15 min; transfer 400 μL of the supernatant to a new centrifuge tube, add an equal volume of isopropanol, invert to mix thoroughly, let stand at room temperature for 10 min, and centrifuge at 12000 rpm and 4℃ for 10 min; discard the supernatant, add 1 mL of 75% ethanol to wash gently, and then centrifuge at 12000 rpm and 4℃ for 5 min; remove the supernatant, dry the precipitate at room temperature, and dissolve it thoroughly in 50-150 μL of nuclease-free water.

[0042] 4. Synthesis of first-strand cDNA

[0043] First-strand cDNA was synthesized using the TransScript One-step gDNA Removal and cDNA Synthesis SuperMix reverse transcription kit, following its instructions. The reaction mixture was prepared as shown in Table 1, gently mixed, and incubated at 42°C for 15 min; the reverse transcriptase was then inactivated by heating at 85°C for 5 s. After the reaction was complete, the mixture was stored at -80°C.

[0044] Table 1 Reaction System

[0045]

[0046] 5. Preparation of dsCHS1 vector

[0047] The dsCHS1 gene was designed based on the CHS1 gene of the two-spotted leaf beetle. dsCHS1 was transcribed from the fragment shown in SEQ ID NO.3.

[0048] SEQ ID NO.3:

[0049] GGACCAATGGTTTGGTATCAGCTGTTTGAGTACGCTATTGGACATTGGCTACAAAAGGCTACCGAACACGTTATTGGCTGTGTACTTTGTAGTCCCGGTTGTTTCTCTTTGTTTAGAGGAAAGGCCCTTATGGACGACAACGTTATGAAGAAATATACTACATGT TCCGCCGAAGCCAGACATTACGTCCAATACGATCAAGGCGAAGACCGTTGGCTATGCACTCTTCTTCTCCAAAGAGGCTACCGAGTAGAATATTCTGCTGCCTCTGACGCCTACACTCACGCCCCTGAAGGTTTCAACGAGTTCTTCAACCAACGTCGTCGCTG.

[0050] The dsCHS1 vector was prepared using an enzyme digestion and ligation method. A schematic diagram of the dsCHS1 vector is shown in Figure 1. The initial vector was pBWA(V)BU. The specific procedures are as follows:

[0051] 1) Design of primers for target fragment amplification, the specific sequences are shown in Table 2.

[0052] Table 2 Primer Sequences

[0053]

[0054] 2) PCR amplification of the target fragment

[0055] Using cDNA and loop plasmid from the two-spotted leaf beetle as templates, the forward and reverse complementary sequences of the target gene, as well as the loop sequence, were amplified using FastPfu enzyme with primers listed in Table 2. Three 50 μL reaction systems were prepared as shown in Table 3, mixed, briefly centrifuged, and then reacted in a PCR instrument according to the procedure shown in Table 4. After PCR amplification, the electrophoretic fragments of target F (329 bp), loop (200 bp, SEQ ID NO.10), and target R (329 bp) were excised under UV light and placed in a system for sol-gel recovery. The PCR products were recovered according to the Wizard SV Gel and PCR Clean-Up System kit instructions. The recovered DNA was dissolved in 30 μL of water (the recovered product is denoted as L target FR).

[0056] SEQ ID NO.10:

[0057] CCTGCAGGTCTAGTTTTTCTCCTTCATTTTCTTGGTTAGGACCCTTTTCTCTTTTTATTTTTTTGAGCTTTGATCTTTCTTTAAACTGATCTATTTTTTAATTGATTGGTTATGGTGTAAATATTACATAGCTTTAACTGATAATCTGATTACTTTATTTCGTGTGTCTATGATGATGATGATAGTTACAGAGCCCGGGC.

[0058] Table 3 Reaction System

[0059]

[0060] Table 4 Reaction Procedure

[0061]

[0062] 3) Vector enzyme digestion

[0063] Prepare the enzyme digestion system as shown in Table 5, mix well, centrifuge briefly, and then digest at 37°C for 1 hour in a PCR instrument.

[0064] Table 5 Enzyme digestion system

[0065]

[0066] 4) L-target FR enzyme digestion

[0067] Prepare the enzyme digestion system as shown in Table 6, mix well, centrifuge briefly, and then digest at 37°C for 1 hour in a PCR instrument.

[0068] Table 6 Enzyme digestion system

[0069]

[0070] 5) Connection reaction

[0071] Combine the vector digestion product from step 3) and the L target FR digestion product from step 4) in a 1:2 ratio and purify them together using a PCR purification kit. The purified product is denoted as PL target FR.

[0072] Configure the ligation reaction system as shown in Table 7, mix well, briefly centrifuge, and then incubate at 20°C for 1 hour in a PCR instrument. Subsequently, transform the ligation product into competent cells.

[0073] Table 7 Connection Reaction System

[0074]

[0075] 6) Transformation

[0076] Transform 5-10 μL of the ligation product into competent E. coli cells, plate the transformed cells onto Kans resistant plates, incubate at 37°C for 12-15 hours, and then perform plaque PCR identification.

[0077] 7) Plaque PCR identification

[0078] Ten bacterial colonies were selected and simultaneously inoculated into 1.5 mL EP tubes for PCR identification. The primer sequences for PCR identification are shown in Table 8. The reaction system was prepared according to Table 9, mixed well, briefly centrifuged, and then the reaction was carried out in a PCR instrument according to the procedure shown in Table 10.

[0079] Table 8 Primer sequences for PCR identification

[0080]

[0081] Table 9 Reaction System

[0082]

[0083] Table 10 Reaction Procedure

[0084]

[0085] The target band amplified by the PCR primers is a fragment of approximately 700 bp. Take 100 μL of bacterial culture corresponding to 1-3 positive bands for sequencing, and inoculate the remaining 400 μL of bacterial culture into 5-10 mL of Kan-resistant LB. Shake the test tubes and wait for the sequencing results. Take the tube corresponding to the correct sequencing and extract the plasmid.

[0086] 6. dsCHS1 maize conversion

[0087] 1) Plasmid transformation

[0088] Add 1 µL of plasmid to 50 µL of EHA105 Agrobacterium competent cells, mix thoroughly, and then transfer to an electroporation cuvette. After electroporation, add 1 mL of LB liquid medium, mix thoroughly, and then transfer to a 1.5 mL centrifuge tube. Incubate at 30°C and 180 rpm for 30 min on a shaker. Inoculate 50 µL of the activated Agrobacterium culture onto LB solid medium and incubate in the dark at 30°C for 48 hours. Subsequently, colony PCR detection yielded positive Agrobacterium clones.

[0089] 2) Agrobacterium infection and co-culture

[0090] Using "B73 corn" as the recipient material, the Agrobacterium infection method was employed. Corn embryos were infected with Agrobacterium bacterial suspension identified as a positive clone. The infected embryos, along with the bacterial suspension, were then transferred to a co-culture dish, and the suspension was aspirated. The mixture was then co-cultured in a dark incubator at 25°C for 2-3 days.

[0091] 3) Callus induction and screening

[0092] After co-culture, the embryos were inoculated onto induction medium and cultured in the dark at 28°C for 7-10 days. The induced calluses were then inoculated onto selection medium for selection culture and cultured in the dark at 28°C for 2 weeks. The embryogenic calluses that survived the first selection were used for a second selection.

[0093] 4) Differentiation and rooting

[0094] The selected embryogenic callus was inoculated onto a predifferentiation medium and cultured in the dark at 28°C for 10 days. The predifferentiated callus was then inoculated onto a differentiation medium and cultured under light at 25°C until seedlings differentiated. The differentiated seedlings were then transferred to a rooting medium and cultured under light at 25°C until the root system was fully developed. The developed seedlings were then hardened off and transplanted into the greenhouse substrate.

[0095] 5) Detection of positive maize lines

[0096] Genomic DNA was extracted from maize using the CTAB method. PCR detection was performed using the EF1α gene as an internal control to screen for positive maize lines transgenic to dsCHS1. The results are shown in Figure 2. Finally, lines 1-3 were selected as positive maize lines transgenic to dsCHS1.

[0097] 7. Indoor biological assays

[0098] The indoor bioassay method for the two-spotted leaf beetle was based on the method for the fall armyworm assay in "Announcement No. 864-19-2024 of the Ministry of Agriculture and Rural Affairs: Indoor Bioassay of Insect-Resistant Maize for Environmental Safety Testing of Transgenic Plants and Their Products". Leaves of the transgenic dsCHS1 maize line (line 2, hereinafter referred to as dsCHS1) and leaves of the non-transgenic maize line (hereinafter referred to as WT) were placed in rearing dishes, with 15 adult two-spotted leaf beetles in each dish. The survival of two-spotted leaf beetles on transgenic maize and their corresponding non-transgenic maize was observed daily, and the corrected mortality rate was calculated based on the natural mortality rate of the non-transgenic maize (WT) to assess the resistance level of transgenic maize to the two-spotted leaf beetle. After the experiment, the affected leaf area and the number of affected leaf parts on transgenic maize and their corresponding non-transgenic maize were recorded.

[0099] The results are shown in Table 11, Figure 3, and Figure 4. The results showed that the mortality rate of the two-spotted leaf beetle fed with dsCHS1 maize leaves was significantly higher than that of the control group, and the area of ​​leaf damage in the dsCHS1 maize line was much smaller than that in the control group.

[0100] Table 11 Indoor bioassay results

[0101]

[0102] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A dsRNA for controlling the two-spotted firefly beetle, characterized in that, It is transcribed from the nucleotide sequence shown in SEQ ID NO.

3.

2. A recombinant expression vector, characterized in that, The recombinant expression vector contains a DNA fragment transcribed from the dsRNA of claim 1.

3. A recombinant microorganism, characterized in that, The recombinant microorganism comprises the recombinant expression vector of claim 2.

4. The application of the recombinant expression vector of claim 2 or the recombinant microorganism of claim 3 in constructing transgenic plants for controlling the two-spotted leaf beetle or in cultivating plants resistant to the two-spotted leaf beetle; wherein the plant is maize.

5. A method for constructing a transgenic plant for controlling the two-spotted leaf beetle, characterized in that, The method includes the step of transforming the recombinant expression vector of claim 2 into a plant to construct a transgenic plant that controls the two-spotted leaf beetle; the plant is maize.

6. A method for cultivating a plant resistant to the two-spotted leaf beetle, characterized in that, The method includes the step of transforming the recombinant expression vector of claim 2 into a plant, stably expressing it in the plant, and cultivating a plant resistant to the two-spotted leaf beetle; the plant is maize.

7. The application of the dsRNA of claim 1, the recombinant expression vector of claim 2, the recombinant microorganism of claim 3, or the transgenic plant constructed by the construction method of claim 5 in the control of the two-spotted leaf beetle; wherein the plant is maize.

8. A method for controlling the two-spotted firefly beetle, characterized in that, The method includes the step of feeding the transgenic plant constructed using the construction method of claim 5 to the two-spotted firefly beetle; the plant is corn.

Citation Information

Patent Citations

  • Chitosan synthase 2 gene of diplodia juncoides, application of chitin synthase 2 gene, dsRNA for preventing and treating diplodia juncoides and application of dsRNA for preventing and treating diplodia juncoides

    CN121087064A