Oligonucleotide molecule for targeted inhibition of human LINC00921 gene, encoding oligopeptide and application of oligonucleotide molecule and encoding oligopeptide in treatment of lung adenocarcinoma
By targeting and inhibiting oligonucleotide molecules, especially small interfering RNA and short hairpin RNA, of the human LINC00921 gene, combined with a retroviral vector, the expression of the LINC00921 gene was successfully silenced, solving the problem of unsatisfactory treatment effects for lung adenocarcinoma, significantly inhibiting the proliferation and migration of lung adenocarcinoma cells, and improving the treatment effect.
Patent Information
- Application Number
- CN202511655907.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-12
- Publication Date
- 2026-02-10
AI Technical Summary
Current technologies for treating lung adenocarcinoma are not ideal, early diagnosis is difficult, drug resistance is common, and there is a lack of effective molecular targets and treatment methods.
Oligonucleotide molecules, including small interfering RNA and short hairpin RNA, were designed to target and inhibit the human LINC00921 gene. LINC00921 gene expression was efficiently silenced using a retroviral vector. In combination with other targeted drugs, LINC00921 inhibitors were prepared.
It significantly reduces the mRNA expression level of LINC00921, inhibits the proliferation and migration of lung adenocarcinoma cells, improves the therapeutic effect, and has high-throughput operability and good reproducibility.
Smart Images
Figure CN121494924A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to an oligonucleotide molecule that targets and inhibits the human LINC00921 gene, encodes a short peptide, and its application in the treatment of lung adenocarcinoma. Background Technology
[0002] Lung cancer is one of the most common malignant tumors worldwide, with lung adenocarcinoma (LUAD) being the most prevalent pathological type, accounting for the largest proportion of non-small cell lung cancer (NSCLC). According to data from the International Agency for Research on Cancer (IARC) and epidemiological studies, lung cancer has long ranked among the leading causes of death from malignant tumors, resulting in millions of deaths annually. Despite advancements in imaging techniques, surgical methods, and targeted and immunotherapies in recent years, the overall prognosis for patients with lung adenocarcinoma remains unsatisfactory, with a five-year survival rate of less than 20%. Common clinical challenges include the lack of specific early symptoms, leading to most patients being diagnosed at an advanced stage; and widespread drug resistance. Therefore, exploring the molecular mechanisms of lung adenocarcinoma development and progression and identifying new therapeutic targets are of great significance.
[0003] Long noncoding RNAs (lncRNAs) are a class of RNA molecules longer than 200 nucleotides that were traditionally considered to lack protein-coding capabilities. Increasing research evidence suggests that lncRNAs play a crucial role in the development and progression of various tumors. Notably, a small subset of lncRNAs can be translated into biologically functional short peptides via small open reading frames (sORFs). However, current research on the functions and mechanisms of lncRNA-encoded short peptides remains very limited. Summary of the Invention
[0004] To address the shortcomings of existing technologies, the present invention aims to provide an oligonucleotide molecule that targets and inhibits the human LINC00921 gene. This is a gene therapy drug targeting the human LINC00921 gene and is suitable for the treatment of lung adenocarcinoma. It can also be used in combination with other targeted drugs to improve therapeutic efficacy.
[0005] To achieve the above objectives, the present invention adopts the following technical solution: The short peptide RRTMP is encoded, and the amino acid sequence of the short peptide is shown in SEQ ID NO.1.
[0006] An oligonucleotide molecule that targets and inhibits the human LINC00921 gene, encoding the short peptide RRTMP.
[0007] Preferably, the oligonucleotide molecule is a small interfering RNA or a short hairpin structure RNA; The small interfering RNA is a double-stranded RNA, and the target sequence of the sense strand of the small interfering RNA is shown in SEQ ID NO.2-4. The antisense strand is complementary to the sense strand. The short hairpin structure RNA is composed of a sense strand and an antisense strand linked by a neck loop structure. The target sequence of the sense strand is shown in SEQ ID NO.2-4, and the antisense strand is complementary to the sense strand.
[0008] The aforementioned small interfering RNA (siRNA) comprises two strands: the first strand is an interfering sequence designed according to the sequence shown in SEQ ID NO.2-4, targeting the human LINC00921 gene; the second strand is complementary to the first strand. The siRNA can specifically silence the expression of endogenous LINC00921 in lung adenocarcinoma cells.
[0009] Furthermore, the aforementioned short hairpin RNA (shRNA) consists of a sense strand and an antisense strand connected by a stem-loop structure; the sense and antisense strand sequences are complementary, and the sense strand sequence is consistent with the target sequence (SEQ ID NO. 2-4) of the LINC00921 gene, thereby achieving efficient silencing of the LINC00921 gene.
[0010] An interfering expression vector that targets and inhibits the human LINC00921 gene, comprising the oligonucleotide molecule as described above; The interference expression vector can express short hairpin RNA that specifically targets LINC00921 in cells or in vivo. After the interference expression vector is transfected into lung adenocarcinoma cells, it can reduce the mRNA expression level of the LINC00921 gene in the cells and promote the silencing effect on the expression of the LINC00921 gene.
[0011] The method for preparing the aforementioned interference expression vector targeting the LINC00921 gene includes: (1) Linearization of the retroviral vector was performed using restriction endonucleases; (2) Annealing of paired single-stranded primers to form insert fragments; (3) The inserted fragment was ligated to a linearized retroviral vector and then transformed into Escherichia coli; (4) The interference expression vector was obtained through colony identification and sequencing verification.
[0012] A retrovirus that targets and inhibits the human LINC00921 gene, wherein the retrovirus is obtained by packaging the interference expression vector as described above with the aid of a retrovirus helper plasmid and viral packaging cells.
[0013] A pharmaceutical composition for the prevention or treatment of lung adenocarcinoma comprises the short peptide RRTMP as described, and a pharmaceutically acceptable carrier or excipient.
[0014] The use of the described encoding short peptide RRTMP, the described oligonucleotide molecule, the described interfering expression vector, the described retrovirus, and the described pharmaceutical composition in the preparation of a LINC00921-targeting inhibitor for the treatment of lung adenocarcinoma.
[0015] An inhibitor targeting the human LINC00921 gene, comprising an inhibitor with an oligonucleotide molecule as the main active ingredient as described above; or, The drug composition as described is loaded onto the interference expression vector as described.
[0016] The aforementioned oligonucleotide molecules can be used in combination with pharmaceutically acceptable excipients and can be delivered via sustained-release or controlled-release delivery systems. These delivery systems include, but are not limited to, liposome carriers, nanoparticles, porous microspheres, and microneedle arrays.
[0017] In this invention, the active ingredient that exerts the above-mentioned effect may be solely a LINC00921 inhibitor, or it may further include other molecules with similar effects. The formulation with the inhibitory effect on LINC00921 can be used as the sole active ingredient of the product, or it can be used in combination with other active ingredients. The product can be a single-component formulation or a multi-component formulation; its dosage form is not limited and can be prepared in various forms such as solid, liquid, gel, semi-fluid, and aerosol.
[0018] The inhibitory formulation of LINC00921 of the present invention can be a nucleic acid molecule, a targeting short peptide, an antibody, a lentivirus, a retrovirus, an adeno-associated virus, etc.
[0019] The application of an inhibitor targeting the human LINC00921 gene in gene-targeted therapy for lung adenocarcinoma, wherein the inhibitor is used to reduce the mRNA expression level of LINC00921, enhance the knockdown effect, and inhibit the proliferation / migration / invasion ability of lung adenocarcinoma cells.
[0020] A kit for detecting the expression level of the LINC00921 gene in lung adenocarcinoma cells, the kit comprising an oligonucleotide molecule targeting and inhibiting the human LINC00921 gene as described above, an interfering expression vector targeting the LINC00921 gene as described above, or a retrovirus targeting the LINC00921 gene as described above.
[0021] Compared with the prior art, the present invention has at least the following technical effects: (i) This invention provides an oligonucleotide molecule that targets and inhibits the human LINC00921 gene. It is a gene therapy drug with the human LINC00921 gene as the therapeutic target and is suitable for the treatment of lung adenocarcinoma. It can also be used in combination with other targeted drugs to improve the therapeutic effect.
[0022] (ii) This invention is the first to identify and confirm that the long intergenic non-protein coding RNA LINC00921 (Gene ID: 283876) has the function of encoding short peptides in lung adenocarcinoma, and provides an intervention method targeting it.
[0023] (III) Application of drugs or products targeting and inhibiting the human LINC00921 gene oligonucleotide molecule in the inhibition or treatment of lung adenocarcinoma. By designing a reasonable RNAi target sequence for the target gene, a retroviral vector plasmid containing the target sequence was successfully constructed, and a retrovirus capable of efficiently silencing LINC00921 was obtained. This retrovirus significantly reduced the mRNA expression level of LINC00921, exhibiting a prominent knockdown effect and significantly inhibiting the proliferation, migration, and invasion of lung adenocarcinoma cells. Therefore, this invention has significant application value in the treatment of lung adenocarcinoma and possesses high-throughput operability and good reproducibility. Attached Figure Description
[0024] Figure 1 This is a schematic diagram illustrating the detection of LINC00921 expression levels in clinically derived tumor tissues (T) vs. normal tissues (N). Figure 2 A schematic diagram illustrating the detection of expression levels of the short peptide (RRTMP) encoded by LINC00921 in clinically derived tumor tissues (T) vs. normal tissues (N); Figure 3 Schematic diagram showing the intracellular LINC00921 expression level in lung adenocarcinoma cells A549 after infection with a retrovirus targeting LINC00921, as detected by RT-qPCR. Figure 4 This is a schematic diagram illustrating the changes in cell proliferation capacity of lung adenocarcinoma cells after infection with LINC00921-targeted retroviruses as detected by the MTS assay. Figure 5 This is a schematic diagram illustrating the changes in cell migration ability of lung adenocarcinoma cells after infection with a LINC00921-targeted retrovirus, as detected by a transwell assay. Detailed Implementation
[0025] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the present invention will be briefly introduced below in conjunction with the accompanying drawings and descriptions of the embodiments or the prior art. Obviously, the following description of the structure of the accompanying drawings is only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort. It should be noted that the description of these embodiments is for the purpose of helping to understand the present invention, but does not constitute a limitation of the present invention.
[0026] One specific embodiment of the present invention is as follows: 1. The amino acid sequence of the short peptide RRTMP encoded by LINC00921 is shown in SEQ ID NO.1: MSLEATKWWE IRDSNIWWPC DVSKLLDFSQ FPFPIKWVVL GIRGSNSAGN RGRNRQLRPR TSPKPRAATG TTVRGASVKR TGGPAPAQPS PPGPLPPTPH GPHARAETGA SPGSPVRQPL PGPAPQREAA WGRRRVERAA EDKEEVAVEN KKELSAVCPD AGRRWGQARP DLHAIPAGVP ACLREGKDPG RLLPKVRLLP KVRLLLPRGPH KARQTLQPDP DAPPSRMHMR GTLPETHLPE RPGSTRANWR AD.
[0027] 2. This invention provides three retroviruses for brain and lung adenocarcinoma, whose siRNA target fragment coding sequences are as follows: SEQ ID NO.2: UCAAGAAGAGGAAGAGAAA SEQ ID NO.3:UUGAGAAACUGAAGGAGAA SEQ ID NO.4:GCAAACAGAUGUAUUCUUA 3. Design corresponding shRNA sequences for the above target sequences and clone them into a retroviral vector.
[0028] 4. The steps for constructing retroviral vector plasmids include: First, psiREN was selected as the tool vector, and corresponding single-stranded primers were synthesized according to the target gene sequence.
[0029] Regarding SEQ ID NO.2: Upstream primer (SEQ ID NO.5): GATCCGTCAAGAAGAGGAAGAGAAATTTCAAGAGAATTTCTCTTCCTCTTCTTGACTTTTTTGCTAGCG Downstream primer (SEQ ID NO.6): AATTCGCTAGCAAAAAAGTTTCTCTTCCTCTTCTTGATTCTCTTGAAATCAAGAAGAGGAAGAGAAACG Regarding SEQ ID NO.3: Upstream primer (SEQ ID NO.7): GATCCGTTGAGAAACTGAAGGAGAATTTCAAGAGAATTCTCCTTCAGTTTCTCAACTTTTTTGCTAGCG Downstream primer (SEQ ID NO.8): AATTCGCTAGCAAAAAAGTTCTCCTTCAGTTTCTCAATTCTCTTGAAATTGAGAAACTGAAGGAGAACG Regarding SEQ ID NO.4: Upstream primer (SEQ ID NO.9): GATCCGGCAAACAGATGTATTCTTATTTCAAGAGAATAAGAATACATCTGTTTGCCTTTTTTGCTAGCG Downstream primer (SEQ ID NO.10): AATTCGCTAGCAAAAAAGTAAGAATACATCTGTTTGCTTCTCTTGAAAGCAAACAGATGTATTCTTACG The complementary primers described above are annealed to form double-stranded oligonucleotides (oligo DNA).
[0030] 5. The annealing system is as follows: 2.5 μL (10 μmol / L) upstream primer, 2.5 μL (10 μmol / L) downstream primer. Annealing buffer 5 μL 10 μL of ultrapure water After mixing, the mixture was annealed in a PCR instrument using the following procedure: heating at 95 °C for 5 min; then cooling by 1 °C per cycle and holding for 30 s, for a total of 90 cycles; finally, it was stored at 4 °C.
[0031] 6. Plasmid construction: Oligonucleotides (oligo DNA) are ligated into linearized tool vectors and then transformed.
[0032] The specific steps are as follows: 6.1 Vector Enzyme Digestion pSIREN-RetroQ was selected as the vector, and double digestion with EcoRI and XhoI was performed. The digestion reaction system was as follows: 16μL of ultrapure water 10×CutSmart Buffer 4 μL pSIREN-RetroQ plasmid DNA (1 μg / μL) 12 μL Xho I (10 U / μL) 1 μL EcoRⅠ (10 U / μL) 1 μL The reaction was carried out at 37°C for 1 h, and the target fragment was separated and recovered by agarose gel electrophoresis.
[0033] 6.2 Connection reaction: The enzyme-digested vector was reacted with oligonucleotides at 22 °C for 1 h. The reaction system was as follows: Enzyme digestion vector 50 ng oligo DNA (100 ng / μL) 2 μL 10 × T4 DNA ligase Buffer 2 μL T4 DNA ligase 0.5 μL Make up to 20 μL of ultrapure water. 6.3 Transformation and Cloning Screening After thawing DH5α competent cells on ice, 10 μL of ligation product was added, and the cells were incubated on ice for 3 min. The cells were then heat-shocked at 42℃ for 90 s, followed by another 3 min on ice. Subsequently, 200 μL of antibiotic-free LB broth was added, and the cells were incubated at 37℃ with shaking at 200 rpm for 1 h. 150 μL of the bacterial culture was then spread onto LB agar plates containing ampicillin (Amp) and incubated at 37℃ for 14 h.
[0034] 6.4 Colony identification and plasmid extraction Transformants were selected and inoculated into LB liquid medium containing Amp, and cultured at 37°C for 14 h. Single clones were selected for sequencing. Clones with correct sequencing results were inoculated into 150 mL LB liquid medium (containing Amp) and cultured overnight at 37°C with shaking. Plasmids were extracted using the Tiangen endotoxin-free plasmid extraction kit, following these steps: Bacterial cell enrichment: Take 10 mL of bacterial solution and centrifuge at 8000 rpm for 4 min; Lysis: Resuspend the bacterial cells in 1 mL GP1 Buffer and transfer to a 2.0 mL EP tube; Cycle termination: Add 0.5 mL GP2 Buffer, gently invert to mix, let stand for 1 min, and centrifuge at 12000 rpm for 1 min; Adsorption: Take 0.7 mL of the supernatant and add it to the activated GP adsorption column. Centrifuge at 13000 rpm for 1 min and discard the waste liquid. Washing: Add 0.5 mL GPW Buffer and centrifuge at 12000 rpm for 1 min; Recovery: Replace the collection tube, add 0.2 mL GP3 Buffer, let stand for 1 min, centrifuge at 12000 rpm for 1 min to obtain the purified plasmid.
[0035] 7. Retroviral Packaging 7.1 Cell Preparation 24 hours before transfection, HEK293T cells were seeded in 6 cm culture dishes to achieve a cell density of 40%–50% at the time of transfection.
[0036] 8.2 Calcium phosphate transfection Change the culture medium 1 h before transfection. Add the plasmid to be transfected to a 1.5 mL EP tube, add water to a final volume of 182.75 μL and mix well. Add 21.5 μL of 10×HBS (0.2 M HEPES-KOH, pH 7.2; 1.37 M NaCl; 50 mM KCl; 7 mM Na2HPO4; 60 mM Glucose), vortex to mix. Slowly add 10.75 μL of 2 M CaCl2, vortex gently for 10 s. After allowing the mixture to stand at room temperature for 15 min, add it dropwise to the cell culture medium, gently shaking to mix. Incubate at 37℃ for 8–12 h, then replace with fresh culture medium.
[0037] The transfection system consisted of 5 μg of pSIREN-shRNA plasmid and 5 μg of pHelper retroviral packaging plasmid.
[0038] 7.3 Virus Collection Forty-eight hours post-transfection, the virus-containing culture medium was collected once and stored temporarily at 4°C; 4 mL of fresh culture medium was added for further incubation. Seventy-two hours post-transfection, the virus-containing culture medium was collected a second time, and the supernatants from both collections were combined to approximately 8 mL. 40 μL of Polybrene (4 mg / mL) and 40 μL of HEPES (20 mM, pH 7.2) were added, mixed well, and then filtered through a 0.22 μm filter to remove cell debris. The resulting filtrate was the retroviral solution.
[0039] Note: This system can be scaled up proportionally when used for mass production of retroviruses.
[0040] 8. The oligonucleotides SEQ ID NO. 10 & SEQ ID NO. 11 used in this invention can be used to detect the expression level of LINC00921 in tissues or cells, and are suitable for diagnosis, prognosis, and disease monitoring. For example, they can be used to assess the malignancy and prognosis of tumors. The above detection can be performed in vitro or in vivo.
[0041] 9. Experimental Conclusion: 9.1 Based on the sequence information of LINC00921 itself, prepare oligonucleotide drugs targeting LINC00921 and its encoded short peptides.
[0042] 9.2 As Figure 1 The figure shows a schematic diagram of the expression level detection of LINC00921 in clinically derived tumor tissue (T) vs. normal tissue (N).
[0043] Combination Figure 1 The results showed that, after extracting RNA from clinically sourced patient tissues, RT-qPCR was performed using primer pairs SEQ ID NO.11: CCAGACCGGCCACTACTTTT; SEQ ID NO.12: CCCACACATGAAGATGCCCT to detect the expression level of LINC00921 in tumor tissues (T) and normal tissues (N) (GAPDH was used as an internal control).
[0044] The results showed that the expression level of LINC00921 was significantly upregulated in tumor tissue (p<0.01).
[0045] This result indicates that LINC00921 is abnormally upregulated in tumor tissue.
[0046] 9.3 As Figure 2 The diagram shows the expression level of the short peptide (RRTMP) encoded by LINC00921 in clinically derived tumor tissues (T) vs. normal tissues (N).
[0047] Combination Figure 2 The results showed that the expression level of the short peptide encoded by LINC00921 (RRTMP) in clinical tissues was detected by immunoblotting.
[0048] The results also showed that the short peptide RRTMP was significantly upregulated in tumor tissue.
[0049] 9.4 such as Figure 3 As shown, the LINC00921-targeting retrovirus significantly inhibited LINC00921 expression after infecting lung adenocarcinoma cells A549.
[0050] Combination Figure 3The results showed that after 72 hours of infection with the above-mentioned retrovirus into lung adenocarcinoma cells A549, the samples were collected and RNA was extracted. Then, RT-qPCR was performed using primers SEQ ID NO.11 and SEQ ID NO.12 to detect the changes in intracellular LINC00921 expression levels after infection with control cells and three retroviruses carrying shRNA targeting LINC00921.
[0051] The results showed that all three retroviruses could significantly downregulate the expression of LINC00921 in lung adenocarcinoma cells.
[0052] 9.5 such as Figure 4 As shown, the lung adenocarcinoma cells infected with the prepared LINC00921-targeting retrovirus and inhibiting LINC00921 showed a significant decrease in the proliferation ability of lung adenocarcinoma cells.
[0053] Combination Figure 4 The results showed that, using the A549 cell line described above, the changes in cell proliferation capacity after knocking down LINC00921 were detected by the MTS cell proliferation assay.
[0054] The results showed that all three retroviruses targeting LINC00921 could significantly inhibit the proliferation of lung adenocarcinoma cells.
[0055] 9.6 As Figure 5 As shown, the lung adenocarcinoma cells infected with the prepared LINC00921-targeting retrovirus and inhibiting LINC00921 showed a significant decrease in the migration ability of lung adenocarcinoma cells.
[0056] Figure 5 The results in A are micrographs of the control group cells (ctrl) and the experimental group cells (sh00921-1~3) after the transwell experiment. Figure 5 The result in B is a statistical result of the result in Figure A (three fields of view were randomly selected).
[0057] Combination Figure 5 The results showed that, using the A549 cell line described above, the changes in cell migration ability after knocking down LINC00921 were detected by transwell cell migration ability assay.
[0058] The results showed that all three retroviruses targeting LINC00921 could significantly inhibit the migration ability of lung adenocarcinoma cells.
[0059] Finally, it should be noted that the above description is merely a preferred embodiment of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. Encoding the short peptide RRTMP, characterized in that, The amino acid sequence encoding the short peptide is shown in SEQ ID NO.
1.
2. An oligonucleotide molecule that targets and inhibits the human LINC00921 gene, characterized in that, It encodes the short peptide RRTMP as described in claim 1.
3. The oligonucleotide molecule targeting and inhibiting the human LINC00921 gene according to claim 2, characterized in that, The oligonucleotide molecule is a small interfering RNA or a short hairpin structure RNA; The small interfering RNA is a double-stranded RNA, and the target sequence of the sense strand of the small interfering RNA is shown in SEQ ID NO.2-4. The antisense strand is complementary to the sense strand. The short hairpin structure RNA is composed of a sense strand and an antisense strand linked by a neck loop structure. The target sequence of the sense strand is shown in SEQ ID NO.2-4, and the antisense strand is complementary to the sense strand.
4. A vector for interfering with the expression of the human LINC00921 gene, characterized in that, It comprises the oligonucleotide molecule as described in claim 2; The interference expression vector can express short hairpin RNA that specifically targets LINC00921 in cells or in vivo. After the interference expression vector is transfected into lung adenocarcinoma cells, it can reduce the mRNA expression level of the LINC00921 gene in the cells and promote the silencing effect on the expression of the LINC00921 gene.
5. A retrovirus that targets and inhibits the human LINC00921 gene, characterized in that, The retrovirus is obtained by packaging the interference expression vector as described in claim 3 with the helper plasmid and viral packaging cells.
6. A pharmaceutical composition for the prevention or treatment of lung adenocarcinoma, characterized in that, It comprises the short peptide RRTMP as described in claim 1, and a pharmaceutically acceptable carrier or excipient.
7. The use of the short peptide RRTMP as described in claim 1, the oligonucleotide molecule as described in claim 2, the interfering expression vector as described in claim 4, the retrovirus as described in claim 5, and the pharmaceutical composition as described in claim 6 in the preparation of a LINC00921-targeting inhibitor for the treatment of lung adenocarcinoma.
8. An inhibitor targeting the human LINC00921 gene, characterized in that, Inhibitors containing oligonucleotide molecules as the main active ingredient as described in claim 2; or, The pharmaceutical composition of claim 6 is loaded onto the interference expression vector of claim 4.
9. The application of an inhibitor targeting the human LINC00921 gene as described in claim 8 in gene-targeted therapy for lung adenocarcinoma, characterized in that, The inhibitor is used to reduce the mRNA expression level of LINC00921, enhance the knockdown effect, and inhibit the proliferation / migration / invasion of lung adenocarcinoma cells.
10. A kit for detecting the expression level of the LINC00921 gene in lung adenocarcinoma cells, characterized in that, The kit contains the oligonucleotide molecule that targets and inhibits the human LINC00921 gene as described in claim 2, the interference expression vector that targets the LINC00921 gene as described in claim 4, or the retrovirus that targets the LINC00921 gene as described in claim 5.