Use of miR-8069 inhibitors

By developing miR-8069 inhibitors, targeting the abnormally elevated miR-8069 in the plasma of IS patients, the lack of effective drugs for the treatment of ischemic stroke has been solved, achieving neuroprotective effects such as increased cell viability, reduced apoptosis rate, and reduced ROS.

CN121534074BActive Publication Date: 2026-04-10YUNNAN YUNKE BIOTECHNOLOGY RES INST
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202610064290.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2026-01-19
Publication Date
2026-04-10
Estimated Expiration
2046-01-19

AI Technical Summary

Technical Problem

There is a lack of effective drugs for the treatment of ischemic stroke (IS). Existing treatments such as thrombolysis with recombinant tissue plasminogen activator and endovascular thrombectomy cannot salvage neuronal damage and have time window limitations and risks of reperfusion injury. miRNAs have potential drug targets in the progression of stroke, but they have not been fully utilized.

Method used

Develop miR-8069 inhibitors, prepare drugs using the nucleotide sequence ACGCCGACCGCCCCCAACCAUCC, and use them to inhibit miR-8069 expression for the treatment of ischemic stroke.

Benefits of technology

It effectively reduced the expression of miR-8069 in the plasma of IS patients, improved the decreased cell viability, increased apoptosis rate and increased ROS caused by OGD/R treatment, and showed a significant neuroprotective effect.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121534074B_ABST
    Figure CN121534074B_ABST
Patent Text Reader

Abstract

The application discloses application of a miR-8069 inhibitor and belongs to the technical field of biological medicines.The inventor of the application finds that the expression of miR-8069 in the plasma of IS patients is abnormally increased in the research on the pathogenesis of IS, and through further cell experiments, it is found that inhibiting the expression of miR-8069 can effectively improve the adverse effects of OGD / R treatment on cell viability, apoptosis and ROS, and has a significant therapeutic effect on IS. Cell damage induced by OGD / R is often used as a model of cerebral stroke in vitro in research. The miR-8069 inhibitor disclosed by the application is used for preparing a medicine for treating cerebral stroke, and the nucleotide sequence is as follows: ACCGCCGACCGCCCCCAACCAUCC.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biological medicine, and particularly relates to an application of a miR-8069 inhibitor. BACKGROUND

[0002] Stroke, commonly known as apoplexy, is an acute cerebrovascular disease, which can be divided into ischemic stroke (IS) and hemorrhagic stroke, which is caused by blood vessel obstruction or blood vessel rupture. However, there is currently a lack of effective treatment methods and drugs. Although recombinant tissue plasminogen activator (rt-PA) thrombolysis and intravascular thrombectomy are important means of clinical treatment, they cannot rescue the neuronal damage caused by hypoxia, and have a strict time window (4.5 h and 24 h), only a small part of patients can be treated. In addition, reperfusion after thrombolysis causes serious secondary damage to the brain tissue and cerebrovascular system, aggravates the risk of inflammatory response and hemorrhagic transformation (HT), disability and death. Therefore, it is crucial to find alternative drugs and new drug targets for cerebral ischemia-reperfusion injury.

[0003] MicroRNA (miRNA) is a small single-stranded non-coding RNA molecule composed of 18-25 nucleotides, which can regulate gene expression by targeting the 3'UTR of mRNA or promoting the degradation of mRNA. miRNA plays a crucial role in almost all cellular activities, and it can exert biological functions through multiple pathways. The OGD / R (oxygen-glucose deprivation / reperfusion) cell model is the most core and classical in vitro experimental model for studying ischemic stroke. It directly simulates the key pathophysiological links in the occurrence of stroke, and provides an irreplaceable platform for revealing the disease mechanism and screening therapeutic drugs. More and more studies have pointed out that miRNA plays a key role in regulating the progression of stroke and is a potential drug target for the treatment of IS. SUMMARY

[0004] In view of the problems in the prior art, the purpose of the present application is to find and discover miRNA markers related to the treatment of ischemic stroke (IS). The inventors of the present application found that the expression of miR-8069 in the plasma of IS patients was abnormally increased in the study of the pathogenesis of IS, and further cell experiments found that inhibiting the expression of miR-8069 can effectively improve the adverse effects of OGD / R treatment on cell viability, apoptosis and ROS, and has a significant therapeutic effect on IS. OGD / R-induced cell damage is often used as an in vitro model of stroke in research.

[0005] The miR-8069 inhibitor described in the present application is used for preparing a drug for treating stroke, and the nucleotide sequence thereof is as follows: ACCGCCGACCGCCCCCAACCAUCC.

[0006] Advantages of the present application:

[0007] The present application first found that miR-8069 was significantly highly expressed in the plasma of IS patients, and through further cell experiments, it was found that the early transfection of miR-8069 inhibitor in neuron cells could effectively reduce the increase of miR-8069 expression level caused by OGD / R treatment (P<0.001), could effectively increase the decrease of cell viability caused by OGD / R treatment (P<0.001), could effectively reduce the increase of cell apoptosis rate caused by OGD / R treatment (P<0.01), and could effectively reduce the increase of ROS caused by OGD / R treatment (P<0.001). BRIEF DESCRIPTION OF DRAWINGS

[0008] Figure 1 Figure 1 is a comparison chart of miR-8069 expression in plasma of IS patients and healthy people; ### Indicates p<0.001 compared with the control group;

[0009] Figure 2 Figure 2 is a comparison chart of the effect of miR-8069 inhibitor on the expression of miR-8069 in neuron cells caused by OGD / R treatment; ### Indicates p<0.001 compared with the control group; *** Indicates p<0.001 compared with the model group;

[0010] Figure 3 Figure 3 is a comparison chart of the effect of miR-8069 inhibitor on the viability of neuron cells caused by OGD / R treatment; #### Indicates p<0.0001 compared with the control group; *** Indicates p<0.001 compared with the model group;

[0011] Figure 4 Figure 4 is a comparison chart of the effect of miR-8069 inhibitor on the apoptosis of neuron cells caused by OGD / R treatment; #### Indicates p<0.0001 compared with the control group; ** Indicates p<0.01 compared with the model group;

[0012] Figure 5 Figure 5 is a comparison chart of the effect of miR-8069 inhibitor on the ROS of neuron cells caused by OGD / R treatment; #### Indicates p<0.0001 compared with the control group; **** Indicates p<0.001 compared with the model group. DETAILED DESCRIPTION

[0013] The application will be further described in connection with the following examples, which are not intended to limit the application in any way, and any modification or substitution based on the teaching of the application shall fall within the scope of the application.

[0014] 1. Expression characteristics of miR-8069 in IS patients and its clinical significance

[0015] 1.1 Main reagents and consumables

[0016] Reagent name Company miRcute miRNA Isolation Kit Tiangen Chloroform Xilong Scientific Anhydrous ethanol Xilong Scientific miRNA cDNA First-Strand Synthesis Kit Tiangen miRNA Fluorescent Quantitative Detection Kit (SYBR Green) Tiangen

[0017] 1.2 Main instruments

[0018] Instrument name Company Vortex Mixer SCILOGEX High-Speed Refrigerated Centrifuge SCILOGEX Handheld Centrifuge SCILOGEX 96-Well Plate Centrifuge Its Linbail Water Bath Jintan Kexi Quantitative PCR Instrument Roche

[0019] 1.3 Experimental methods

[0020] 1.3.1 Sample collection

[0021] Plasma samples of 5 ischemic stroke patients and 5 healthy volunteers (control group) were collected as research objects. The plasma sample preparation method was as follows: about 4 mL of fasting peripheral venous blood of the subject was collected, the plasma sample was stored in a sodium citrate anticoagulant tube after collection, and the plasma was taken after centrifugation (3000 rpm, 4°C, 10 min) and immediately stored in a -80°C refrigerator for standby.

[0022] 1.3.2 Primer design and synthesis

[0023] The corresponding sequence was obtained from the NCBI database, and the miR-8069 primer was designed. The primer was synthesized by Shanghai Shengong Biotechnology Co., Ltd., and the primer sequence was as follows: miR-8069 Forward: 5'-GGATGGTTGGGGGCGGTCGGCGT-3'.

[0024] 1.3.3 miRNA extraction

[0025] 200 μL of plasma sample was taken, and miRcute miRNA extraction and separation kit was used to extract miRNA from the plasma sample.

[0026] 1.3.4 miRNA reverse transcription

[0027] The operation was carried out according to the requirements of the miRNA cDNA first strand synthesis kit instruction manual, and the reverse transcription system was as follows:

[0028] Ingredient Volume 2x miRNA RT Reaction Buffer 10 μL miRNA RT Enzyme Mix 2 μL miRNA Sample 8 μL

[0029] To a total volume of 20 μL, gently shake, centrifuge for 3-5 s, mix the reactants, incubate at 42℃ for 60 min, and obtain the first strand of reverse-transcribed cDNA at 95℃ for 3 min, then place it on ice immediately or store it at -20℃.

[0030] 1.3.5 qPCR detection of target gene expression

[0031] According to the instructions of the miRNA fluorescent quantitative detection kit, the following reagents were added to the 96-well PCR plate in the order of sample loading:

[0032] Ingredient Volume 2x miRcute Plus miRNA PreMix (SYBR & ROX) 5 μL Forward Primer 0.2 μL Reverse Primer (10 µM) 0.2 μL miRNA First-Strand cDNA 1 μL ddH2O 3.6 μL Total System 10 µL

[0033] Mix the above system uniformly, centrifuge briefly, and place it in the LightCycler 96 instrument for detection. Collect the amplification signal, and the quantitative PCR conditions are as follows: pre-denaturation at 95℃ for 600 s; 95℃ for 5 s, 60℃ for 30 s, and 72℃ for 30 s, for 45 cycles; melting curve analysis: 95℃ for 15 s, 60℃ for 30 s, and 95℃ for 1 s. U6 was selected as the internal reference, and the relative expression level of the target gene was analyzed by selecting 2 -△△Ct Method for calculation.

[0034] 1.3.6 Statistical analysis

[0035] GraphPad Prism 9.0.0 was used for analysis and comparison, and two independent sample T tests were used for comparison between groups. P<0.05 was considered statistically significant.

[0036] 1.4 Experimental results

[0037] The results are shown in Figure 1 Compared with healthy volunteers (control group), the expression level of miR-8069 in the plasma of IS patients was significantly increased (p<0.001).

[0038] 2. The neuroprotective effect of miR-8069 inhibitor on OGD / R-induced neuronal cell injury

[0039] 2.1 Main reagents and consumables

[0040] Reagent name Company DMEM High Glucose Medium Gibco Hanks' Balanced Salt Solution (HBSS) Gibco Papain Sigma DNase I Solebao Neurobasal-A Medium Gibco B-27 Supplement Gibco Penicillin-Streptomycin (P / S) Gibco lipofectamine TM 3000]]> Gibco Trizol Thermo Fisher Isopropanol Xilong Scientific Chloroform Xilong Scientific Anhydrous ethanol Xilong Scientific miRNA cDNA First-Strand Synthesis Kit Tiangen miRNA Fluorescent Quantitative Detection Kit (SYBR Green) Tiangen Annexin V-FITC Apoptosis Detection Kit Biyun Tian Reactive Oxygen Species Detection Kit Biyun Tian

[0041] 2.2 Main instruments

[0042] Instrument name Company Cell Culture Incubator Thermo Fisher Scientific 3141 Super Clean Bench Haier HCB-1300V Inverted Microscope OLYMPUS BX53 Nanophotometer Ultra-Micro Spectrophotometer IMPLEN Quantitative PCR Instrument Roche Flow Cytometer ACEA Novocyte 2060R

[0043] 2.3 Experimental method

[0044] 2.3.1 Culture of tree shrew primary cortical neurons

[0045] The tree shrews within 24 h after birth (Institute of Medical Biology, Chinese Academy of Medical Sciences, license number SCXK (Yunnan) K2023-0003) were soaked with 75% alcohol for disinfection, decapitated on ice to take out the brain, rinsed in pre-cooled HBSS liquid, peeled off the meninges and blood vessels on the surface of the cortex on ice, removed the cerebellum and brainstem, and separated the cerebral cortex. The collected cortex was cut into pieces (about 0.5-1 mm 3 size), resuspended and mixed uniformly after blowing, 37℃ 2mg / mL papain and 200U / mL DNase I mixture was added, and it was put into the cell incubator for 37℃ for 30min, then DMEM high-sugar complete medium was added to terminate the digestion, and the cell suspension was gently blown and resuspended, and the cell concentration of the mother liquor was counted, and the appropriate cell density was inoculated in the cell culture plate coated with mouse tail glue. 4h after inoculation, all the DMEM high-sugar complete medium was replaced with Neurobasal-A medium (add 2% B27, 1% double antibody, 1% glutamine), and then the medium was replaced every 2 days, and cultured in vitro for 7 days for subsequent experiments.

[0046] 2.3.2 Establishment of sugar-oxygen deprivation / reoxygenation model

[0047] On the 8th day of neuron culture, the sugar-oxygen deprivation / reoxygenation (OGD / R) model was established. The specific method was as follows: the normal culture medium was discarded, washed with PBS for 2 times, and then added with DMEM medium without sugar and serum. The cells were placed in the incubator (37℃, 95% N2, 5% CO2) for OGD treatment. After 2h, the cells were taken out, the DMEM medium was discarded, and the normal Neurobasal-A medium was replaced, which was the beginning of reoxygenation. After 18h, the subsequent detection was performed.

[0048] 2.3.3 Cell treatment

[0049] Experimental grouping and treatment:

[0050] ①Control group: normal culture of neuron cells;

[0051] ②OGD / R group: establish the OGD / R model of neuron cells according to 2.3.2;

[0052] ③miR-8069 inhibitor group: dilute the miR-8069 inhibitor sequence with lipofectamine TM3000 Transfection reagent mix, gently mix, incubate at room temperature for 20 min, form transfection complex. The above mixture is added to the cultured 7-day-old neuron cells, and the cell plate is mixed evenly before and after gentle shaking. After incubation in a 5% CO2, 37°C incubator for 24 h, the OGD / R model is constructed. The sequence of the self-designed miR-8069 inhibitor is as follows: ACCGCCGACCGCCCCCAACCAUCC, which is synthesized by Shanghai Shenguo Biotechnology Co., Ltd.

[0053] 2.3.4 qPCR detection

[0054] Cells in different treatment groups were collected, total RNA was extracted by Trizol method, and after detection of total RNA concentration and purity by ultramicro spectrophotometer, reverse transcription into cDNA was performed, and PCR amplification reaction was performed by Roche quantitative PCR instrument. Reaction conditions: pre-denaturation 95℃, 600s; 95℃: 5s, 60℃: 30s, 72℃: 30s, cycle 45 times; melting curve analysis: 95℃: 15s; 60℃: 30s; 95℃: 1s. U6 was selected as the internal reference, and the relative expression level of the target gene was analyzed by selecting 2 -△△Ct Method.

[0055] 2.3.5 Cell survival rate determination

[0056] CCK-8 reagent was used to detect cell survival rate. After the culture of the above cells was completed, the original culture medium was removed, 100 μL / well of fresh Neurobasal-A medium containing 10% CCK-8 was added, and the plate was incubated at 37℃ in the dark for 2 h, then the absorbance value at 450 nm was measured using a full-wavelength enzyme marker,

[0057] 2.3.6 Flow cytometry apoptosis

[0058] Cells in different treatment groups were collected, resuspended with 400 μL of binding buffer, added with 5 μL of Annexin V-FITC, and gently mixed, incubated in the dark for 15 min, then added with 10 μL of PI and mixed, and reacted at room temperature in the dark for 5 min, then detected by flow cytometry.

[0059] 2.3.7 ROS detection

[0060] The ROS level in the neurons was detected using the DCFH-DA probe, and the operation was as follows: DCFH-DA was diluted with serum-free medium (final concentration 10 μmol / L), and cells in different treatment groups were collected. 1 mL of DCFH-DA diluent was added to the cells, and incubated at 37°C for 20 min. Centrifugation at 350 g for 5 min, aspirate the supernatant, wash the cells with serum-free cell culture medium for 3 times, and fully remove the DCFH-DA that does not enter the cells. Centrifugation at 350 g for 5 min, aspirate the supernatant, resuspend with PBS, and detect on a flow cytometer.

[0061] 2.3.8 Statistical analysis

[0062] GraphPad Prism 9.0.0 was used for analysis and comparison. One-way ANOVA was used for comparison between groups, and LSD method was used for pairwise comparison. P<0.05 was considered statistically significant.

[0063] 2.4 Experimental results

[0064] 2.4.1 Effect of miR-8069 inhibitor on expression of miR-8069 in neurons treated by OGD / R

[0065] As shown in the results, the expression level of miR-8069 in the neurons was significantly increased after OGD / R treatment (P<0.001); the expression level of miR-8069 in the neurons was effectively reduced by pre-transfection of miR-8069 inhibitor (P<0.001). Figure 2 2.4.2 Effect of miR-8069 inhibitor on cell viability of neurons treated by OGD / R

[0066] As shown in the results, the cell viability of the neurons was significantly reduced after OGD / R treatment (P<0.0001); the cell viability of the neurons was effectively increased by pre-transfection of miR-8069 inhibitor (P<0.001).

[0067] Figure 3 2.4.3 Effect of miR-8069 inhibitor on apoptosis of neurons treated by OGD / R

[0068] As shown in the results, the apoptosis rate of the neurons was significantly increased after OGD / R treatment (P<0.0001); the apoptosis rate of the neurons was effectively reduced by pre-transfection of miR-8069 inhibitor (P<0.01).

[0069] Figure 4 ​​​

[0070] 2.4.4 Effects of miR-8069 inhibitor on OGD / R treatment of reactive oxygen species (ROS) in neurons

[0071] The results are as follows Figure 5 As shown, the ROS level in neurons was significantly increased after OGD / R treatment (P < 0.0001); pre-transfection of neurons with miR-8069 inhibitor effectively reduced the increase in ROS caused by OGD / R treatment (P < 0.001).

Claims

1. The application of miR-8069 inhibitors, characterized in that, The inhibitor is used to prepare a drug for treating ischemic stroke, and its nucleotide sequence is ACGCCGACCGCCCCCAACCAUCC.

Citation Information

Patent Citations

  • Use of mirnas for the prognosis of stroke patients and as targets for the treatment of stroke.

    WO2025186229A2