Herbicide-tolerant alfalfa transformation event TWMS2-17 and detection method thereof
By inserting the IVA-EPSPS and RePAT genes into the alfalfa genome, herbicide-tolerant plant TWMS2-17 was screened out, solving the problem of alfalfa's tolerance to glyphosate and glufosinate herbicides, and achieving efficient weed control and quality improvement.
Patent Information
- Application Number
- CN202512017831.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-29
- Publication Date
- 2026-04-07
AI Technical Summary
In the existing technology, alfalfa lacks tolerance to glyphosate and glufosinate herbicides, which makes weed control difficult, affects yield and quality, and the application scope of existing herbicides is limited.
By inserting exogenous DNA fragments into the alfalfa genome, glyphosate and glufosinate tolerance was conferred using the IVA-EPSPS and RePAT genes. Single-copy plants, TWMS2-17, were screened through herbicide spraying treatment, and the results were combined with the detection methods of characteristic DNA sequences and flanking sequences.
The herbicide-tolerant alfalfa conversion event TWMS2-17 was obtained, achieving high tolerance to glyphosate and glufosinate, reducing planting and management costs, and improving yield and quality.
Smart Images

Figure CN121801959A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of plant biotechnology and plant breeding technology, specifically to the herbicide-tolerant alfalfa transformation event TWMS2-17 and its detection method. Background Technology
[0002] alfalfa ( Medicago sativa Alfalfa is a perennial leguminous forage crop, characterized by high nutritional value, palatability, high yield, and long regeneration time, earning it the title of "King of Forages." It plays an indispensable role in modern animal husbandry. During alfalfa cultivation, weeds fiercely compete with alfalfa for water, nutrients, light, and growing space, directly leading to reduced forage yield and decreased nutritional value. Furthermore, many weeds serve as intermediate hosts for pests and diseases, severely impacting the quality and yield of alfalfa forage and hindering the healthy development of the alfalfa industry. Therefore, efficient weed control is crucial for ensuring improved quality and yield of alfalfa. The use of chemical herbicides can effectively improve weed control efficiency. However, the selective herbicides widely used in the market today require large application rates and have long residual periods, limiting their application scope.
[0003] Glyphosate and glufosinate-ammonium, among other non-selective herbicides, are characterized by high efficiency, low toxicity, easy degradation, and no residue. Glyphosate inhibits the activity of EPSP synthase, thereby blocking the synthesis of aromatic amino acids and ultimately leading to plant death. The active ingredient in glufosinate-ammonium herbicide, L-PPT (L-phosphinothricin), is an inhibitor of glutamine synthetase. Since glutamine synthetase participates in the synthesis of enzymes required for ammonia metabolism, inhibiting glutamine synthetase reduces ammonia metabolism efficiency. Rapidly accumulated ammonia causes the breakdown of plant cell membranes and blocks photosynthesis, ultimately leading to plant wilting and even death. Glufosinate-ammonium is readily and rapidly decomposed in soil, leaving no detectable residues at harvest time, and has no toxic effects on mammals.
[0004] Because glyphosate and glufosinate are non-selective in their herbicidal effects, they cannot be directly applied during the alfalfa growing season. Existing research indicates that... EPSPs Gene transfer into crops can confer glyphosate resistance, PAT , Bar Genes introduced into crops can confer resistance to glyphosate. Therefore, breeding herbicide-tolerant forage grasses through transgenic technology, enabling them to tolerate glyphosate and glufosinate, not only overcomes the selectivity problem of herbicides and reduces weeding costs in forage planting and management, but also facilitates large-scale and mechanized forage production, possessing very broad application value and market potential.
[0005] Currently, there are few studies on introducing herbicide-tolerant genes into alfalfa, and the expression efficiency and herbicide tolerance vary greatly depending on the location of the exogenous gene introduced into the alfalfa genome. Therefore, it is necessary to screen for superior transformation events from a large number of transformation events to enable the exogenous gene to be expressed efficiently and to have glyphosate and glufosinate tolerance, thereby reducing labor costs in alfalfa planting and management and improving planting efficiency. Summary of the Invention
[0006] This invention provides the herbicide-tolerant alfalfa transformation event TWMS2-17, which is obtained by inserting a foreign DNA fragment into the alfalfa genome, followed by herbicide spraying treatment and single-copy plant screening. It also provides characteristic DNA sequences, flanking sequences, or specific detection primer pairs from the transformation event TWMS2-17 for breeding or identification of herbicide-tolerant alfalfa.
[0007] In view of this, the solution of the present invention is as follows: A first aspect of the invention is to provide a characteristic DNA sequence of the herbicide-tolerant alfalfa transformation event TWMS2-17, said characteristic DNA sequence comprising the nucleotide sequence shown in SEQ ID NO: 1, or its complementary sequence.
[0008] Furthermore, the characteristic DNA sequence is located on chromosome 3 of alfalfa.
[0009] A second aspect of the invention is to provide use of the characteristic DNA sequence described in the first aspect, said use comprising at least one of the following: (1) To identify or assist in the identification of herbicide tolerance in alfalfa; (2) Screening or assisting in the screening of new alfalfa varieties with strong herbicide tolerance; (3) Herbicide-tolerant molecular marker-assisted breeding of alfalfa; (4) To prepare products for identification or to assist in the identification of alfalfa's herbicide tolerance; (5) Prepare products for screening or assisting in the screening of new alfalfa varieties with strong herbicide resistance; (6) Prepare products for herbicide-tolerant molecular marker-assisted breeding of alfalfa; The herbicide-resistant types include glufosinate-tolerant and / or glyphosate-tolerant.
[0010] In the above applications, genetic material possessing the herbicide-tolerant alfalfa transformation event TWMS2-17 includes alfalfa plants, alfalfa cells, alfalfa proteins, seeds, progeny plants, or hybrid plants.
[0011] A third aspect of the invention is to provide flanking sequences of the herbicide-tolerant alfalfa transformation event TWMS2-17, comprising a left-bound flanking sequence as shown in SEQ ID NO: 2 and a right-bound flanking sequence as shown in SEQ ID NO: 3.
[0012] A fourth aspect of the invention is to provide primer pairs for detecting the characteristic DNA sequence of the first aspect, comprising: a first primer pair for specifically recognizing a left-border flanking sequence, and / or a second primer pair for specifically recognizing a right-border flanking sequence; the nucleotide sequence of the left-border flanking sequence is as shown in SEQ ID NO: 2, and the nucleotide sequence of the right-border flanking sequence is as shown in SEQ ID NO: 3.
[0013] Further, the first primer pair consists of nucleotide sequences as shown in SEQ ID NO: 4-5, and / or the second primer pair consists of nucleotide sequences as shown in SEQ ID NO: 6-7.
[0014] A fifth aspect of the invention is to provide a detection kit comprising the primer pairs described in the fourth aspect.
[0015] A sixth aspect of the present invention is to provide a method for identifying the characteristic DNA sequence of the alfalfa glyphosate and glufosinate resistance transformation event TWMS2-17 in an alfalfa biosample, the steps of which include: (a) Extracting DNA from alfalfa biological samples; (b) Using the extracted DNA as a template, perform PCR amplification using the primer pairs described in the fourth aspect; (c) The length of the PCR amplification product was compared with the theoretical nucleotide sequence length in the alfalfa transformation event TWMS2-17.
[0016] Compared with the prior art, the present invention has the following beneficial effects: This invention inserts a foreign DNA fragment into the alfalfa genome, and through herbicide spraying treatment and single-copy plant screening, obtains the herbicide-resistant plant TWMS2-17. The characteristic DNA sequence of this transformation event will help control weeds; the detection of the characteristic DNA sequence of the transformation event is of significant value for identifying alfalfa transformation events in samples and for application in breeding alfalfa containing this DNA.
[0017] The herbicide-tolerant alfalfa material developed in this invention can be used to introduce herbicide-tolerant genes into other alfalfa varieties through conventional breeding methods such as hybridization and backcrossing, to further develop new transgenic lines or varieties of herbicide-tolerant alfalfa. Attached Figure Description
[0018] Figure 1 This is a schematic diagram of the T-DNA region of the plant expression vector constructed in Example 1.
[0019] Figure 2 The results show the calculated relative expression levels of the target gene during the TWMS2-17 transformation event in Example 3.
[0020] Figure 3 The results show the herbicide resistance identification of the transgenic alfalfa TWMS2-17 in Example 5.
[0021] Figure 4 The copy number detection results of the exogenous gene in the TWMS2-17 transformation event in Example 6 are shown.
[0022] Figure 5 This is the verification result of the exogenous gene insertion site in the TWMS2-17 transformation event in Example 8.
[0023] Figure 6 The result is the right boundary flanking sequence alignment of the TWMS2-17 transformation event in Example 8.
[0024] Figure 7 The results of sequence alignment of the left boundary flanking side of the TWMS2-17 transformation event in Example 8.
[0025] Figure 8 This is a schematic diagram of the characteristic DNA sequence structure of the TWMS2-17 transformation event in Example 8. Detailed Implementation
[0026] The technical solution of the present invention will now be clearly and completely described in conjunction with preferred embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0027] This invention provides the herbicide-resistant alfalfa transformation event TWMS2-17, in which a foreign DNA fragment is inserted into the alfalfa genome. Herbicide-resistant plants TWMS2-17 are obtained through herbicide spraying treatment and single-copy plant selection. Flanking sequence analysis of the T-DNA insertion site confirms that the foreign gene is inserted into chromosome 3, replacing 270 bp of the genomic sequence. After asexual propagation by cuttings, the plants exhibit excellent resistance to glyphosate and glufosinate, and grow normally.
[0028] The glyphosate-resistant gene used in this invention I. variabilis-EPSPS (Hereinafter abbreviated as) IVA-EPSPsThe gene was isolated and cloned from mutant termites by Professors Liu Ziduo and Lin Yongjun of Huazhong Agricultural University (Patent Application No.: 201610317483.7; Lin Yongjun, Cui Ying, Liu Ziduo: A modified glyphosate-resistant gene and a method for cultivating glyphosate-resistant rice: Publication No. CN107129993A). IVA-EPSPS The original gene length is 1374 bp, encoding 458 amino acids. Plant codon preference was optimized using codon optimization software, and the complete gene sequence is shown in SEQ ID NO:8. This invention utilizes a glufosinate-tolerant gene. RePAT Professors Liu Ziduo and Lin Yongjun from Huazhong Agricultural University discovered the novel coronavirus from deep-sea microorganisms. Rhodococcus sp . strain YM12 was isolated and cloned. RePAT The original gene length was 489 bp, encoding 162 amino acids. Plant codon preference was optimized using codon optimization software, and the complete gene sequence is shown in SEQ ID NO: 9.
[0029] Example 1: Construction of plant expression vectors
[0030] The expression vector construction process of this invention is as follows: In IVA-EPSPs A 133bp UTR1 sequence and a 228bp chloroplast localization signal peptide CTP were added to the 5' end of the gene, utilizing... Xho I enzyme digestion removes the pCAMBIA1300 vector. hpt Genes, and then carry at both ends Xho The UTR1-CTP-EPSPs fragments at the sticky ends were removed. hpt The gene vector was ligated to obtain the intermediate vector pTWMS1. RePAT A 21 bp UTR2 was added to the 5' end of the gene. The synthesized CaMV35s promoter-UTR2-RePAT-CaMV35s polyA sequence was then ligated to the gene. Bam HI and Kpn The intermediate vector pTWMS1, linearized by double enzyme digestion, was used to obtain the final plant expression vector pTWMS2. A schematic diagram of its T-DNA region is shown below. Figure 1 As shown (P35S represents CaMV35s promoter, T35S represents CaMV35s polyA). pTWMS2 was introduced into the Agrobacterium strain. EHA105 Genetically transformed strains were formed and stored at -80°C for later use.
[0031] Example 2: Agrobacterium-mediated genetic transformation of alfalfa
[0032] The alfalfa variety 'Zhongcao 3' was selected as the genetic transformation recipient. The Agrobacterium-mediated genetic transformation method for alfalfa followed the method reported by Jiang et al. (Jiang et al., 2019). The main procedures were: sterile seedling culture, infection and co-culture, callus induction, somatic embryo induction, differentiation culture, and rooting culture. The specific steps are briefly described below: 'Zhongcao 3' alfalfa seeds were treated with 50% 84 disinfectant for 12 minutes, rinsed several times with sterile water, and the surface moisture was absorbed. The seeds were then inoculated onto germination medium and cultured at 24°C under light. After 4-6 weeks, the trifoliate leaves of the sterile seedlings were collected as explants, and the Agrobacterium-mediated bacterial solution was resuspended in suspension medium to OD. 600 The bacterial solution was approximately 0.2-0.3 mg / L, then mixed with the explants. The explants were sequentially subjected to a vacuum drying oven at -0.07 MPa negative pressure for 10 min, followed by ultrasonic treatment at 40 kHz for 4 min, and then a vacuum drying oven at -0.07 MPa negative pressure for 10 min. The bacterial solution was then removed, and the surface of the explants was dried. The explants were then inoculated onto a co-culture medium and cultured in the dark at 24°C. After 24 h of dark culture, the explants were placed on callus induction medium containing 3 mg / L glufosinate and cultured in the dark at 24°C. The induction medium was changed every 2 weeks, for a total of 2 changes. The callus induced in the dark was then transferred to a somatic embryo induction medium containing 2 mg / L glufosinate and cultured under light at 24°C. Two weeks later, the somatic embryo explants were transferred to a differentiation medium containing 2 mg / L glufosinate and cultured under light at 24°C. The differentiation medium was changed every 3 weeks until regenerated plantlets appeared. The differentiated and regenerated seedlings were then transferred to a rooting medium and cultured under light at 24°C for approximately 2 weeks.
[0033] Example 3: PCR positive detection of transformed and regenerated plants
[0034] Total DNA was extracted from the leaves of regenerated plants using the CTAB method (Reference: Murry & Thompson, 1980). This DNA was used for detection. IVA-EPSPsThe two primers used for the gene were: IVA-EPSPsF: 5'-CACCTTCCATTCACCGTTCA-3', and IVA-EPSPsR: 5'-GTGCGGCCAATCTATCAGTC-3'. The PCR product size was 625 bp. The PCR reaction mixture consisted of 100 ng template DNA, 10 μl 2×PCR Mix, 0.3 μl IVA-EPSPsF primer (10 μM), 0.3 μl IVA-EPSPsR primer (10 μM), and ddH2O to a final volume of 20 μl. The PCR program was as follows: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 10 s, 56℃ annealing for 10 s, 72℃ extension for 10 s; repeated for 32 cycles; 72℃ for 5 min; 25℃ for 2 min. The amplified products were detected by electrophoresis on a 1% agarose gel. All T0 generation regenerated plants were subjected to PCR positive detection, and a total of 107 positive transformed plants were obtained.
[0035] Example 4: Detection of exogenous gene expression levels in positively transformed plants
[0036] Total RNA was extracted from alfalfa leaves using TransZol Up reagent (GoldenSmithKline), following the manufacturer's instructions. Goldenstar reagent was used for further analysis. TM The RT6 reverse transcription kit is used for RNA reverse transcription. The operating steps are as follows: 1) Prepare the reaction mixture in a 1.5 mL RNase-free centrifuge tube as follows: 2 μg total RNA, 1 μL gDNA remover, 1 μL 10×gDNA remover buffer, add DEPC water to a final volume of 10 μL, gently mix, and centrifuge briefly. Incubate at 42°C for 2 min, followed by incubation at 60°C for 5 min.
[0037] 3) The above reaction product was cooled on ice, briefly centrifuged, and then the following components were added: 1 μL dNTP Mix, 1 μL LOligo(dT) 17 , 4 μL 5×Goldenstar Buffer, 1 μL DTT, 1 μL Goldenstar RT6, 1 μL DEPC water.
[0038] 4) After gently mixing, briefly centrifuge, incubate at 55°C for 40 min, then at 85°C for 5 min. Add DEPC water to 100 μl of the obtained cDNA for later use.
[0039] use MsActin2The gene was used as an internal reference gene. Primers MsActin2-qRTF and MsActin2-qRTR (Table 1) were designed to detect the quality of cDNA. The PCR reaction system was: 1 μl cDNA, 10 μl 2×PCR Mix, 0.3 μl MsActin2-qRTF primer (10 μM), MsActin2-qRTR primer (10 μM), and ddH2O added to a final volume of 20 μl. The PCR reaction program was: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 10 s, 56℃ annealing for 10 s, 72℃ extension for 10 s; repeated for 30 cycles; 72℃ for 5 min; 25℃ for 2 min. Primers EPSPs-qRTF and EPSPs-qRTR and RePAT-qRTF and RePAT-qRTR (Table 1) were designed to detect the expression level of the exogenous gene. The qPCR reagent used was the full-gold qPCR SuperMix (AQ601). qPCR reactions were performed using a Bio-Rad CFX384 real-time quantitative PCR instrument. The 11 μL qPCR reaction mixture consisted of: 5.1 μL diluted cDNA, 5.5 μL 2×qPCRSYBR Green MIX, 0.2 μL F primer (10 μM), and 0.2 μL R primer (10 μM). The qPCR program was: 95℃, 10 min; 95℃, 10 s, 60℃, 40 s, 40 cycles. Data from the assay were used... -ΔΔCt The computational method was used to calculate the relative expression level of the target gene in the transformed plants. The results are as follows: Figure 2 As shown.
[0040] Table 1: Primers for qRT-PCR detection
[0041] Example 5: Identification of herbicide resistance in transgenic alfalfa
[0042] Transformed plants TWMS2-17 grown in greenhouses were propagated asexually through cuttings. When the cuttings reached approximately 20 cm in height, TWMS2-17 were sprayed with 2000 mg / L and 4000 mg / L glufosinate, as well as glyphosate (Roundup), which was four times the recommended dosage in the pesticide registration list. Damage was observed after 1 and 2 weeks. The results are as follows: Figure 3 As shown, the wild-type plant Zhongcao 3 died one week after treatment with both herbicides, while the transgenic family TWMS2-17 continued to grow normally two weeks after treatment with herbicides and could tolerate 4000 mg / L glufosinate and 4 times the dose of glyphosate.
[0043] Example 6: Detection of copy number of exogenous gene in transgenic plants
[0044] Southern blot was used to detect the copy number of exogenous genes in positive plants. Total DNA was extracted from the leaves of transformed plants using the CTAB method (see Murry & Thompson, 1980). Specific experimental methods for Southern blot were found in the Roche digoxigenin labeling manual. Total DNA was... Eco RI enzyme digestion, IVA-EPSPS The PCR fragment of the gene was used as a hybridization probe, labeled with digoxigenin, and then hybridization detection was performed. Southern blot results showed that TWMS2-17 was a single-copy transgenic family. Figure 4 M: DL2000 DNA Marker; N: Zhongcao No. 3 control; 1 is TWMS2-17 transgenic line).
[0045] Example 7: Insertion site analysis of transformation event TWMS2-17
[0046] The location of exogenous T-DNA insertion into the alfalfa genome in the transformation event TWMS2-17 was analyzed using the FPNI-PCR method (see Wang et al., 2011). Based on the T-DNA sequence of TWMS2, vector-specific primers SP1, SP2, and SP3 (Table 2) were designed for the LB end and used in combination with universal primers FAP1 to FAP9, FSP1, and FSP2 (Table 2) for three rounds of PCR.
[0047] Table 2: Primer Information for FAP1-FAP9, FSP1, and FSP2
[0048] 1) First round of PCR
[0049] The PCR reaction system is as follows: 1 μL DNA (100 ng / ul), 2 μL 10×PCR buffer, 0.2 μL dNTPs (10 mM each), 0.2 μL SP1 (10 μM), 0.5 μL FAP1-FAP9 (10 μM), 0.2 μL rTaq (1 U / μL), and water to a final volume of 20 μL.
[0050] PCR reaction procedure:
[0051] Take 1 μL of the product from the first round of PCR reaction as the template for the second round of PCR reaction.
[0052] 2) Second round of PCR
[0053] PCR reaction system: 1 μL first-round PCR product, 2 μL 10×PCR buffer, 0.2 μL dNTPs (10 mMeach), 0.2 μL SP2 (10 μM), 0.2 μL FSP1 (10 μM), 0.2 μL rTaq (1 U / μL), and water to 20 μL. PCR reaction program: 95℃ for 2 min; 94℃ for 10 sec, 64℃ for 30 sec, 72℃ for 2 min, 30 cycles; 72℃ for 7 min; 25℃ for 1 min. 5 μL of PCR product was analyzed by agarose gel electrophoresis. If a specific band was amplified, 1 μL of the second-round PCR product, diluted 30-fold, was used as the template for the third-round PCR reaction.
[0054] 3) Third round of PCR
[0055] PCR reaction system: 1 μL second-round PCR product (diluted 30-fold), 5 μL 10× PCR buffer, 0.5 μL dNTPs (10 mM each), 0.5 μL SP3 (10 μM), 0.5 μL FSP2 (10 μM), 0.5 μL rTaq (1 U / μL), and water to 50 μL. PCR reaction program: 95℃ for 2 min; 94℃ for 10 sec, 60℃ for 30 sec, 72℃ for 2 min, 32 cycles; 72℃ for 7 min; 25℃ for 1 min. 5 μL of PCR product was subjected to agarose gel electrophoresis. If a specific band was amplified, the remaining PCR stock solution containing a specific fragment greater than 500 bp was sent for sequencing. The sequencing results were compared with the NCBI database to determine the insertion site of T-DNA in the alfalfa genome.
[0056] Example 8: Validation of exogenous gene insertion sites in TWMS2-17
[0057] Based on the flanking sequence isolation results in Example 7, primers (Table 3) were designed for specific PCR verification analysis.
[0058] Table 3: Primers for T-DNA insertion site verification
[0059] The TWMS2-17 genomic DNA sample was amplified by PCR using primers MS2-V1F and MS2-17-gLBR to verify the flanking sequence of the left boundary of the T-DNA insertion site. The TWMS2-17 genomic DNA sample was amplified by PCR using primers MS2-V2F and MS2-17-gRBR to verify the flanking sequence of the right boundary of the T-DNA insertion site.
[0060] PCR reaction system: 100ng template DNA, 10μl 2×PCR Mix, 0.3μl MS2-V1F (or MS2-V2F) primer (10μM), 0.3μl MS2-17-gLBR (or MS2-17-gRBR) primer (10μM), add ddH2O to 20μl.
[0061] PCR reaction program: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 10 s, 58℃ annealing for 15 s, 72℃ extension for 15 s; repeat 32 cycles; 72℃ for 5 min; 25℃ for 2 min. TWMS2-17 amplification results are as follows... Figure 5 As shown (4a is the left flanking sequence verification; 4b is the right flanking sequence verification; M: DL2000 DNA Marker; N: Zhongcao No. 3 control; 1 is the TWMS2-17 transgenic line).
[0062] The left boundary validation showed a specific band at 760 bp, and the right boundary validation showed a specific band at 846 bp. The flanking sequences of the T-DNA were aligned with the Bolivia genome sequence on the NCBI website. The results showed that in the TWMS2-17 transformant, the T-DNA was inserted into chromosome 3 of the alfalfa genome. The right boundary flanking sequence alignment results... Figure 6 As shown, the sequence alignment results of the left boundary flank are as follows: Figure 7 As shown, due to the insertion of T-DNA, a 270bp deletion occurred in the alfalfa genome, with a 54bp insertion near LB and a 43bp insertion near RB. The inserted T-DNA sequence is shown in SEQ ID NO:10. The characteristic DNA sequence structure of the TWMS2-17 transformation event is shown in... Figure 8 As shown, the nucleotide sequence is shown in SEQ ID NO: 1, and the location information of each genetic element in the sequence is shown in Table 4.
[0063] Table 4: Location information of genetic elements in the characteristic DNA sequence of the TWMS2-17 transformation event
[0064] The left-side flanking sequence of T-DNA in the TWMS2-17 transformation event, SEQ ID NO: 2, is shown below (composed of the underlined insertion sequence SEQ ID NO: 11 and the italicized alfalfa genome sequence SEQ ID NO: 12): GTAGTAGTGCAAGAAAAGCAAGAGGCATATATGTCGGCCATCCTATTTTTTCAC TATGAGAATGATGTG AAAATTAACAAAACGAAAAAAAGATGTTGGCATATTAGGGGTTTTTCACTGAGAAGTAACCCAACAGTCTGTCTCTG TCCCAATCCCAATCTACCACGCACTATATAGTACTTCTTTTTACTTTTCTTTATACAATTGCATAAGACACGCTAAT ATATCATATACAAACTCCATTTATTTCATTTCATCATATCATATCATATCATATCTACACTTGCAGCCGTATAGTAT AATGATCTATAACAACCAACAATTGTCACAGACAAACTCTGTCCAACATCTCTTTTAAGCTTCCTTCCTTCCTTCCTTCCTATTGCACACACACAATATTCATCATTCTCTTCTCTTTCTTTCATGTCTCATGCATCTTCTTCCCTCTCTTAAC AAGCTTTAAACCAAAGAAGATTATTTTGTGTTGAGTTGGGTTGGATTTGGAAGAAGGTAGCTTAATTAGGATGATGG CAGTGAGTTCAGGATGCA TTGTTGCCAGTTCTATTAATGCTTGTGATATGTCCTAGCCACAAAATAGATCCAATTTTGGAGCGTGGA CAAATTCCAGTACAAATTAGTACTACCTCCGTCCCGATATAATTGACCTACTTTGGTTTTTCAAACAGATTAAAAAA AGTGTATAAATAAAGAGGAAAGTAGAATATATTGTATTGGGAATGATAAAAGTAGTACTCCCTCCGGTCACTATTAT The right flanking sequence of T-DNA in the TWMS2-17 transformation event, SEQ ID NO: 3, is shown below (composed of the alfalfa genome sequence SEQ ID NO: 13 marked in italics and the insertion sequence SEQ ID NO: 14 marked in underline): AAGCAAAAATCAATTTTTTAGGTTCATTCATTAAATGATGTATTTGGTCCATATTATAGACCAAATACATCATTTAA TGAATGAACCTAAAAAGTTGATTTTTGCTTATAATAGTGACCGGAGGAAGTATTATTTAGTGTTATATTGTATTGGG AATGATAAAAGTTGTATTGAAAATTGAAATGGGTCAGTTATTTTGGGACACTTTTTTTTAGAAAATGGGTCAGTTAT TCCGTGACGGAGGAAGTATTAGTTAATTCCTTACAATTGAATATAGCATATGGGCAGAAGTAGTACATAAATTAGAT TTGATATGAAAAAAGCAAAACAATGTATGCACACATTTTCACTGTCGCTGTGACATAGTGAAAAA TGTATGCACACA TTTTCACTGTCGCTGTGACATATTGTATTTT Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.
Claims
1. The characteristic DNA sequence of the herbicide-tolerant alfalfa transformation event TWMS2-17, characterized in that, The characteristic DNA sequence comprises the nucleotide sequence shown in SEQ ID NO: 1, or its complementary sequence.
2. The characteristic DNA sequence according to claim 1, characterized in that, The characteristic DNA sequence is located on chromosome 3 of alfalfa.
3. The use of the characteristic DNA sequence according to claim 1, characterized in that, The use includes at least one of the following: (1) To identify or assist in the identification of herbicide tolerance in alfalfa; (2) Screening or assisting in the screening of new alfalfa varieties with strong herbicide tolerance; (3) Herbicide-tolerant molecular marker-assisted breeding of alfalfa; (4) To prepare products for identification or to assist in the identification of alfalfa's herbicide tolerance; (5) Prepare products for screening or assisting in the screening of new alfalfa varieties with strong herbicide resistance; (6) Prepare products for herbicide-tolerant molecular marker-assisted breeding of alfalfa; The herbicide-resistant types include glufosinate-tolerant and / or glyphosate-tolerant.
4. The use according to claim 3, characterized in that, Genetic material possessing the herbicide-tolerant alfalfa transformation event TWMS2-17 includes alfalfa plants, alfalfa cells, alfalfa proteins, seeds, progeny plants, or hybrid plants.
5. The flanking sequence of the herbicide-tolerant alfalfa transformation event TWMS2-17, characterized in that, This includes the left flanking sequence of the nucleotide sequence as shown in SEQ ID NO: 2, and the right flanking sequence as shown in SEQ ID NO:
3.
6. A primer pair for detecting the characteristic DNA sequence of claim 1, characterized in that, include: A first primer pair for specifically recognizing the left flanking sequence, and / or a second primer pair for specifically recognizing the right flanking sequence; the nucleotide sequence of the left flanking sequence is shown in SEQ ID NO: 2, and the nucleotide sequence of the right flanking sequence is shown in SEQ ID NO:
3.
7. The primer pair according to claim 6, characterized in that, The first primer pair consists of nucleotide sequences as shown in SEQ ID NO: 4-5, and / or the second primer pair consists of nucleotide sequences as shown in SEQ ID NO: 6-7.
8. A detection kit comprising the primer pair of claim 6 or 7.
9. A method for identifying the characteristic DNA sequence of the TWMS2-17 alfalfa resistance to glyphosate and glufosinate transformation event in alfalfa biological samples, characterized by the following steps: include: (a) Extracting DNA from alfalfa biological samples; (b) Using the extracted DNA as a template, perform PCR amplification using the primer pair described in claim 6 or 7; (c) The length of the PCR amplification product was compared with the theoretical nucleotide sequence length in the alfalfa transformation event TWMS2-17.
Citation Information
Patent Citations
Modified glyphosate-resistant gene and glyphosate-resistant rice cultivation method
CN107129993A
A modified glyphosate-resistant gene and a method for breeding glyphosate-resistant rice.
CN107129993B