Primer pair, kit and detection reagent for detecting genotype of rs339725582 site of pig chromosome 2 and application
By designing specific primer pairs for detecting the rs339725582 locus on pig chromosome 2, and combining them with genotyping technology, the problem of evaluating pork color traits was solved, achieving efficient and accurate breeding results and enhancing the competitiveness of the pig industry.
Patent Information
- Application Number
- CN202610204889.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-12
- Publication Date
- 2026-04-14
AI Technical Summary
Existing technologies make it difficult to quickly and accurately assess pork color traits, resulting in poor breeding outcomes and making it difficult to efficiently select and breed pigs based on meat color traits using traditional methods.
Specific primer pairs were designed to detect the genotype at the rs339725582 locus on pig chromosome 2. Combined with genotyping technology, this enabled accurate and efficient evaluation of the color trait in pork.
It has improved the efficiency and accuracy of breeding for pork color traits, provided a reliable molecular breeding tool, and enhanced the economic benefits and product competitiveness of the pig industry.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular biology technology and relates to a primer pair, kit, detection reagent and application for detecting the genotype of the rs339725582 locus on pig chromosome 2. Background Technology
[0002] Meat color is one of the most direct sensory indicators of pork quality for consumers, directly influencing their purchasing behavior. With intensive selective breeding focusing on growth traits and lean meat percentage, many commercial pig breeds have experienced deterioration in meat color, prompting the breeding community to pay close attention to the selection of pork with optimal color. Pork color is a complex economic trait, influenced not only by genetic background and muscle fiber type, but also by a combination of factors including feeding environment, breed, growth rate, pre-slaughter stress, slaughter and cooling processes, muscle pH dynamics, and myoglobin oxidation state. Instrumental measurement is a commonly used method for determining meat color; L* represents the brightness value, a* represents the redness value, and b* represents the yellowness value.
[0003] The L* value (24h) of pork color is one of the core sensory indicators for evaluating pork quality after slaughter. It is a lightness (brightness) parameter of meat based on the CIE Lab color space; the smaller the value, the darker the meat color, and the larger the value, the lighter the meat color. "24h" refers to the measurement taken 24 hours after slaughter—at this time, the oxidation state of myoglobin in the muscle tends to stabilize, and the meat color no longer fluctuates significantly. This is the industry-recognized standard time point for meat color evaluation. Studies have shown a strong negative correlation between the L* value (24h) and subjective meat color scores (r=-0.60, P<0.01). That is, the lower the L* value, the darker the visual color of the meat, and the higher the subjective score; while an excessively high L* value often corresponds to a lighter, paler color. Therefore, the meat color index is directly related to the sensory quality of pork (consumer acceptance of meat color), freshness, and processing suitability. The ideal range for the L* value of pork is 45-52, which is one of the key bases for determining the commercial value and quality grade of pork.
[0004] Because determining meat color requires slaughter, which is costly and difficult, phenotypic detection is mainly based on physical measurements using optical instruments. Detection of the specific biological substances that contribute to meat color is still limited. This has slowed the development of genetic mechanisms for meat color formation and efficient breeding techniques, making it difficult to directly select pigs for meat color traits using traditional methods. In recent years, with the development of molecular genetics and genomics, researchers have begun to use the association between single nucleotide polymorphism (SNP) markers and pig traits to address this problem. SNP markers are common genomic genetic markers with the advantages of high polymorphism and wide distribution throughout the genome, thus becoming an important tool for studying pig genetic traits.
[0005] Currently, molecular breeding research targeting the color trait of pork has identified several traits, including...MC1R, CAST, TFAM Multiple SNP markers, including those related to meat color, have been identified. However, the genetic explanatory power of these known markers for meat color phenotype remains limited. Therefore, the continued discovery of new SNP markers significantly associated with meat color traits is crucial for elucidating their complex genetic mechanisms and improving the molecular breeding marker system. However, the discovery of new molecular markers is only the first step. Transforming them into detection tools that can be stably applied in breeding practice hinges on designing primer pairs that perfectly match the marker and possess high specificity and amplification efficiency. Developing dedicated primer pairs for newly discovered SNPs enables precise and efficient genotyping of target loci, providing key technical support for verifying the reliability of the association between the marker and meat color traits (such as the L* value at 24 hours post-mortem) and assessing the stability of its effects in different populations and environments. Furthermore, based on stable genotyping data, the interaction of this new marker with other genetic or environmental factors can be explored in depth, systematically elucidating its role in the meat color formation and stable regulatory network.
[0006] Therefore, developing specific primer pairs for newly discovered meat color-related SNP markers is not only a bridge connecting genome discovery and functional verification, but also a core step in promoting the application of these markers from scientific research to breeding, ultimately achieving precise improvement of pork quality. This is of great value in enhancing the competitiveness of the pig breeding industry and meeting the market demand for high-quality pork. Summary of the Invention
[0007] To address the technical problems of difficulty in determining the L* value (24h) phenotype of pork color, slow breeding results, and limited progress in traditional methods, this invention provides a primer pair for detecting the genotype at the rs339725582 locus on pig chromosome 2. Using this primer pair and genotyping technology, the meat color trait of pigs can be rapidly and accurately assessed. This not only improves the accuracy and efficiency of meat color assessment but also provides important molecular genetic evidence for the breeding and improvement of pork color traits.
[0008] The objective of this invention is achieved through the following technical solution: In a first aspect, the present invention provides a primer pair for detecting the genotype of the rs339725582 locus on pig chromosome 2. The rs339725582 locus is the rs339725582 nucleotide site on pig chromosome 2 in the International Pig Genome Version 11.1 reference sequence. It is a SNP marker site associated with the pork color trait, and the SNP marker site exhibits T / C polymorphism. The primer pair includes an upstream primer and a downstream primer. The sequence of the upstream primer is shown in SEQ ID NO: 2, and the sequence of the downstream primer is shown in SEQ ID NO: 3.
[0009] In a second aspect, the present invention provides a kit for identifying the color trait of pork, comprising the primer pair.
[0010] In a third aspect, the present invention provides a detection reagent for SNP markers associated with the color trait of pork, comprising the primer pair described above. In a fourth aspect, the present invention provides the application of the primer pair, the kit, or the detection reagent described herein in the detection of pork color traits and / or in pig breeding.
[0011] As a preferred embodiment of the present invention, the pig is a Large White pig or a Suhuai pig.
[0012] As a preferred embodiment of the present invention, the meat color trait is the meat color L* value 24 hours after slaughter.
[0013] In a fifth aspect, the present invention provides a method for identifying the color trait of pork, comprising the following steps: Genomic DNA was extracted from the pigs to be tested; Using the genomic DNA as a template, PCR amplification was performed using the primer pair described above; The amplified products were sequenced to determine the genotype at position 250 from the 5' end. Based on genotype, the color trait of pork was determined: the L* value of meat color in TT and CT individuals was greater than that in CC individuals.
[0014] As a preferred embodiment of the present invention, the primer pair for PCR amplification includes an upstream primer and a downstream primer, wherein the sequence of the upstream primer is shown in SEQ ID NO: 2 and the sequence of the downstream primer is shown in SEQ ID NO: 3.
[0015] As a preferred embodiment of the present invention, the PCR amplification program is as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 58.7℃ annealing for 15 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 5 min.
[0016] As a preferred embodiment of the present invention, the 25 μL PCR amplification reaction system contains: 1 μL DNA template, 1 μL each of the primers shown in SEQ ID NO: 2 and SEQ ID NO: 3, 9.5 μL ddH2O, and 12.5 μL PCR mix.
[0017] In a sixth aspect, the present invention provides a method for screening pig individuals with high meat color L* values, comprising the following steps: Genomic DNA was extracted from the pigs to be tested; Using the genomic DNA as a template, PCR amplification was performed using the primer pair described above; The amplified products were sequenced to determine the genotype at position 250 from the 5' end. Individuals with the CC genotype were selected as replacement breeding pigs.
[0018] As a preferred embodiment of the present invention, the primer pair includes an upstream primer and a downstream primer, the sequence of the upstream primer is shown in SEQ ID NO: 2, and the sequence of the downstream primer is shown in SEQ ID NO: 3.
[0019] As a preferred embodiment of the present invention, the PCR amplification program is as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 58.7℃ annealing for 15 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 5 min.
[0020] As a preferred embodiment of the present invention, the 25 μL PCR amplification reaction system contains: 1 μL DNA template, 1 μL each of the primers shown in SEQ ID NO: 2 and SEQ ID NO: 3, 9.5 μL ddH2O, and 12.5 μL PCR mix.
[0021] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention develops a SNP marker on pig chromosome 2 associated with the L* value (24h) of pork color and provides primer pairs and methods for detecting this marker. The SNP marker and detection primer pairs provided by this invention enable accurate and rapid identification of the key trait, the L* value (24h) of pork color. Genotyping of this SNP marker allows for efficient screening of individuals with stable L* values within the ideal range, thereby guiding the breeding of pig populations or breeds with superior pork color traits. This not only significantly improves the efficiency and accuracy of breeding for pork color traits, overcoming the limitations of traditional phenotypic determination due to its difficulty and high cost, but also provides a reliable molecular breeding tool for pork quality improvement, which has positive implications for enhancing the economic benefits and product competitiveness of the pig industry. Attached Figure Description
[0022] Figure 1 shows a gel image of PCR amplification of the rs339725582 site on chromosome 2 of Large White pigs.
[0023] Figures 2-4 are examples of genotyping diagrams of the rs339725582 locus on chromosome 2 of Large White pigs. Figure 2 It is of type TT. Figure 3 It is a CT type. Figure 4 It is of type CC. Detailed Implementation
[0024] Embodiments of the present invention are described in detail below, examples of which are illustrated in the accompanying drawings, wherein the same or similar reference numerals denote the same or similar elements or elements having the same or similar functions throughout. The embodiments described below with reference to the accompanying drawings are exemplary and intended to explain the present invention, and should not be construed as limiting the present invention.
[0025] Where no specific technology or conditions are specified in the embodiments, the technology or conditions described in the literature in this field or the product manual shall apply.
[0026] If the manufacturers of the reagents or instruments used are not specified, they are all conventional products that can be obtained commercially.
[0027] Example 1 Determination of SNPSNP markers associated with pork color traits 1. Source of experimental animals Jiangsu Zhengda Suken Pig Industry Co., Ltd.
[0028] 2. Determination of flesh color L* value (24h) The meat color L* value (24h) was measured using a Hunter Lab colorimeter (10° field of view, D65 light source). The colorimeter was first calibrated using a white board and a black board. After slaughter, the longissimus dorsi muscle sample was stored at 4℃ for 24h, and the meat color characteristics of three areas on the sample surface were randomly measured again. The average value was recorded as L* (24h).
[0029] 3. Extracting pig genomic DNA Ear tissue samples were collected from 413 Large White pigs for individual DNA extraction. Referring to the instructions for the Tissue DNA Extraction Kit from Tiangen Biotech Co., Ltd., the extraction steps are as follows: ① First, add 68 mL of anhydrous ethanol to buffer GD and 200 mL of wash buffer PW, respectively, and mix thoroughly.
[0030] ② Collect approximately 100 mg of ear tissue sample and place it in a 2 mL EP tube. After completely cutting it into small pieces, add 200 μL of buffer GA and shake until completely suspended.
[0031] ③ Add 20 μL of proteinase K solution, mix well, and place in a 56 ℃ water bath to digest overnight until the tissue sample dissolves. Briefly centrifuge to remove water droplets from the inner wall of the tube cap.
[0032] ④ Add 200 μL of buffer GB, mix thoroughly by inverting, place in a 70 ℃ metal bath for 10 min, the solution should become clear, and briefly centrifuge to remove water droplets from the inner wall of the tube cap.
[0033] ⑤ Add 200 μL of anhydrous ethanol and shake thoroughly for 15 seconds. At this time, flocculent precipitate may appear. Briefly centrifuge to remove water droplets from the inner wall of the tube cap.
[0034] ⑥ Add the solution and flocculent precipitate obtained in the previous step to an adsorption column CB3, place the adsorption column in the collection tube, then centrifuge at 12,000 rpm for 30 seconds, discard the waste liquid, and put the adsorption column CB3 back into the collection tube.
[0035] ⑦ Add 500 μL of buffer GD to the adsorption column CB3, centrifuge at 12,000 rpm for 30 seconds, discard the waste liquid, and place the adsorption column CB3 into the collection tube. ⑧ Add 600 μL of washing buffer PW to the adsorption column CB3, centrifuge at 12,000 rpm for 30 sec, discard the waste liquid, and place the adsorption column CB3 into the collection tube.
[0036] ⑨ Repeat step ⑧.
[0037] ⑩ Place the adsorption column CB3 back into the collection tube, centrifuge at 12,000 rpm for 2 min, and discard the waste liquid. Place the adsorption column CB3 at room temperature for several minutes to thoroughly dry any residual washing liquid in the adsorption material.
[0038] ⑪ Transfer the adsorption column CB3 into a clean centrifuge tube, add 100 μL of elution buffer TE to the middle of the adsorption membrane, incubate at room temperature for 2-5 min, centrifuge at 12,000 rpm for 2 min, collect the solution into the centrifuge tube, add the centrifuged solution back into the adsorption column CB3, incubate at room temperature for 2 min, centrifuge at 12,000 rpm for 2 min, collect the solution into the centrifuge tube.
[0039] The quality and concentration of DNA were determined using a Nanodrop-2000 spectrophotometer. All DNA concentrations were diluted to 50 ng / μL and stored at -20 ℃ for later use.
[0040] 4. PCR amplification and sequencing of the target fragment PCR amplification was performed using porcine genomic DNA as a template. The reaction system included 1 μL of DNA template, 1 μL each of the primers shown in SEQ ID NO: 2 and SEQ ID NO: 3, 9.5 μL of ddH2O, and 12.5 μL of PCR mix.
[0041] The amplification procedure is as follows: Pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 15 s, annealing at 58.7℃ for 15 s, extension at 72℃ for 30 s, 35 cycles; extension at 72℃ for 5 min. Store at 4℃.
[0042] The primer sequences shown in SEQ ID NO: 2 and SEQ ID NO: 3 are as follows: 5'-TAGGCCAGCCGTTGTAGC-3', SEQ ID NO: 2; 5'-TTTCAGCAGGCAGGGAGT-3', SEQ ID NO: 3.
[0043] The amplified product was subjected to agarose gel electrophoresis. The product fragment size was approximately 482 bp. The electrophoresis results are shown in Figure 1.
[0044] The amplified product sequence is shown in SEQ ID NO: 1: TAGGCCAGCCGTTGTAGC TGTCATTTGACCCCTAGCCTGGGAACCCCCCTATGCTGCGAATGCGGCCCTAAAAAACAAAAGGAAATAAGCAAACAAAGCCCCAAATGCCTCTGGGGGAGCCGCAGTTACTGTCCACATTTAATTGGTCGAGTCTCGATGGCATTCACACTCCTTGTGTTAACTTCAGGCTAAACTGCAAGGTGACAATTAGACAACCCGTCTTAGCCCCAGAGATAAGAAA TTACAAAASTGTCTTTACCTCTCTTTGCGGGGAGGTGGCTCTAGTGTAACCTAGAAAACATAAATCAGACACGTGAAGTTGGGCCATGAATGGGAGAAGCCAGGTGTTCGGATTCAGAATTTTCTGCTTCTGTTTACGTCTGTGACTTCCCCGTTGGTCTCTGCCATGACTCACCCCTTCTCATTTCCATTTTTCAAGGACATCTCATTGGTGTCCATTC ACTCCCTGCCTGCTGAAA S represents the T / C polymorphic site, and the underlined part is the primer sequence.
[0045] The remaining amplification products were sequenced, and the sequencing results were compared and verified for accuracy using DNAman software. Chromas software was used to determine the genotype of the 250th base of the amplification product (i.e., the rs339725582 site on chromosome 2 of the pig genome version 11.1 reference sequence).
[0046] 5. Statistical Analysis Association analysis between genotype and phenotype was performed using a general linear model in SAS 9.4 software. The model is as follows: Y ijk = μ i + B j + G k + e jk; Where Yijk is the individual's flesh-colored L* value; μ i B represents the mean of the group's flesh-colored L* value; j Represents the fixed effects of slaughter batches; G k For the fixed effect of SNP labeling; e jk It is a residual.
[0047] 6. Results Table 1 shows the effect of different genotypes at the rs339725582 locus on the L* value (24h) of pork color in Large White pork.
[0048] Table 1. Association analysis between the rs339725582 locus on chromosome 2 of pigs and the L* value (24h) of pork color in Large White pigs. Note: Different letters in the same row's number superscript indicate extremely significant differences. P <0.01).
[0049] The results showed a significant association between the rs339725582 locus genotype and the meat color L* value phenotype (P<0.001). Specifically, the meat color L* value of CC genotype individuals was significantly lower than that of TT and CT genotype individuals (P<0.001). Although the average L* values of the CC, CT, and TT genotypes were all within the reasonable range for Large White pork color (45–52), the meat color L* value of CC genotype individuals was relatively lower. Considering the significant negative correlation between meat color L* value and subjective meat color score (r = −0.60, P<0.01), the lower the L* value, the darker the visual color of the meat, and the higher the subjective score; excessively high L* values often correspond to a lighter, paler color. Successive generation selection of CC genotype individuals at the rs339725582 locus in Large White pigs is beneficial for reducing the 24-hour meat color brightness value of Large White and Suhuai pig populations within the normal range, thereby improving the stability and consistency of the Large White pork color trait.
[0050] Example 2 Application of SNP markers in identifying the L* value trait of pork color Using the primer pairs shown in SEQ ID NO: 2 and SEQ ID NO: 3 in Example 1, the SNP site rs339725582C>T was genotyped in 290 Suhuai pigs raised at Huaiyin Xinhuai Breeding Pig Farm in Huai'an City, Jiangsu Province. The results are shown in Table 2.
[0051] Table 2. Association analysis between the rs339725582 locus on chromosome 2 of pigs and the L* value (24h) of Suhuai pork color. Note: Different letters in the same row's number superscript indicate significant differences. P <0.05) The results showed that 48 cases were of the TT type, 123 cases were of the CT type, and 119 cases were of the CC type. The flesh color L* value of the TT and CT type individuals was 3.75 and 2.64 higher than that of the CC type individuals, respectively, which was consistent with the actual results.
[0052] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention without departing from the principles and spirit of the present invention.
Claims
1. A primer pair for detecting the genotype at the rs339725582 locus on porcine chromosome 2, characterized in that, The primer pair includes an upstream primer and a downstream primer, the sequence of which is shown in SEQ ID NO: 2, and the sequence of which is shown in SEQ ID NO:
3.
2. A reagent kit for identifying the color trait of pork, characterized in that, It includes the primer pair as described in claim 1.
3. A detection reagent for SNP markers related to the color trait of pork, characterized in that, It includes the primer pair as described in claim 1.
4. The use of the primer pair of claim 1, the kit of claim 2, or the detection reagent of claim 3 in detecting pork color traits and / or in pig breeding.
5. The application according to claim 4, characterized in that, The pigs mentioned are either Large White pigs or Suhuai pigs.
6. The application according to claim 4, characterized in that, The meat color trait is the L* value of the meat color 24 hours after slaughter.
7. A method for identifying the color trait of pork, characterized in that, Includes the following steps: Genomic DNA was extracted from the pigs to be tested; Using the genomic DNA as a template, PCR amplification was performed using the primer pair described in claim 1; The amplified products were sequenced to determine the genotype at position 250 from the 5' end. Based on genotype, the meat color trait of pork was determined as follows: the meat color L* value of CC type individuals was less than that of TT and CT type individuals.
8. A method for screening pig individuals with high meat color L* values, characterized in that, Includes the following steps: Genomic DNA was extracted from the pigs to be tested; Using the genomic DNA as a template, PCR amplification was performed using the primer pair described in claim 1; The amplified products were sequenced to determine the genotype at position 250 from the 5' end. Individuals with the CC genotype were selected as replacement breeding pigs.
9. The method according to claim 7 or 8, characterized in that, The PCR amplification program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 58.7℃ annealing for 15 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 5 min.
10. The method according to claim 7 or 8, characterized in that, The 25 μL PCR amplification reaction system contains: 1 μL DNA template, 1 μL each of the primers shown in SEQ ID NO: 2 and SEQ ID NO: 3, 9.5 μL ddH2O, and 12.5 μL PCR mix.