Primer probe combination, kit and detection system for detecting ameeba histolytica, giardia cyanea and cryptosporidium and application of primer probe combination, kit and detection system for detecting ameeba histolytica, giardia cyanea and cryptosporidium

By designing specific primer-probe combinations and optimizing the reaction system, highly sensitive and specific multiplex nucleic acid detection of Entamoeba histolytica, Giardia lamblia, and Cryptosporidium has been achieved, solving the problems of low detection efficiency and complex operation in existing technologies, and making it suitable for rapid diagnosis in primary healthcare institutions.

CN121874376APending Publication Date: 2026-04-17SHANGHAI NAQUAN BIOMEDICAL TECHNOLOGY CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610052099.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-15
Publication Date
2026-04-17

AI Technical Summary

Technical Problem

Existing technologies are insufficient to achieve highly sensitive and specific multiplex nucleic acid detection for Entamoeba histolytica, Giardia lamblia, and Cryptosporidium. Furthermore, traditional PCR methods are complex to operate and cannot meet the needs of primary healthcare institutions or rapid on-site diagnosis.

Method used

A primer-probe combination, including specific primer pairs and probes, labeled with fluorescent reporter and quencher groups, was designed and combined with real-time PCR. The reaction system was optimized to be fully premixed, providing a multiplex nucleic acid detection kit that supports the simultaneous detection of three parasites.

Benefits of technology

It achieves high-throughput, rapid, and accurate detection of three parasites, is simple to operate, highly sensitive, specific, and has a short reaction time, making it suitable for on-site diagnosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121874376A_ABST
    Figure CN121874376A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of in-vitro molecular detection of pathogenic microorganisms, and particularly relates to a primer probe combination, a kit and a detection system for detecting entamoeba histolytica, giardia lamblia and cryptosporidium and application of the primer probe combination, the kit and the detection system. The primer and probe combination is obtained by optimizing primer and probe design and comprises primers and probes for detecting entamoeba histolytica, giardia blue and cryptosporidium, three types of parasite pathogens can be identified and detected on suspected infected patients at a time, the flux is high, the detection time is short, the detection time is short, and the detection efficiency is high. And the kit has the advantages of strong specificity, high sensitivity, good stability, short reaction time and the like. Furthermore, the kit containing the primer and probe combination is formed by optimizing a reaction system, a single tube in the kit can contain all primers, probes and components required by PCR reaction in a fully premixed form, the reaction system does not need to be prepared, the operation is simple, and the consumed time is short.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of in vitro molecular detection technology for pathogenic microorganisms, specifically relating to a primer and probe combination, reagent kit, detection system, and its application for detecting Entamoeba histolytica, Giardia lamblia, and Cryptosporidium. Background Technology

[0002] Entamoeba histolytica ( Entamoeba histolytica ), Giardia lamblia ( Giardia lamblia ) and Cryptosporidium ( Cryptosporidium parvum These three parasites are major pathogens causing diarrhea and related intestinal infections worldwide. All three are transmitted via the fecal-oral route and are widespread in areas with poor sanitation, particularly in immunocompromised populations (such as HIV-infected individuals, children, and the elderly), where they are prone to causing severe illness. For example, *Entamoeba histolytica* can cause amoebic dysentery and extraintestinal abscesses; *Giardia lamblia* infection often manifests as chronic watery diarrhea and malnutrition; and *Cryptospora*, due to its tolerance to chlorine disinfectants, has become an important pathogen in waterborne outbreaks.

[0003] Currently, detection methods for the aforementioned pathogens mainly include microscopic examination, immunological detection (such as antigen detection kits), and molecular biological methods (such as PCR). While microscopic examination is inexpensive, it relies on the experience of technicians and has a low detection rate for low concentrations of pathogens. Immunological detection (such as colloidal gold assays or immunochromatography) is simple to perform, but suffers from insufficient sensitivity, the risk of cross-reactivity, and missed detections of early infections. For example, existing immunochromatographic kits typically have a sensitivity of less than 90% for detecting Cryptosporidium cysts, while the detection specificity of Giardia lamblia is easily interfered with by other enteric pathogens.

[0004] Molecular biology methods (such as quantitative real-time PCR) are gradually becoming the preferred choice for clinical testing due to their high sensitivity and specificity. However, traditional PCR methods rely on specialized equipment and complex procedures (such as DNA extraction, amplification cycling, and electrophoretic analysis), making it difficult to meet the needs of primary healthcare institutions or rapid on-site diagnosis. Furthermore, existing nucleic acid detection protocols for the three pathogens mentioned above are mostly single-pathogen detection methods or require step-by-step operations, resulting in low detection efficiency. For example, some studies have used LAMP (loop-mediated isothermal amplification) technology to achieve rapid detection of single pathogens, but there are no publicly reported multiplex nucleic acid detection kits and methods that simultaneously cover Entamoeba histolytica, Giardia lamblia, and Cryptosporidium.

[0005] Therefore, there is an urgent need to develop a simple, sensitive, and specific multiplex nucleic acid detection technology that is suitable for rapid on-site detection, in order to simultaneously identify the above three pathogens, improve diagnostic efficiency, and reduce the risk of missed diagnoses. Summary of the Invention

[0006] The purpose of this invention is to provide a primer-probe combination, kit, detection system, and application for detecting Entamoeba histolytica, Giardia lamblia, and Cryptosporidium. The primer-probe combination and the kit containing the primer-probe combination can achieve high-throughput joint detection of multiple pathogens, with high specificity, high sensitivity, and short reaction time.

[0007] This invention provides primer and probe combinations for detecting Entamoeba histolytica, Giardia lamblia, and Cryptosporidium, including a first primer pair and a first probe for detecting Entamoeba histolytica, a second primer pair and a second probe for detecting Giardia lamblia, and a third primer pair and a third probe for detecting Cryptosporidium. The nucleotide sequences of the first primer pair are shown in SEQ ID NO:1 and SEQ ID NO:2, respectively, and the nucleotide sequence of the first probe is shown in SEQ ID NO:3. A first fluorescent reporter group is labeled at the 5' end of SEQ ID NO:3, and a first fluorescent quencher group that quenches the first fluorescent reporter group is labeled at the 3' end. The nucleotide sequences of the second primer pair are shown in SEQ ID NO:4 and SEQ ID NO:5, respectively, and the nucleotide sequence of the second probe is shown in SEQ ID NO:6. A second fluorescent reporter group is labeled at the 5' end of SEQ ID NO:6, and a second fluorescent quencher group that quenches the second fluorescent reporter group is labeled at the 3' end. The nucleotide sequences of the third primer pair are shown in SEQ ID NO:7 and SEQ ID NO:8, respectively, and the nucleotide sequence of the third probe is shown in SEQ ID NO:9. A third fluorescent reporter group is labeled at the 5' end of SEQ ID NO:9, and a third fluorescent quencher group is labeled at the 3' end to quench the third fluorescent reporter group. The first fluorescent reporter group, the second fluorescent reporter group, and the third fluorescent reporter group are all different from each other.

[0008] Preferably, the primer-probe combination further includes an endogenous internal standard primer pair and an internal standard probe. The nucleotide sequences of the endogenous internal standard primer pair are shown in SEQ ID NO:10 and SEQ ID NO:11, respectively. The nucleotide sequence of the internal standard probe is shown in SEQ ID NO:12. A fourth fluorescent reporter group is labeled at the 5' end of SEQ ID NO:12, and a fourth fluorescent quencher group is labeled at the 3' end to quench the fourth fluorescent reporter group. The fourth fluorescent reporter group is different from the first fluorescent reporter group, the second fluorescent reporter group, and the third fluorescent reporter group.

[0009] Preferably, the first, second, third, and fourth fluorescent reporter groups include one or more of FAM, VIC, ROX, Cy3, and Cy5; and the first, second, third, and fourth fluorescent quencher groups include one or more of BHQ1, BHQ2, BHQ3, Dabcy1, and Tamra.

[0010] The present invention also provides a multiplex nucleic acid detection kit for Entamoeba histolytica, Giardia lamblia, and Cryptosporidium, comprising PCR amplification reagents and the primer-probe combination described in the above technical solution.

[0011] Preferably, the PCR amplification reagent includes one or more of PCR buffer, MgCl2, dNTPs, RNase-free water, DNA polymerase, and UDG enzyme.

[0012] Preferably, the multiplex nucleic acid detection kit further includes a positive control and / or a negative control.

[0013] Preferably, the positive control includes one or more of the following: Entamoeba histolytica specific sequence positive plasmid, Giardia lamblia specific sequence positive plasmid, Cryptosporidium specific sequence positive plasmid, and endogenous internal standard positive plasmid; the nucleotide sequences of the specific sequences in the Entamoeba histolytica specific sequence positive plasmid, Giardia lamblia specific sequence positive plasmid, Cryptosporidium specific sequence positive plasmid, and endogenous internal standard positive plasmid are shown in SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, and SEQ ID NO:28, respectively. The negative control includes RNase-free water.

[0014] This invention also provides the application of the primer-probe combination described in the above-mentioned technical solution or the multiplex nucleic acid detection kit described in the above-mentioned technical solution in the preparation of products having one or more of the following functions: 1) Detection of parasitic infections; 2) Diagnosing parasitic infection-related diseases; 3) As an adjunct treatment for parasitic infection-related diseases; The parasites include one or more of Entamoeba histolytica, Giardia lamblia, and Cryptosporidium.

[0015] This invention also provides a detection system for Entamoeba histolytica, Giardia lamblia, and Cryptosporidium, comprising: The sample processing module is used to extract nucleic acid samples from the sample to be tested, and obtain the nucleic acid sample to be tested; A multi-channel sample detection module, connected to the sample processing module, is used to perform real-time fluorescence PCR detection on the nucleic acid sample to be tested and to obtain the real-time fluorescence PCR detection results; the real-time fluorescence PCR detection and acquisition includes: performing real-time fluorescence PCR amplification on the sample to be tested using a primer-probe combination to obtain the real-time fluorescence PCR detection results, wherein the primer-probe combination is the primer-probe combination described in the above technical solution or the primer-probe combination in the multiplex nucleic acid detection kit described in the above technical solution; A multi-channel result output module, connected to the multi-channel sample detection module, is used to output the fluorescence quantitative PCR detection results of the sample to be tested; the output includes: if the Ct of the detection channel labeled by the first probe is ≤38, then the output is positive for Entamoeba histolytica infection; if the Ct of the detection channel labeled by the first probe is >38 or Undet, then the output is negative for Entamoeba histolytica infection. If the Ct of the detection channel marked by the second probe is ≤38, the output is positive for Giardia lamblia infection; if the Ct of the detection channel marked by the second probe is >38 or Undet, the output is negative for Giardia lamblia infection. If the Ct of the detection channel marked by the third probe is ≤38, the output is positive for Cryptosporidium infection; if the Ct of the detection channel marked by the third probe is >38 or Undet, the output is negative for Cryptosporidium infection.

[0016] Preferably, the multi-channel sample detection module includes a sample loading component, which includes detection reagents. With a total volume of 1 unit equal to 10 µL, the detection reagents are: PCR buffer 2 µL, MgCl2 0.06 µL, 100 mM dATP 0.05 µL, 100 mM dGTP 0.05 µL, 100 mM dCTP 0.05 µL, 100 mM dUTP 0.025 µL, 100 mM dTTP 0.025 µL, the upstream and downstream primers of the first primer pair 0.08 µL each, the first probe 0.04 µL, the upstream and downstream primers of the second primer pair 0.08 µL each, the second probe 0.04 µL, the upstream and downstream primers of the third primer pair 0.08 µL each, and the third probe 0.04 µL. µL, 0.08 µL each of the upstream and downstream primers in the endogenous internal standard primer pair, 0.04 µL of internal standard probe, 6.32 µL of RNase-free water, 0.6 µL of 5 U / µL DNA polymerase and 0.02 µL of 10 U / µL UDG enzyme; The program executed in the multi-channel sample detection module is as follows: 95℃ pre-denaturation for 5 min, 1 cycle; 95℃ amplification for 10 sec, 60℃ amplification for 30 sec, 40 cycles.

[0017] Beneficial effects: This invention provides a primer-probe combination, kit, detection system, and applications for detecting Entamoeba histolytica, Giardia lamblia, and Cryptosporidium. The invention optimizes primer and probe design to obtain the primer-probe combination, which includes primers and probes for detecting Entamoeba histolytica, Giardia lamblia, and Cryptosporidium. It enables simultaneous identification and detection of three parasitic pathogens in suspected infected patients, offering high throughput and advantages such as high specificity, high sensitivity, good stability, and short reaction time. Furthermore, this invention optimizes the reaction system to construct a kit containing the primer-probe combination. Each tube in the kit contains all primers, probes, and components required for the PCR reaction in a fully premixed form, eliminating the need for reaction system preparation, simplifying operation, and reducing time consumption.

[0018] In summary, this invention provides a solution that integrates speed, accuracy, and high throughput by optimizing primer design, reaction system, and signal detection method, filling the gap in the field of joint detection of multiple pathogens. Attached Figure Description

[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0020] Figure 1 This is the result of the sensitivity test for Entamoeba histolytica, Giardia lamblia, and Cryptosporidium in Example 4. Figure 2 This is the result of the specificity test for Entamoeba histolytica, Giardia lamblia, and Cryptosporidium in Example 5; Figure 3 This is the result of the repeatability test verification of Entamoeba histolytica, Giardia lamblia and Cryptosporidium in Example 6; exist Figures 1-3 In the diagram, channel 1 represents Cryptosporidium, channel 2 represents Entamoeba histolytica, channel 3 represents Giardia lamblia, and channel 4 represents internal reference. Detailed Implementation

[0021] This invention provides primer and probe combinations for detecting Entamoeba histolytica, Giardia lamblia, and Cryptosporidium, including a first primer pair and a first probe for detecting Entamoeba histolytica, a second primer pair and a second probe for detecting Giardia lamblia, and a third primer pair and a third probe for detecting Cryptosporidium. The nucleotide sequences of the first primer pair are shown in SEQ ID NO:1 and SEQ ID NO:2, respectively, and the nucleotide sequence of the first probe is shown in SEQ ID NO:3. A first fluorescent reporter group is labeled at the 5' end of SEQ ID NO:3, and a first fluorescent quencher group that quenches the first fluorescent reporter group is labeled at the 3' end. The nucleotide sequences of the second primer pair are shown in SEQ ID NO:4 and SEQ ID NO:5, respectively, and the nucleotide sequence of the second probe is shown in SEQ ID NO:6. A second fluorescent reporter group is labeled at the 5' end of SEQ ID NO:6, and a second fluorescent quencher group that quenches the second fluorescent reporter group is labeled at the 3' end. The nucleotide sequences of the third primer pair are shown in SEQ ID NO:7 and SEQ ID NO:8, respectively, and the nucleotide sequence of the third probe is shown in SEQ ID NO:9. A third fluorescent reporter group is labeled at the 5' end of SEQ ID NO:9, and a third fluorescent quencher group is labeled at the 3' end to quench the third fluorescent reporter group. The first fluorescent reporter group, the second fluorescent reporter group, and the third fluorescent reporter group are all different from each other.

[0022] In one embodiment, the primer-probe combination further includes an endogenous internal standard primer pair and an internal standard probe. The nucleotide sequences of the endogenous internal standard primer pair are shown in SEQ ID NO:10 and SEQ ID NO:11, respectively. The nucleotide sequence of the internal standard probe is shown in SEQ ID NO:12. A fourth fluorescent reporter group is labeled at the 5' end of SEQ ID NO:12, and a fourth fluorescent quencher group is labeled at the 3' end to quench the fourth fluorescent reporter group. The fourth fluorescent reporter group is different from the first fluorescent reporter group, the second fluorescent reporter group, and the third fluorescent reporter group.

[0023] In one embodiment, the first, second, third, and fourth fluorescent reporter groups include one or more of FAM, VIC, ROX, Cy3, and Cy5; the first, second, third, and fourth fluorescent quencher groups include one or more of BHQ1, BHQ2, BHQ3, Dabcy1, and Tamra. In an embodiment of the present invention, the 5' end of the first probe is labeled with a VIC fluorescent reporter group, and the 3' end is labeled with a BHQ1 fluorescent quencher group; the 5' end of the second probe is labeled with a ROX fluorescent reporter group, and the 3' end is labeled with a BHQ2 fluorescent quencher group; the 5' end of the third probe is labeled with a FAM fluorescent reporter group, and the 3' end is labeled with a BHQ1 fluorescent quencher group; the 5' end of the internal standard probe is labeled with a Cy5 fluorescent reporter group, and the 3' end is labeled with a BHQ2 fluorescent quencher group.

[0024] The present invention also provides a multiplex nucleic acid detection kit for Entamoeba histolytica, Giardia lamblia, and Cryptosporidium, comprising PCR amplification reagents and the primer-probe combination described in the above technical solution.

[0025] In one embodiment, the PCR amplification reagent includes one or more of PCR buffer, MgCl2, dNTPs, RNase-free water, DNA polymerase, and UDG enzyme; in another embodiment, the dNTPs are dATP, dTTP, dCTP, dGTP, and dUTP.

[0026] In one embodiment, the multiplex nucleic acid detection kit further includes a positive control and / or a negative control. In one embodiment, the positive control includes one or more of the following: *Entamoeba histolytica*-specific sequence positive plasmid, *Giardia lamblia*-specific sequence positive plasmid, *Cryptospora*-specific sequence positive plasmid, and endogenous internal standard positive plasmid; the nucleotide sequences of the specific sequences in the *Entamoeba histolytica*-specific sequence positive plasmid, *Giardia lamblia*-specific sequence positive plasmid, *Cryptospora*-specific sequence positive plasmid, and endogenous internal standard positive plasmid are shown in SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, and SEQ ID NO:28, respectively. In one embodiment, the negative control includes RNase-free water.

[0027] When the multiplex nucleic acid detection kit includes primer and probe combinations, PCR amplification reagents, positive controls, and negative controls, a single tube in the kit can contain all primers, probes, and components required for the PCR reaction in a fully premixed form, eliminating the need for reaction system preparation. This makes the operation simple and time-saving.

[0028] In one embodiment, the concentrations of the first primer pair, the second primer pair, and the third primer pair in the multiplex nucleic acid detection kit are 0.4~0.6 μM, respectively; the concentrations of the first probe, the second probe, and the second probe are 0.25~0.35 μM, respectively; and the concentrations of the endogenous internal standard primer and the endogenous probe are 0.15~0.25 μM, respectively.

[0029] This invention also provides the application of the primer-probe combination described in the above-mentioned technical solution or the multiplex nucleic acid detection kit described in the above-mentioned technical solution in the preparation of products having one or more of the following functions: 1) Detection of parasitic infections; 2) Diagnosing parasitic infection-related diseases; 3) As an adjunct treatment for parasitic infection-related diseases; The parasites include one or more of Entamoeba histolytica, Giardia lamblia, and Cryptosporidium.

[0030] In one embodiment, the product may be a reagent and / or a pharmaceutical product. In another embodiment, the parasitic infection-related disease may be at least one gastrointestinal disease such as intestinal amebiasis, extraintestinal amebiasis, chronic diarrhea, and cryptosporidiosis.

[0031] This invention also provides a detection system for Entamoeba histolytica, Giardia lamblia, and Cryptosporidium, comprising: The sample processing module is used to extract nucleic acid samples from the sample to be tested, and obtain the nucleic acid sample to be tested; A multi-channel sample detection module, connected to the sample processing module, is used to perform real-time fluorescence PCR detection on the nucleic acid sample to be tested and to obtain the real-time fluorescence PCR detection results; the real-time fluorescence PCR detection and acquisition includes: performing real-time fluorescence PCR amplification on the sample to be tested using a primer-probe combination to obtain the real-time fluorescence PCR detection results, wherein the primer-probe combination is the primer-probe combination described in the above technical solution or the primer-probe combination in the multiplex nucleic acid detection kit described in the above technical solution; A multi-channel result output module, connected to the multi-channel sample detection module, is used to output the fluorescence quantitative PCR detection results of the sample to be tested; the output includes: if the Ct of the detection channel labeled by the first probe is ≤38, then the output is positive for Entamoeba histolytica infection; if the Ct of the detection channel labeled by the first probe is >38 or Undet, then the output is negative for Entamoeba histolytica infection. If the Ct of the detection channel marked by the second probe is less than or equal to 38, the output is positive for Giardia lamblia infection; if the Ct of the detection channel marked by the second probe is greater than or equal to 38 or Undet, the output is negative for Giardia lamblia infection. If the Ct of the detection channel marked by the third probe is less than or equal to 38, the output is positive for Cryptosporidium infection; if the Ct of the detection channel marked by the third probe is greater than or equal to 38 or Undet, the output is negative for Cryptosporidium infection.

[0032] In one implementation, the detection system includes: a sample processing module for extracting nucleic acid samples from the sample to be tested to obtain the nucleic acid sample to be tested; A multi-channel sample detection module, connected to the sample processing module, is used to perform quantitative real-time PCR detection on the nucleic acid sample to be tested, the positive control, and the negative control, and to obtain the quantitative real-time PCR detection results. The quantitative real-time PCR detection and acquisition includes: using a primer-probe combination to perform quantitative real-time PCR amplification on the sample to be tested, the positive control, and the negative control, respectively, to obtain the quantitative real-time PCR detection results for the sample to be tested, the positive control, and the negative control. The primer-probe combination is the primer-probe combination described in the above technical solution or the primer-probe combination in the multiplex nucleic acid detection kit described in the above technical solution. A multi-channel result output module, connected to the multi-channel sample detection module, is used to output the fluorescence quantitative PCR detection results of the sample to be tested; the output includes: When the Ct value of the negative control detection channel labeled by the first probe is Undet, and the Ct value of the positive control detection channel labeled by the first probe is ≤32, the detection result of the sample to be tested is interpreted; otherwise, the test is repeated. If the Ct value of the detection channel of the sample to be tested labeled by the first probe is ≤38, the result is positive for Entamoeba histolytica infection. If the Ct value of the detection channel of the sample to be tested labeled by the first probe is >38 or Undet, the result is negative for Entamoeba histolytica infection. When the Ct value of the negative control detection channel labeled by the second probe is Undet, and the Ct value of the positive control detection channel labeled by the second probe is ≤32, the test result of the sample to be tested is interpreted; otherwise, the test is repeated. If the Ct value of the test sample detection channel labeled by the second probe is ≤38, the result is positive for Giardia lamblia infection. If the Ct value of the test sample detection channel labeled by the second probe is >38 or Undet, the result is negative for Giardia lamblia infection. When the Ct value of the negative control detection channel labeled by the third probe is Undet, and the Ct value of the positive control detection channel labeled by the third probe is ≤32, the detection result of the sample to be tested is interpreted; otherwise, the test is repeated. If the Ct value of the detection channel of the sample to be tested labeled by the third probe is ≤38, the result is positive for Cryptosporidium infection. If the Ct value of the detection channel of the sample to be tested labeled by the third probe is >38 or Undet, the result is negative for Cryptosporidium infection.

[0033] In one embodiment, the multi-channel sample detection module includes a sample loading component, which includes detection reagents. With a total volume of 1 unit equal to 10 µL, the detection reagents are: PCR buffer 2 µL, MgCl2 0.06 µL, 100 mM dATP 0.05 µL, 100 mM dGTP 0.05 µL, 100 mM dCTP 0.05 µL, 100 mM dUTP 0.025 µL, 100 mM dTTP 0.025 µL, the upstream and downstream primers of the first primer pair 0.08 µL each, the first probe 0.04 µL, the upstream and downstream primers of the second primer pair 0.08 µL each, the second probe 0.04 µL, the upstream and downstream primers of the third primer pair 0.08 µL each, and the third probe 0.04 µL. µL, 0.08 µL each of the upstream and downstream primers in the endogenous internal standard primer pair, 0.04 µL of the internal standard probe, 6.32 µL of RNase-free water, 0.6 µL of 5 U / µL DNA polymerase and 0.02 µL of 10 U / µL UDG enzyme.

[0034] As one implementation method, the program executed in the multi-channel sample detection module of the present invention is as follows: pre-denaturation at 95℃ for 5 minutes, 1 cycle; amplification at 95℃ for 10 seconds, amplification at 60℃ for 30 seconds, 40 cycles. It can be seen from the execution program of the multi-channel sample detection module of the present invention that the detection time of the present invention is significantly shorter than that of conventional parasite detection methods.

[0035] The detection system described in this invention is a product for detecting Entamoeba histolytica, Giardia lamblia, and Cryptosporidium, rather than a simple detection step. Its sample detection module and sample output module can be executed by a computer, and can be subsequently developed into a mature software product.

[0036] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0037] Unless otherwise specified, all reagents and biological materials used in the following embodiments are commercial products.

[0038] Example 1 Preparation of a rapid multiplex nucleic acid detection kit for Entamoeba histolytica, Giardia lamblia, and Cryptosporidium. (1) Synthesis of primers and probes The preferred primer and probe sequences are shown in Table 1, and the alternative primer and probe sequences are shown in Table 2.

[0039] Table 1. Preferred primer and probe sequences

[0040] Table 2. Alternative Primer and Probe Sequences

[0041] (2) Plasmid sequence synthesis The specific sequences of the three pathogens and the sequence of the internal reference gene RNase P were ligated into the pUC57 vector to synthesize four plasmid standards. Plasmid construction was completed by Shanghai Diwin Biotechnology Co., Ltd., and the sequence information is as follows: The plasmid insertion sequence of Entamoeba histolytica: GGGAGAGGTGAAAATCCATGATCGCTATAAGATGCACGAGAGCGAAAGCATTTCACTCAACTGTGTCCATTAATCAAGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCCTAACTATAAACGATGTCAACCAAGGATTGGATGAAATTCAGATGTACAAAGATAGAGAAGCATTGTTTCTAGATCTGA (SEQ ID NO: 25); Giardia lamblia plasmid insertion sequence: GCTTCTCGCAAGCAAACTGGGCAACGTTGCCGGAGCCAGAAAGAAGGACGTTCTTACCCCTGATCACAATGTTGTTGTCCTTGCACATCTCCTCCAGGAAGTAGACAGCGCCATAGCCCGTAGCCTCCGGCCTGATGAAAGACCCGCCCCACTTGACGTTCTTGCCTGTGAGGACGCCTGTGAACTCGTTCCTCAGGCGCT (SEQ ID NO: 26); Cryptosporidium plasmid insertion sequence: GTTCAATCAGACACAGCTCCTCCTAATCCAGAATGTCCTCCAGGCACTATACTGGAGAATGGCACATGTAAATTAATTCAACAAATTGATACCGTTTGTCCTTCTGGTTTTGTTGAAGAAGGAAATAGATGTGTTCAATATCTCCCTGCAAATAAAATCTGTCCTCCTGGATTCAATTTGTCAGGACAACAATGTATGGCA (SEQ ID NO: 27); Insertion sequence of internal reference gene RNase P plasmid: AAGGCGGGCAGGCCCATCGGTGCTGCTGTGTGGCTGATCGGACTGGCCACTCGCTATTGCACACCTTATATGGAAGGTCTCTGCGATATGATACCAGCTATTTTGTGGAGTATTTTGCCTTGGATCTCCTGATGGAGAATGGGGAGTGCCGTGGTGTCATCGCACTGTGCATAGAGGACGGGTCCATCCATCGCATAAGA (SEQ ID NO: 28).

[0042] (3) Composition and preparation of nucleic acid amplification reaction solution Prepare the nucleic acid amplification reaction solution according to Table 3.

[0043] Table 3 Nucleic Acid Amplification Reaction Solution

[0044] (4) Positive control Prepare the positive control according to Table 4. Table 4. Preparation of positive control

[0045] (5) Negative control RNase-free water.

[0046] Example 2 The instructions for using the rapid multiplex nucleic acid detection kit for Entamoeba histolytica, Giardia lamblia, and Cryptosporidium are as follows: (1) Reagent preparation (Reagent preparation area) Take out the kit from Example 1, melt it at room temperature and mix it by shaking. Centrifuge at low speed for 10 seconds. Please label each tube of reaction solution to avoid misinterpretation of the test results.

[0047] PCR reaction solution aliquoting: Calculate the number of reaction reagents required N (N = number of samples + 1 positive control tube + 1 negative control tube), and aliquot each PCR reaction system into PCR reaction tubes at 15 µL / tube.

[0048] (2) Sample processing (sample processing area) Nucleic acid extraction: Take the sample to be tested and extract nucleic acid using a commercial nucleic acid extraction kit, following the instructions in the kit's manual.

[0049] Add samples: Add 5 µL each of the prepared nucleic acid sample to be tested, negative control, and positive control to the prepared PCR reaction tubes, with a final volume of 20 µL / tube. Tighten the caps and centrifuge briefly at low speed.

[0050] (3) PCR amplification detection (nucleic acid amplification area) Place the reaction tube into the fluorescent PCR amplification instrument and set the reaction program to perform amplification and detection.

[0051] Table 5 Reaction Program Settings

[0052] Note: During the amplification step, fluorescence detection is performed at 60℃, with the detection channels being FAM, VIC, ROX, and Cy5; for ABI series fluorescence PCR instruments, ROX calibration is not selected, and the quenching group is set to None.

[0053] (4) Results Analysis Adjust the start and end values ​​based on the analyzed images (it is recommended to set the start value to 3-15 and the end value to 5-20, and at the same time adjust the amplification curve of the negative control to be flat or below the threshold line). Click "Analyze" and view the results in the report interface.

[0054] (5) Interpretation of test results Table 6 Quality Control

[0055] Table 7 Result Interpretation

[0056] Example 3 Screening of primers and probes for a rapid multiplex nucleic acid detection kit for Entamoeba histolytica, Giardia lamblia, and Cryptosporidium. The reagents prepared by the preferred primer-probe combinations SEQ ID NO:1~12 of this invention were compared with the reagents prepared by the alternative primer-probe combinations SEQ ID NO:13~24. The nucleic acid reaction solution of the alternative primer-probe combinations was prepared according to the ratio in Table 3. The difference was that the alternative primer-probe combinations SEQ ID NO:13~24 were used instead of the preferred primer-probe combinations SEQ ID NO:1~12. The comparison test was carried out as in Example 2. The experimental results are shown in Table 8.

[0057] Table 8 Comparison of the results of the preferred primer-probe combinations and the alternative primer-probe combinations.

[0058] The results in Table 8 show that the detection Ct values ​​of each target in the preferred group are earlier than those in the alternative group, indicating that the primer-probe combination of the preferred group has better performance.

[0059] Example 4 Sensitivity validation of a rapid multiplex nucleic acid detection kit for Entamoeba histolytica, Giardia lamblia, and Cryptosporidium. The specific sequences of three pathogens and the sequence of the internal reference gene RNase P were ligated into the pUC57 vector to synthesize three plasmid standards. Plasmid construction was completed by Shanghai Diwin Biotechnology Co., Ltd., and the concentration was determined using a UV spectrophotometer. The copy number of each plasmid was calculated based on its length and concentration using the following formula: (copies / µL) = [plasmid concentration (ng / µL) × 10] -9 ×6.02×10 23 ] / (number of bases × 660); The copy number results are shown in Table 9: Table 9 Plasmid copy number results

[0060] The quantified plasmids were diluted to 0.5 copies / µL. Sensitivity experiments were performed using this concentration of plasmid as a template. At least eight wells were tested repeatedly to determine the sensitivity of this kit at this concentration. Amplification systems were prepared according to Table 3, and amplification conditions were set according to Table 5. Experimental results are shown in Table 10 and... Figure 1 As shown.

[0061] Table 10 Sensitivity Verification Results

[0062] from Figure 1 As can be seen from the results, the positive detection rates of Entamoeba histolytica, Giardia lamblia, and Cryptosporidium were all 100% at a concentration gradient of 0.5 copies / µL. Therefore, the detection sensitivity of Entamoeba histolytica, Giardia lamblia, and Cryptosporidium in this kit is no higher than 0.5 copies / µL.

[0063] Example 5 Specificity validation of a rapid multiplex nucleic acid detection kit for Entamoeba histolytica, Giardia lamblia, and Cryptosporidium. The specificity of this kit was verified by using *Escherichia coli*, *Vibrio cholerae*, *Salmonella*, *Shigella*, *Salmonella typhi*, *Salmonella paratyphi*, *Vibrio parahaemolyticus*, *Staphylococcus aureus*, *Campylobacter jejuni*, and *Campylobacter coli* at concentrations not less than 100 copies / µL. The amplification systems were prepared according to Table 3, and the amplification conditions were set according to Table 5. The experimental results are shown in Table 11 and... Figure 2 As shown.

[0064] Table 11 Specificity validation results of the rapid multiplex nucleic acid detection kit for Entamoeba histolytica, Giardia lamblia, and Cryptosporidium.

[0065] from Figure 2 As can be seen from the results, this kit has good specificity and does not produce cross-reactions with other intestinal pathogens or common bacteria.

[0066] Example 6 Repeatability validation of a rapid multiplex nucleic acid detection kit for Entamoeba histolytica, Giardia lamblia, and Cryptosporidium. The quantified plasmids were diluted to 20 copies / µL, and this concentration was used as a template for repeatability experiments. Two groups were tested in total, with each group repeated four times. The CV value was calculated based on the experimental results. The amplification systems were prepared according to Table 3, and the amplification conditions were set according to Table 5. The experimental results are shown in Tables 12 and 13. Figure 3 As shown.

[0067] Table 12. Repeatability validation results of the rapid multiplex nucleic acid detection kit for Entamoeba histolytica, Giardia lamblia, and Cryptosporidium.

[0068] from Figure 3 As can be seen from the results, the CV of the repeated detection Ct values ​​of Entamoeba histolytica, Giardia lamblia, and Cryptosporidium at a concentration gradient of 20 copies / µL all meet the index of ≤5%. Therefore, this kit has good repeatability and high stability.

[0069] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A primer-probe combination for detecting Entamoeba histolytica, Giardia lamblia, and Cryptosporidium, characterized in that, This includes the first primer pair and first probe for detecting Entamoeba histolytica, the second primer pair and second probe for detecting Giardia lamblia, and the third primer pair and third probe for detecting Cryptosporidium. The nucleotide sequences of the first primer pair are shown in SEQ ID NO:1 and SEQ ID NO:2, respectively, and the nucleotide sequence of the first probe is shown in SEQ ID NO:

3. A first fluorescent reporter group is labeled at the 5' end of SEQ ID NO:3, and a first fluorescent quencher group that quenches the first fluorescent reporter group is labeled at the 3' end. The nucleotide sequences of the second primer pair are shown in SEQ ID NO:4 and SEQ ID NO:5, respectively, and the nucleotide sequence of the second probe is shown in SEQ ID NO:

6. A second fluorescent reporter group is labeled at the 5' end of SEQ ID NO:6, and a second fluorescent quencher group that quenches the second fluorescent reporter group is labeled at the 3' end. The nucleotide sequences of the third primer pair are shown in SEQ ID NO:7 and SEQ ID NO:8, respectively, and the nucleotide sequence of the third probe is shown in SEQ ID NO:

9. A third fluorescent reporter group is labeled at the 5' end of SEQ ID NO:9, and a third fluorescent quencher group is labeled at the 3' end to quench the third fluorescent reporter group. The first fluorescent reporter group, the second fluorescent reporter group, and the third fluorescent reporter group are all different from each other.

2. The primer-probe combination according to claim 1, characterized in that, The primer-probe combination further includes an endogenous internal standard primer pair and an internal standard probe. The nucleotide sequences of the endogenous internal standard primer pair are shown in SEQ ID NO:10 and SEQ ID NO:11, respectively. The nucleotide sequence of the internal standard probe is shown in SEQ ID NO:

12. A fourth fluorescent reporter group is labeled at the 5' end of SEQ ID NO:12, and a fourth fluorescent quencher group is labeled at the 3' end to quench the fourth fluorescent reporter group. The fourth fluorescent reporter group is different from the first fluorescent reporter group, the second fluorescent reporter group, and the third fluorescent reporter group.

3. The primer-probe combination according to claim 1 or 2, characterized in that, The first, second, third, and fourth fluorescent reporter groups include one or more of FAM, VIC, ROX, Cy3, and Cy5; the first, second, third, and fourth fluorescent quencher groups include one or more of BHQ1, BHQ2, BHQ3, Dabcy1, and Tamra.

4. A multiplex nucleic acid detection kit for Entamoeba histolytica, Giardia lamblia, and Cryptosporidium, characterized in that, It includes PCR amplification reagents and the primer-probe combination as described in any one of claims 1 to 3.

5. The multiplex nucleic acid detection kit according to claim 4, characterized in that, The PCR amplification reagents include one or more of the following: PCR buffer, MgCl2, dNTPs, RNase-free water, DNA polymerase, and UDG enzyme.

6. The multiplex nucleic acid detection kit according to claim 4 or 5, characterized in that, The multiplex nucleic acid detection kit also includes a positive control and / or a negative control.

7. The multiplex nucleic acid detection kit according to claim 6, characterized in that, The positive control includes one or more of the following: Entamoeba histolytica specific sequence positive plasmid, Giardia lamblia specific sequence positive plasmid, Cryptosporidium specific sequence positive plasmid, and endogenous internal standard positive plasmid; the nucleotide sequences of the specific sequences in the Entamoeba histolytica specific sequence positive plasmid, Giardia lamblia specific sequence positive plasmid, Cryptosporidium specific sequence positive plasmid, and endogenous internal standard positive plasmid are shown in SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, and SEQ ID NO:28, respectively. The negative control includes RNase-free water.

8. The use of the primer-probe combination according to any one of claims 1 to 3 or the multiplex nucleic acid detection kit according to any one of claims 4 to 7 in the preparation of products having one or more of the following functions: 1) Detection of parasitic infections; 2) Diagnosing parasitic infection-related diseases; 3) As an adjunct treatment for parasitic infection-related diseases; The parasites include one or more of Entamoeba histolytica, Giardia lamblia, and Cryptosporidium.

9. A detection system for Entamoeba histolytica, Giardia lamblia, and Cryptosporidium, characterized in that, include: The sample processing module is used to extract nucleic acid samples from the sample to be tested, and obtain the nucleic acid sample to be tested; A multi-channel sample detection module, connected to the sample processing module, is used to perform real-time quantitative PCR detection on the nucleic acid sample to be tested and to obtain the real-time quantitative PCR detection results; The fluorescence quantitative PCR detection and acquisition includes: performing fluorescence quantitative PCR amplification on the sample to be tested using a primer probe combination to obtain fluorescence quantitative PCR detection results, wherein the primer probe combination is the primer probe combination according to any one of claims 1 to 3 or the primer probe combination in the multiplex nucleic acid detection kit according to any one of claims 4 to 7; A multi-channel result output module, connected to the multi-channel sample detection module, is used to output the fluorescence quantitative PCR detection results of the sample to be tested; the output includes: if the Ct of the detection channel labeled by the first probe is ≤38, then the output is positive for Entamoeba histolytica infection; if the Ct of the detection channel labeled by the first probe is >38 or Undet, then the output is negative for Entamoeba histolytica infection. If the Ct of the detection channel marked by the second probe is less than or equal to 38, the output is positive for Giardia lamblia infection; if the Ct of the detection channel marked by the second probe is greater than or equal to 38 or Undet, the output is negative for Giardia lamblia infection. If the Ct of the detection channel marked by the third probe is less than or equal to 38, the output is positive for Cryptosporidium infection; if the Ct of the detection channel marked by the third probe is greater than or equal to 38 or Undet, the output is negative for Cryptosporidium infection.

10. The detection system according to claim 9, characterized in that, The multi-channel sample detection module includes a sample loading component, which includes detection reagents. The total amount of the detection reagents, calculated as 1 unit = 10 µL, consists of: 2 µL PCR buffer, 0.06 µL MgCl2, 0.05 µL 100 mM dATP, 0.05 µL 100 mM dGTP, 0.05 µL 100 mM dCTP, 0.025 µL 100 mM dUTP, 0.025 µL 100 mM dTTP, 0.08 µL each of the upstream and downstream primers in the first primer pair, 0.04 µL of the first probe, 0.08 µL each of the upstream and downstream primers in the second primer pair, 0.04 µL of the second probe, and 0.08 µL each of the upstream and downstream primers in the third primer pair, and 0.04 µL of the third probe. µL, 0.08 µL each of the upstream and downstream primers in the endogenous internal standard primer pair, 0.04 µL of internal standard probe, 6.32 µL of RNase-free water, 0.6 µL of 5 U / µL DNA polymerase and 0.02 µL of 10 U / µL UDG enzyme; The program executed in the multi-channel sample detection module is as follows: 95℃ pre-denaturation for 5 min, 1 cycle; 95℃ amplification for 10 sec, 60℃ amplification for 30 sec, 40 cycles.